Motifs of the V-GENE PROMOTERs: Mouse (Mus musculus) (Mus musculus) IGKV

Click on an accession number to get the sequence and additional information (IMGT annotations, IMGT flat file, Coding regions...).

Click on the strain name to get information on the strain (link to MGD) .

For Organization of the Mouse (Mus musculus) IGKV PROMOTERs for each subgroup, click here

IGKV subgroup IGKV
gene name
allele name
Fct Strains Accession numbers PENTADECAMER
(1) (2)
Number of nucleotides between PENTADECAMER and DECAMER DECAMER/ OCTAMER
(1) (3)
Number of nucleotides between DECAMER and TATA_BOX TATA_BOX Number of nucleotides between TATA_BOX and ATG
1 1-35 1-35*01 ORF C3H AJ231200     gtatttgcat 38 ataaaa 54
1-88 1-88*01 F C57BL/6 AJ231206     atctttgcat 37 ataaaa 38
1-99 1-99*01 F C3H AJ231207 ctct.ctatttatac 21 tcctttacat 38 ataaat 54
1-108 1-108*01 P C3H AJ231204     acctttgcat 37 ataaaa 53
1-110 1-110*01 F BALB/c D00080 ctcttccttctatac 16 gcttttgcat 38 ataaaa 68
1-110*02 F NZB/BINJ M28132 ctcttccttctatac 16 gcttttgcat 26 ataaaa 67
1-115 1-115*01 P C3H AJ231208     tcttttgcaa 43 aaagga 56
1-117 1-117*01 F BALB/c D00081 ctcttccttctatac 16 gcttttgcat 38 ataaaa 67
1-117*02 F CE/J M28134 ctcttccttctatat 16 gcttttgcat 38 ataaaa 67
1-122 1-122*01 F C57BL/6 AJ231203 ctcttgcttctatac 16 gactttgcat 38 ataaaa 54
1-131 1-131*01 ORF C57BL/6 AJ231197 ...ctctatatacac 16 tcatttgcat 38 ataaaa 54
1-132 1-132*01 F C57BL/6 AJ231198     gcatttgcat 38 ataaaa 54
1-133 1-133*01 F 129/Sv Z72382 cacttctttgtatac 16 acatttgcat 38 ataaaa 54
1-135 1-135*01 F 129/Sv Z72384 cccttctttgtatac 16 acatttgcat 38 ataaaa 54
1-136 1-136*01 P C57BL/6 AJ231202            
2 2-93-1 2-93-1*01 vg C3H AJ231265 tgctaattttcatac 16 ggacgtgttt 37 ataaaa 55
2-95-1 2-95-1*01 vg C57BL/6 AJ231261 tgctaattttcatac 16 ggacgtgttt 37 ataaaa 55
2-95-2 2-95-2*01 vg C57BL/6 AJ231266 tgctaattctcatac 16 ggacttgttt 37 ataaaa 55
2-105 2-105*01 P C3H AJ231262     ggatttacat 38 acaaag 55
2-107 2-107*01 P C3H AJ132682 tgactctttttctaa 16 ggatttgcat 35 acaaaa 55
2-109 2-109*01 F C3H AJ132683 aggtactttttacac 16 agatttgcat 38 gtaaaa 55
2-109*02 F BALB/c K02418 .ggtactttttacac 16 agatttgcat 38 gtaaaa 55
2-112 2-112*01 F BALB/c J00562     ggatttgcat 38 acaaaa 54
2-113 2-113*01 P C57BL/6 AJ231260 tggtactttt.acac 16 ggatttgcat 38 acaaaa 55
2-116 2-116*01 P C57BL/6 AJ277843     agatttgcat 38 gtaaaa 55
2-137 2-137*01 F C3H AJ231263 ggctacttttcacac 16 ggatttgcat 37 acaaaa 55
2-a 2-a*01 F BALB/c K02417     ctttttgtat      
3 3-1 3-1*01 F BALB/c X16955 gagcaggtgcccttg 21 ttatttgcat 30 tttaa 48
3-2 3-2*01 F BALB/c X16954 gagcaggtgcccttg 21 tgatttgcat 30 tttaa 48
3-3 3-3*01 F BALB/c K02162            
3-4 3-4*01 F C57BL/6 Y15968 .agcaggtgcccttg 21 tgatttgcat 30 tttaa 49
3-5 3-5*01 F BALB/c K02161 gggcaggtgcacatg 21 tgatttgcat 30 tttaa 50
3-6 3-6*01 P C57BL/6 Y15969 .accaggtgcccttt 26 tgatttgcat 30 attaa 48
3-7 3-7*01 F BALB/c K02158         tttaa 49
3-8 3-8*01 P C57BL/6 Y15971            
3-9 3-9*01 F C57BL/6 Y15972 .agcaggtacccttg 21 tgatttgcat 30 tttaa 49
