When several alleles are shown, the nucleotide mutations are indicated in red letters. These polymorphic mutations are reported in Tables of alleles.
Dashes indicate identical nucleotides. Dots indicate gaps by comparison to the longest sequence. Blanks indicate partial sequences (blanks at the 5' and/or 3' end).

                                   Direct 5'- 3' orientation                             Inverted orientation
					
                                 A  Y  T  S  S  S  G  Y  Y  I                            V  Y  N  N  H  Y  Y  *  Y  M  
                                  H  I  L  V  V  V  V  I  I  Y                            Y  I  I  T  T  T  T  S  I  C  
                                   I  Y  *  *  *  W  L  L  Y                               I  *  *  P  L  L  L  V  Y  
AY386697 ,IGHD1-1*01(1)         gcatatactagtagtagtggttattatatac                         gtatataataaccactactactagtatatgc

                                  S  Y  D  D  Y  G  D  Y                                 V  I  T  I  V  I  V  A     
                                   A  T  M  T  M  V  I                                    *  S  P  *  S  S  *  L  
                                 *  L  R  *  L  W  *  L                                    N  H  H  S  H  R  S     
AY386697 ,IGHD2-1*01(1)         tagctacgatgactatggtgattac                               gtaatcaccatagtcatcgtagcta  

                                  S  Y  D  D  Y  G  D  Y                                  V  I  T  I  V  I  V  A     
                                   A  T  M  T  M  V  I                                     *  S  P  *  S  S  *  L  
                                 *  L  R  *  L  W  *  L                                     N  H  H  S  H  R  S     
AY386695 ,IGHD2-2*01(1)         tagctacgatgactatggtgattac                                gtaatcaccatagtcatcgtagcta  

                                  S  Y  D  D  Y  G  D  Y                                  V  I  T  I  V  I  V  A     
                                   A  T  M  T  M  V  I                                     *  S  P  *  S  S  *  L  
                                 *  L  R  *  L  W  *  L                                     N  H  H  S  H  R  S     
AY386695 ,IGHD2-3*01(1)         tagctacgatgactatggtgattac                                gtaatcaccatagtcatcgtagcta  

                                  S  Y  D  D  Y  G  D  Y                                  V  I  T  I  V  I  V  A     
                                   A  T  M  T  M  V  I                                     *  S  P  *  S  S  *  L  
                                 *  L  R  *  L  W  *  L                                     N  H  H  S  H  R  S     
AY386695 ,IGHD2-4*01(1)         tagctacgatgactatggtgattac                                gtaatcaccatagtcatcgtagcta  

                                 P  M  G  S  W  F  P  W  L  W  G                          N  P  I  A  M  G  T  R  T  P  *  
                                  L  W  G  P  G  S  H  G  Y  G  V                          T  P  *  P  W  E  P  G  P  H  R  
                                   Y  G  V  L  V  P  M  A  M  G                             P  H  S  H  G  N  Q  D  P  I  
AY386695 ,IGHD3-1*01            cctatggggtcctggttcccatggctatggggtt                       aaccccatagccatgggaaccaggaccccatagg

                                 P  M  G  S  W  F  P  W  L  W  G                          N  P  I  A  M  G  T  R  T  P  *  
                                  L  W  G  P  G  S  H  G  Y  G  V                          T  P  *  P  W  E  P  G  P  H  R  
                                   Y  G  V  L  V  P  M  A  M  G                             P  H  S  H  G  N  Q  D  P  I  
AY386697 ,IGHD3-1*01(3)         cctatggggtcctggttcccatggctatggggtt                       aaccccatagccatgggaaccaggaccccatagg

                                 P  M  G  S  W  F  P  W  L  W  G                          N  P  I  A  M  G  T  R  T  P  *  
                                  L  W  G  P  G  S  H  G  Y  G  V                          T  P  *  P  W  E  P  G  P  H  R  
                                   Y  G  V  L  V  P  M  A  M  G                             P  H  S  H  G  N  Q  D  P  I  
AY386695 ,IGHD3-2*01            cctatggggtcctggttcccatggctatggggtt                       aaccccatagccatgggaaccaggaccccatagg

                                 P  M  G  S  L  F  P  W  L  C  S                          D  C  I  A  M  G  T  R  T  P  *  
                                  L  W  G  P  C  S  H  G  Y  A  V                          T  A  *  P  W  E  Q  G  P  H  R  
                                   Y  G  V  L  V  P  M  A  M  Q                             L  H  S  H  G  N  K  D  P  I  
AY386695 ,IGHD3-3*01(3)         cctatggggtccttgttcccatggctatgcagtc                       gactgcatagccatgggaacaaggaccccatagg

                                 V  T  I  V  V  A  G  V                                  H  P  S  H  Y  Y  S  N  
                                  L  L  *  *  W  L  G                                     T  P  A  T  T  I  V  
                                   Y  Y  S  S  G  W  G                                     P  Q  P  L  L  *  *  
AY386697 ,IGHD4-1*01(1)         gttactatagtagtggctggggtg                                 caccccagccactactatagtaac

                                 V  M  L  V  V  A  G  M                                   H  P  S  Y  Y  Q  H  N  
                                  L  C  W  *  *  L  G                                      I  P  A  T  T  S  I  
                                   Y  A  G  S  S  W  D                                      S  Q  L  L  P  A  *  
AY386695 ,IGHD4-2*01(1)         gttatgctggtagtagctgggatg                                 catcccagctactaccagcataac

                                  F  G  E  G  P  T  H  H  V  A  M  V  V                   V  T  T  I  A  T  W  W  V  G  P  S  P  N  
                                   L  V  K  G  R  P  T  M  *  L  W  *  L                   *  L  P  *  L  H  G  G  S  A  L  H  Q     
                                 I  W  *  R  A  D  P  P  C  S  Y  G  S  Y                   N  Y  H  S  Y  M  V  G  R  P  F  T  K     
AY386695 ,IGHD5-1*01(2)         atttggtgaagggccgacccaccatgtagctatggtagttac               gtaactaccatagctacatggtgggtcggcccttcaccaaat  

                                 V  T  I  V  M  V  M  L  M  L                             G  S  I  S  I  T  I  T  I  V  
                                  L  L  *  L  W  L  C  L  C  Y                             V  A  *  A  *  P  *  L  *  *  
                                   Y  Y  S  Y  G  Y  A  Y  A  T                             *  H  K  H  N  H  N  Y  S  N  
AY386695 ,IGHD6-1*01(1)         gttactatagttatggttatgcttatgctacc                         ggtagcataagcataaccataactatagtaac

                                 V  I  L  V  I  V  L  V                                   G  T  S  T  I  T  R  I  
                                  L  S  W  L  *  Y  W  Y                                   V  P  V  L  *  P  G  *  
                                   Y  P  G  Y  S  T  G  T                                   Y  Q  Y  Y  N  Q  D  N  
AY386695 ,IGHD7-1*01(1)         gttatcctggttatagtactggtacc                               ggtaccagtactataaccaggataac

                                 V  M  L  V  V  V  I  I                                   G  I  I  T  T  T  S  I  
                                  L  C  W  *  *  L  L  Y                                   V  *  *  L  L  P  A  *  
                                   Y  A  G  S  S  Y  Y  T                                   Y  N  N  Y  Y  Q  H  N  
AY386695 ,IGHD8-1*01            gttatgctggtagtagttattatacc                               ggtataataactactaccagcataac
IMGT note:
(1) Only 11 pb in 3D-SPACER
(2) ORF because only 11 pb in 3D-SPACER and mutation in 5D-HEPTAMER
(3) ORF because mutation in 3D-HEPTAMER