Here you are: IMGT Web resources > IMGT Repertoire (IG and TR) > 1. Locus and genes

"+" or "-" indicates if the gene sequences have been found (+) or not been found (-) rearranged (R), transcribed (T) and/or translated into protein (Pr). Arbitrarily that information is shown on the first line of each gene when the data have been confirmed by several studies.

Functionality is shown between parentheses, (F) and (P), when the accession number refers to rearranged genomic DNA or cDNA and the corresponding germline gene has not yet been isolated.
Functionality is shown between brackets, [F] and [P], when the accession number refers to genomic DNA, but not known as being germline or rearranged.

Click on:

IMGT subgroup IMGT gene name IMGT allele name Fct Chromosomal localization R T Pr Positions in the locus IMGT/LIGM-DB reference sequences IMGT/LIGM-DB sequences from the literature
Breed Clone names Accession numbers Positions in the sequence (from INIT-CODON to the end of the V-REGION) Secondary accession numbers Breed Clone names Accession numbers Positions in the sequence
TRDV1 TRDV1S1 TRDV1S1*01 [1] F chromosome 7 Texel OviAri_3_chr7 complement(53181..53747)
TRDV1S2 TRDV1S2*01 [1] F chromosome 7 Texel OviAri_3_chr7 complement(41692..42262)
TRDV1S3 TRDV1S3*01 [1] F (1) chromosome 7 Texel OviAri_2_chr7 complement(362230..362783)
TRDV1S4 TRDV1S4*01 [1] P (2) chromosome 7 Texel OviAri_2_chr7 299287..299855
TRDV1S5 TRDV1S5*01 [1] F chromosome 7 Texel OviAri_2_chr7 270600..271166
TRDV1S6 TRDV1S6*01 [1] F (3) chromosome 7 Texel OviAri_2_chr7 complement(254755..>255058)
TRDV1S7 TRDV1S7*01 [1] P (4) chromosome 7 Texel OviAri_2_chr7 complement(240153..240759)
TRDV1S8 TRDV1S8*01 [1] F (5) chromosome 7 Texel OviAri_2_chr7 complement(228762..229296)
TRDV1S9 TRDV1S9*01 [1] F (6) chromosome 7 Texel OviAri_2_chr7 complement(>206901..207353)
TRDV1S10 TRDV1S10*01 [1] F chromosome 7 Texel OviAri_2_chr7 complement(195500..195971)
TRDV1S11 TRDV1S11*01 [1] F chromosome 7 Texel OviAri_2_chr7 complement(180946..181509)
TRDV1S12 TRDV1S12*01 F (7) chromosome 7 Texel NW_004080312 [1] 1399..1952
TRDV1S13 TRDV1S13*01 F chromosome 7 Texel NW_004080352 [1] 1959..2527
TRDV1S14 TRDV1S14*01 F chromosome 7 Texel NW_004081110 [1] complement(12509..13071)
TRDV1S15 TRDV1S15*01 P (8) chromosome 7 Texel NW_004081259 [1] complement(2925..3486)
TRDV1S16 TRDV1S16*01 F (9) chromosome 7 Texel NW_004081954 [1] 2742..3251
TRDV1S17 TRDV1S17*01 F chromosome 7 Texel NW_004082010 [1] complement(2281..2843)
TRDV1S18 TRDV1S18*01 F chromosome 7 Texel NW_004082156 [1] 1064..1533
TRDV1S19 TRDV1S19*01 F chromosome 7 Texel NW_004082203 [1] complement(2031..2586)
TRDV1S20 TRDV1S20*01 F chromosome 7 Texel NW_004082507 [1] complement(47603..48172)
TRDV1S21 TRDV1S21*01 ORF (10) chromosome 7 Texel NW_004082507 [1] complement(43095..43628)
TRDV1S22 TRDV1S22*01 F chromosome 7 + Texel NW_004082507 [1] complement(15194..15655)
TRDV1S23 TRDV1S23*01 F chromosome 7 Texel NW_004082507 [1] complement(2739..3303)
TRDV1S24 TRDV1S24*01 F (5) chromosome 7 Texel NW_004083226 [1] 4873..5392
TRDV1S25 TRDV1S25*01 F chromosome 7 Texel NW_004083566 [1] complement(310..865)
TRDV1S26 TRDV1S26*01 [1] P (11) chromosome 7 Texel OviAri_3_chr7 complement(54472..54764)
TRDV1S27 TRDV1S27*01 [1] P (12) chromosome 7 Texel OviAri_2_chr7 complement(147272..148096)
TRDV2 TRDV2-1 TRDV2-1*01 [1] F chromosome 7 Texel OviAri_2_chr7 complement(116406..116968)
TRDV2S2 TRDV2S2*01 [1] F chromosome 7 Texel OviAri_1_chr7 complement(320846..321335)
TRDV2S3 TRDV2S3*01 [1] F (12) chromosome 7 Texel OviAri_2_chr7 complement(143849..144407)
TRDV3 TRDV3-1 TRDV3-1*01 [1] F chromosome 7 Texel OviAri_1_chr7 complement(388913..389438)
TRDV4 TRDV4-1 TRDV4-1*01 [1] F chromosome 7 Texel OviAri_1_chr7 199768..200352
IMGT notes:
  1. (1) TRDV1S3*01 differs from TRDV1S12*01 by two nucleotides in V-REGION (g7>a, E3>K; g23>a, R8>Q) (http://www.imgt.org/IMGTScientificChart/Nomenclature/IMGTmutation.html). Given the current status of the genome assembly (28/03/16), these two sequences are considered as two different genes, although it is not excluded that they may represent alleles of a same gene.
  2. (2) in frame STOP CODON in FR1-IMGT.
  3. (3) no L-PART1 due to many undetermined nucleotides in 5', functionality is defined for the available sequence.
  4. (4) INSERTION of 51 nucleotides ATTTTTTGGTACAAGCAGCTTCCCAGTGGACAGATGACTTATCTTATTCGT in FR2-IMGT (between positions 152 and 153 in IMGT unique numbering). This INSERTION is a duplication of positions 101-149 and may represent a sequencing error.
  5. (5) no CDR2-IMGT, functionality is defined for the available sequence.
  6. (6) V-REGION is partial in 3', functionality defined for the available sequence, from the 2nd-CYS the sequence is rich of T and A.
  7. (7) TRDV1S12*01 differs from TRDV1S3*01 by two nucleotides in V-REGION (a7>g, K3>E; a23>g, Q8>R) (http://www.imgt.org/IMGTScientificChart/Nomenclature/IMGTmutation.html). Given the current status of the genome assembly (28/03/16), these two sequences are considered as two different genes, although it is not excluded that they may represent alleles of a same gene.
  8. (8) in frame STOP CODON in V-REGION, CONSERVED-TRP is replaced by in frame a STOP CODON.
  9. (9) V-REGION is partial: AA 93 to 104 are missing (partial FR3-IMGT), no CDR3-IMGT, functionality defined for the available sequence of the gene.
  10. (10) noncanonical L-PART1 length, no CDR2-IMGT, 2nd-CYS is replaced by Ser.
  11. (11) in frame STOP CODON in FR1-IMGT, unexpected DONOR-SPLICE position.
  12. (12) frameshifts in V-REGION.
IMGT references:
  1. [1] Piccinni B. et al., BMC Genomics, 16:709 (2015). PMID: 26383271
See also (IMGT Scientific chart):