3-10 3-10*01 F BALB/c K02160 gggcaggtgcacttg 21 ttatttgcat 30 tttaa 50
3-11 3-11*01 P C57BL/6 Y15973 .agcaggtacccttt 26 tgatttgcat 30 tttaa 49
3-12 3-12*01 F BALB/c K02159         tttaa 49
4 4-50 4-50*01 F C57BL/6 AJ235938     atatttgcat 37 tttaaa 56
4-51 4-51*01 F   V01565     ctatttgcat 37 tttaaa 56
4-52 4-52*01 F C57BL/6 AJ239198     ctatttgcat 37 tttaaa 56
4-53 4-53*01 F C57BL/6 AJ231231     ctatttgcat 37 tttaaa 55
4-54 4-54*01 F C57BL/6 AJ231223     ctatttgcat 37 tttaaa 56
4-55 4-55*01 F C57BL/6 AJ231225     ctatttgcat 37 tttaaa 26
4-56 4-56*01 P C57BL/6 AJ231220     atatttgcat 37 tttaaa 56
4-57 4-57*01 F C57BL/6 AJ231221     atatttgcat 37 tttaaa 56
4-58 4-58*01 F C57BL/6 AJ231233     ctatttgcat 37 tttaaa 56
4-59 4-59*01 F C57BL/6 AJ231234     ctatttgcat 37 tttaaa 26
4-60 4-60*01 P C57BL/6 AJ235941     ctatttccat 37 tttaaa 55
4-61 4-61*01 F C57BL/6 AJ231209     cgatttgcat 37 tttaaa 56
4-62 4-62*01 ORF C57BL/6 AJ231210     ctatttgcat 37 tttaaa 56
4-63 4-63*01 F C57BL/6 AJ231211     ctatttgcat 37 tttaaa 56
4-65 4-65*01 P C57BL/6 AJ231232     gggagctcat      
4-68 4-68*01 F C57BL/6 AJ231222     ctatttgcat 37 tttaaa 56
4-69 4-69*01 F C57BL/6 AJ235942     ..atttgcat 37 tttaaa 56
4-70 4-70*01 F C57BL/6 AJ235943     ..atttgcat 37 tttaaa 56
4-71 4-71*01 F C57BL/6 AJ231218     ctatttgcat 37 tttaaa 56
4-72 4-72*01 F C57BL/6 AJ231219     cgatttgcat 37 tttaaa 56
4-73 4-73*01 F C57BL/6 AJ231216     ccatttgcat 37 tttaaa 56
4-74 4-74*01 F C57BL/6 AJ231217     ctatttgcat 37 tttaaa 56
4-75 4-75*01 P C57BL/6 AJ231227     ctatttgcat 37 tttaaa 56
4-77 4-77*01 P C57BL/6 AJ235940     atatttgcat 37 tttaaa 56
4-78 4-78*01 F C57BL/6 AJ231212     atatttgcat 37 tttaaa 56
4-79 4-79*01 F C57BL/6 AJ231214     tgatttgcat 37 tttaaa 56
4-80 4-80*01 F C57BL/6 AJ231213     ctatttgcat 37 tttaaa 56
4-81 4-81*01 F C57BL/6 AJ231215     ttatttgcat 37 tttaaa 56
4-83 4-83*01 P C57BL/6 AJ231230     ccatttgcac 37 tttaaa 55
4-86 4-86*01 F C57BL/6 AJ231228     ttatttgcat 37 tttaaa 56
4-90 4-90*01 F C57BL/6 AJ231224     ctatttgcat 38 tttaaa 56
4-91 4-91*01 F C57BL/6 AJ231229     ctatttgcat 37 tttaaa 55
4-92 4-92*01 F C57BL/6 AJ231226     atatttgcat      
5 5-37 5-37*01 F C57BL/6 AJ235963 ttcgggtaaccagaa 79 cgatttgcat 37 tattataa 55
5-39 5-39*01 F C57BL/6 AJ235964     tgatttgcat 37 ttttataa 56
5-40-1 5-40-1*01 vg C57BL/6 AJ235976     tgatttgcat 37 tattataa 56
5-43 5-43*01 F C3H AJ235973 ttcaggtaatcagca 78 tgatttgcat 36 tattataa 56
5-45 5-45*01 F C57BL/6 AJ235974 ttcaggtaatcagca 78 tgattttgcat 36 tattataa 56
5-48 5-48*01 F C57BL/6 AJ235975     tgatttgcat 37 tattataa 56
6 6-13 6-13*01 (F)   J00569 #g tgactgtttatttaa 48 tactttgcat 24 atttataaa 40
6-14 6-14*01 F C57BL/6 Y15975     tattttgcat 31 atttataaa 52
6-15 6-15*01 F C57BL/6 Y15976     tgctttgcat 31 atttataaa 52
6-17 6-17*01 F C57BL/6 Y15978     tcctttgcat 31 atttataaa 52
6-20 6-20*01 F C57BL/6 Y15981     tactttgcat 30 atttataac 52
6-23 6-23*01 F C57BL/6 AJ235961 tgactgtttatttaa 48 tgctttgcat 31 atttataaa 52
6-25 6-25*01 F C57BL/6 AJ235962     tactttgcat 31 atttataaa 52
6-29 6-29*01 F C57BL/6 AJ235967     tactttgcat 31 atttataac 52
6-32 6-32*01 F C57BL/6 AJ235968     tgctttgcgt 31 ttttataaa 52
6-32*02 F BALB/c M14360 tggatatttatttaa 53 tgctttgcgt 31 tgttataaa 52
6-b 6-b*01 F C58 M14361 tggatatttatttaa 53 tgctttgcat 31 tgttataaa 52
6-c 6-c*01 F SK M24937 tggatatttatttaa 53 tgctttgcat 31 ttttataaa 52
6-d 6-d*01 F PERA L36249 tggatatttatttaa 53 tgctttgcgt 31 ttttataaa 52
7 7-33 7-33*01 F C57BL/6 AJ235965 tgttgattgacacca 48 tgctttgcat 28 taaata 57
8 8-16 8-16*01 F C57BL/6 Y15977     tgctttgcat 36 atgtataaa 50
8-18 8-18*01 ORF C57BL/6 Y15979     tactttgcat 31 atttataaa 52
8-19 8-19*01 F C57BL/6 Y15980     agctttgcat 31 atttataaa 51
8-21 8-21*01 F C57BL/6 Y15982     tgctttgcat 31 atttataaa 42
8-22 8-22*01 P C57BL/6 Y15983     ccattctcat 31 atttataaa 42
8-24 8-24*01 F C57BL/6 AJ235944 tgcctgttgattgac 53 tgctttgcat 31 atttataaa 50
8-26 8-26*01 ORF C57BL/6 AJ235945     tactttgcat 31 atttataaa 52
8-27 8-27*01 F C57BL/6 AJ235946 tgcttgttgattgac 51 tgctttgcat 31 atttataaa 51
8-28 8-28*01 F C57BL/6 AJ235947     agctttgcat 31 atttataaa 51
8-28*02 F MRL L17135            
8-30 8-30*01 F C3H AJ235948 tttttgttgattgac 53 tgctttgcat 31 atttataaa 42
8-31 8-31*01 P C3H AJ235957     atctttggct   tttataaa 42
8-34 8-34*01 F 129/Sv AJ235958 .ggctgttgattgac 48 tgttttgcat 33 tttataaa 42
9 9-119 9-119*01 P C57BL/6 AJ231236 tgcactggtatccag 17 tgatttgcat 31 atatac 46
9-120 9-120*01 F C57BL/6 V00804 ......cgtgaccaa 17 taatttgcat 31 atataa 46
9-123 9-123*01 F C3H AJ231250 tgcagctgtgaccaa 17 tgatttgcat 31 atatac 46
9-124 9-124*01 F C3H AJ231248 tgcagctgtgaccaa 17 tgatttgcat 31 atatac 46
9-128 9-128*01 P C3H AJ231245     tgattttcat 31 atatac 46
9-129 9-129*01 F BALB/c K00880 tgcagctgtgaccaa 17 tgattttcat 31 atatac 46
10 10-94 10-94*01 F A/J M54906 tgcagctgtgctcag 17 aaatttgcat 31 atatac 48
10-94*02 F PERU M54908 tgcagctgtgctcag 17 aaatttgcat 31 atatac 48
10-94*03 F AKR M54904 tgcagctgtgctcag 17 aaatttgcat 31 atatac 48
10-95 10-95*01 F BALB/c AF029261 tgcagctgtgctcag 16 aaatttgcat 31 atatac 48
10-96 10-96*01 F A/J M15520 tgcagctgtgctcag 17 aaatttgcat 31 atatac 47
10-96*02 F PERU M54907 tgcagctgtgctcag 17 aaatttgcat 31 atatac 48
10-96*03 F AKR M54903 tgcagctgtgctcag 17 aaatttgcat 31 atatac 47
11 11-106 11-106*01 P C3H AJ231252 tgcagctgtgctcag 17 agatttgcat 25 ttatat 50
11-114 11-114*01 P C3H AJ231253     tgacttgcat 25 ttatat 50
11-118 11-118*01 P C3H AJ231255 tgcagcttggcccag 17 tgatttgcat 25 ttatat 50
11-125 11-125*01 F 129/Sv AJ231256 tgcagcttggcccag 18 tgatttgcat 25 ttatat 50
12 12-38 12-38*01 F C57BL/6 AJ235951 tacaactgtgcttac 7 tgatttgcat 40 tccata 51
12-40 12-40*01 P C57BL/6 AJ235952 tgcagccttgcctac 7 tgatttgcat 35 ttcata 51
12-41 12-41*01 F C57BL/7 AJ235953 tgcagctgtgcctac 7 tgatttgcat 35 ttcata 51
12-41*02 F BALB/c V00779 ....gctgtgcctac 7 tgatttgcat 35 ttcata 51
12-42 12-42*01 P C3H AJ235954 ......tgtgcctac 7 tgatttgcat 35 ttcata 51
12-44 12-44*01 F C3H AJ235955 tgcagctgtgcctac 7 tgatttgcat 35 ttcata 51
12-46 12-46*01 F C57BL/6 AJ235956 tgcagctgtgcctac 7 tgatttgcat 35 ttcata 51
12-47 12-47*01 P C57BL/6 AJ235959     tgatttgcat 35 tttata 51
12-49 12-49*01 P C57BL/6 AJ235960 tgcagctatgcctac 7 tgatttgcat 35 ttcacc 52
12-66 12-66*01 P C57BL/6 AJ235934     tgatttgcat 35 ttcaca 50
12-67 12-67*01 P C57BL/6 AJ235933 tg.agctatgcctac 7 tgatttgcat 35 ttcaca 50
12-89 12-89*01 F C57BL/6 AJ235950 tgcagctatgcctac 7 tgatttgcat 35 tttata 51
12-98 12-98*01 F C3H AJ235949 ....ggcattcctac 7 tgatttgcat 35 tttaaa 51
12-e 12-e*01 F BALB/c J00546            
13 13-54-1 13-54-1*01 vg C57BL/6 AJ132680            
13-55-1 13-55-1*01 vg C57BL/6 AJ132679            
13-56-1 13-56-1*01 vg C57BL/6 AJ132675            
13-57-1 13-57-1*01 vg C57BL/6 AJ132681            
13-61-1 13-61-1*01 vg C57BL/6 AJ132676     atggatgcat 48 ttaata 52
13-62-1 13-62-1*01 vg C57BL/6 AJ132672            
13-64 13-64*01 P C57BL/6 AJ235969 aatagaagttcttag 18 aggataccat 34 ttaata 52
13-71-1 13-71-1*01 vg C57BL/6 AJ132673            
13-73-1 13-73-1*01 vg C57BL/6 AJ132677            
13-74-1 13-74-1*01 vg C57BL/6 AJ132678            
13-76 13-76*01 P C57BL/6 AJ231271     atggatgcat 48 ttaata 52
13-78-1 13-78-1*01 vg C57BL/6 AJ132671            
13-80-1 13-80-1*01 vg C57BL/6 AJ132674            
13-82 13-82*01 P C57BL/6 AJ231276     atggatgcat 48 ttaata 52
13-84 13-84*01 F C57BL/6 AJ231273 agttactgagataac 17 tgatttgcat 27 ttatta 48
13-85 13-85*01 F C57BL/6 AJ231274 agttactgagataac 17 tgatttgcat 27 ttatta 48
13-85*02 F BALB/c M35154            
13-85*03 F AKR M35155            
13-87 13-87*01 P C57BL/6 AJ231275 tacatctgtccctag 17 tgattttcat 27 ttaatt 52
13-89-1 13-89-1*01 vg C57BL/6 AJ132672            
14 14-100 14-100*01 F C3H AJ231243     tgattttcat 31 atatac 46
14-111 14-111*01 F C57BL/6 AJ231235     ..atttgcat 31 atatac 46
14-118-1 14-118-1*01 vg C57BL/6 AJ277844            
14-118-2 14-118-2*01 vg C57BL/6 AJ231237 tgcacctgttcccaa 17 tgatttgcat 31 atatac 41
14-126 14-126*01 P C3H AJ231238 tgcacctgttcccag 17 tgatttgcat 31 atatac 46
14-126-1 14-126-1*01 vg C57BL/6 AJ231246 tgcacctgttcccaa 17 tgatttgcat 31 atatac 41
14-130 14-130*01 F C57BL/6 AJ231241 tgcacctgttcccag 17 ttatttgcat 31 atatac 41
14-134-1 14-134-1*01 vg C3H AJ231249 tgcacctgttcccaa 17 tgatttgcat 31 atatac 41
15 15-97 15-97*01 P C3H AJ231267     taatttgcat 30 atatat 57
15-101 15-101*01 P C3H AJ231268 tgtaggtggctccag 16 tgatttgcat 30 atatat 56
15-101-1 15-101-1*01 vg C3H AJ231251 tgtagcagttcttat 17 tgatttgcat 28 acttcc 45
15-102 15-102*01 P C3H AJ231270 tgtacggtgctccag 16 caatttacat 30 attttt 54
15-103 15-103*01 ORF C3H AJ231269 tgcaggtggctctag 16 tgatttgcat 27 atttct 58
16 16-104 16-104*01 F C3H AJ235936 tgtagctatacatat 17 tgatttgcat 32 tatttaata 52
17 17-121 17-121*01 F C57BL/6 AJ231258 tatcagctcagctgtgaaga 75 caatttgcat 32 atataat 44
17-127 17-127*01 F C57BL/6 AJ231259 tatcagctgtgaaga 75 caatttgcat 32 atataat 44
17-134 17-134*01 P C57BL/6 AJ231257 tatcagctgtgaaga 75 caatttgcat 36 atataat 45
18 18-36 18-36*01 F C3H AJ235966     tgctttgcat 28 ttcataaca 51
19 19-93 19-93*01 F C57BL/6 AJ235935     tgatttgcat 31 tttaataat 50
#g: rearranged genomic DNA

IMGT notes:
(1) Dots or empty cells indicate partial or absent motifs respectively, due to partial sequences.
(2) The E-Box, if present, is shown in bold.
(3) The OCTAMER is shown in bold.

Created: 17/05/2001
Author: Christèle Martinez-Jean

Software material and data coming from IMGT server may be used for academic research only, provided that it is referred to IMGT®, and cited as "IMGT®, the international ImMunoGeneTics information system® (founder and director: Marie-Paule Lefranc, Montpellier, France)." References to cite: Lefranc, M.-P. et al., Nucleic Acids Res., 27:209-212 (1999); doi: 10.1093/nar/27.1.209 Full text Cover; Ruiz, M. et al., Nucleic Acids Res., 28:219-221 (2000); doi: 10.1093/nar/28.1.219 Full text; Lefranc, M.-P., Nucleic Acids Res., 29:207-209 (2001); doi: 10.1093/nar/29.1.207 Full text; Lefranc, M.-P., Nucleic Acids Res., 31:307-310 (2003); doi: 10.1093/nar/gkg085 Full text; Lefranc, M.-P. et al., In Silico Biol., 5, 0006 (2004) [Epub], 5:45-60 (2005); Lefranc, M.-P. et al., Nucleic Acids Res., 33:D593-597 (2005); doi: 10.1093/nar/gki065 Full text; Lefranc, M.-P. et al., Nucleic Acids Res., 37:D1006-1012 (2009); doi: 10.1093/nar/gkn838 Full text; Lefranc, M.-P. et al., Nucleic Acids Res., 43:D413-422 (2015); doi: 10.1093/nar/gku1056 Full text.
For any other use please contact Marie-Paule Lefranc

CNRS Université de Montpellier European Commission
IMGT® Founder and Executive Director Emeritus:
Marie-Paule Lefranc
IMGT® Director:
Sofia Kossida
Bioinformatics manager:
Véronique Giudicelli
Computer manager:
Patrice Duroux
Amélie Houles

Citing IMGT | Warranty disclaimer and copyright notice | Privacy policy and advertisement policy

© Copyright 1995-2018 IMGT®, the international ImMunoGeneTics information system®