IMGT reference directory: V-REGION Teleostei IGHV set


The IMGT reference directory contains sets of allele sequences isolated from the IMGT reference sequences. By definition, these sets contain one sequence for each allele.


Authors: Véronique Giudicelli (Veronique.Giudicelli@igh.cnrs.fr) and Marie-Paule Lefranc (Marie-Paule.Lefranc@igh.cnrs.fr)

Software material and data coming from IMGT server may be used for academic research only, provided that it is referred to IMGT, and cited as "IMGT, the international ImMunoGeneTics information system® http://www.imgt.org (Initiator and coordinator: Marie-Paule Lefranc, Montpellier, France)." References to cite: Lefranc, M.-P. et al., Nucleic Acids Research, 27, 209-212 (1999) Cover of NAR; Ruiz, M. et al., Nucleic Acids Research, 28, 219-221 (2000); Lefranc, M.-P., Nucleic Acids Research, 29, 207-209 (2001), Lefranc, M.-P., Nucleic Acids Res., 31, 307-310 (2003) Full text, Lefranc, M.-P. et al., Nucleic Acids Res., 33, D593-D597 (2005) Full text.
For any other use please contact Marie-Paule Lefranc Marie-Paule.Lefranc@igh.cnrs.fr.


Species are designated with "short" names (the three first letters from the genus and species names):

for Anarhichas minor (Spotted wolffish): Anamin
for Carassius auratus (Goldfish): Caraur
for Danio rerio (Zebrafish): Danrer
for Elops saurus (Ladyfish): Elosau
for Gadus morhua (Atlantic cod): Gadmor
for Ictalurus punctatus (Channel catfish): Ictpun
for Oncorhynchus mykiss (Rainbow trout): Oncmyk
for Paralichthys olivaceus (Bastard halibut): Paroli
for Salvelinus alpinus (Charr): Salalp
for Scophthalmus maximus (Turbot): Scomax
for Salmo salar (Atlantic salmon): Salsal
for Trematomus bernachii (Emerald rockcod): Treber
for Takifugu rubripes (Torafugu):Takrub
for Chaenocephalus aceratus (Blackfin icefish):Chaace
for Notothenia corriceps(Yellowbelly rockcod):Notcor




>AF138958|IGHV1S1*01_Anamin|(F)|V-REGION
TGTGAACAGTTGACACAG......ACAGACTCT...GAGACTGTGCAGCCAGGTCAACGTCTGACCATCACCTGTCAGG
TCTCTTATGCTCTTAGC...............AGCTACAACACAGCTTGGATCAGACAGCCTGCAGGGAAAGGACTGGA
GTGGATTGGAATGAAACATACT............GGAGCTTCATACTACAAAGATTCACTGAAG...AACAAGTTCAGC
ATCGACTTAGAGACTTCCAGCAAAACAGTGACTCTAAACGGACAGAACGTGCAGCCTGAAGACACTGCTGTGTATTACT
GTGCCAGATCT
>AY188780|IGHV1S2*01_Anamin|(F)|V-REGION
TGTGAACAGTTGACACAG......CCAGACTAT...GTGACTGTGCAGCCAGGTCAACGTCTGACCATCACCTGTCAGG
TCTCTTATGCTCTTAGC...............AGCTACTACACAGCTTGGATCAGACAGCCTGCAGGGAAAGGACTGGA
GTGGATTGGAATGAAATATACG............GGAGATTCATACTTCAAAGATTCACTGAAG...AACAAGTTCAGT
ATCGACTTAGACACTTCCAGCAAAACAGTGACTCTAACTGGACAGAACATGCAGCCTGAAGACACTGCTGTGTATTACT
GTGCCAGAGAC
>AY188783|IGHV1S3*01_Anamin|(F)|V-REGION
TGTGAACAGTTGACACAG......CCAGCCTCT...GAGACTGTGCAGCCAGGTCAACGTCTGACCATCACCTGTCAGG
TCTCTTATGCTCTTAGC...............AGCTACTACACAGCTTGGATCAGACAGCCTGCAGGGAAAGGACTGGA
GTGGATTGGAATGAAATATACT............GGAGCTTCATACTACAAAGATTCACTGAAG...AACAAGTTCAGT
ATCGATTTAGACACTTCCAGCAAAACAGTGACTCTAACTGGACAGAACGTGCAGCCTGAAGACACTGCTGTGTATTACT
GTGCCAGATAT
>AY188784|IGHV1S4*01_Anamin|(F)|V-REGION
TGTGAACAGTTGACACAG......ACAGACTCT...GTGACTGTGCAGCCAGGTCAACGTCTGACCATCACCTGTCAGG
TCTCTTATTCTCTTAGC...............AGCTACAACACAGCTTGGATCAGACAGCCTGCAGGGAAAGGACTGGA
GTGGATTGGAATGAAACATACT............GGAGCTTCATACTACAAAGATTCACTGAAG...AACAAGTTCAGC
ATCGACTTAGACACTTCCAGCAAAACAGTGACTCTAACTGGACAGAACGTGCAGCCTGAAGACACTGCTGTGTATTACT
GTGCCAGAGGA
>AY188781|IGHV1S5*01_Anamin|(F)|V-REGION
........GTTGACACAG......CCAGCCTCT...GTGACTGTGCAGCCAGGTCAACGTCTGACCATCACCTGTCAGG
TCTCTTATGCTCTTAGC...............AGCTACTACACAGCTTGGATCAGACAGCCTGCAGGGAAAGGACTGGA
GTGGATTGGATATGCCGCTGTT.........GGAAACACAGCATACTACAAAGATTCACTGAAG...AACAAGTTCAGT
ATCGACTTAGACACTTCCAGCAAAACAGTGACTCTAACTGGACAGAACGTGCAGCCTGAAGACACTGCTGTGTATTACT
GTGCCAGAGGG
>AY188788 |IGHV1S6*01_Anamin|(F)|V-REGION
TGTGAACAGTTGACACAG......CCAGCCTCT...GAGACTGTGCAGCCAGGTCAACGTCTGACCATCACCTGTCAGG
TCTCTTATGGTCTT..................AACTACTACACAGCTTGGATCAGACAGCCTGCAGGGAAAGGACTGGA
GTGGATTGGAATGAAAAATACT............GGATATTCATACTTCAAAGATTCACTGAAG...AACAAGTTCAGT
ATCGACTTAGACACTTCCAGCAAAACAGTGACTCTAACTGGACAGAACATGCAGCCTGAAGACACTGCTGTGTATTACT
GTGCCAGAGGT
>AY188782 |IGHV2S1*01_Anamin|(F)|V-REGION
GGTCAGACTCTGACAGAA......TCTGAACCA...GTGGTTAAAAGGCCTGGAGAATCTCACAGATTGACCTGTACAG
TCTCTGGATTTTCACTC............AGCAGCTACTATATGGCCTGGGTCAGACAGGCTCCTGGAAAAGGACTGGA
GTGGATTGCCTTGAATGATAACGGT......GGTAGCACCAAATACTACTCTCAGTCAGTCCAA...GGCCGGTTTACC
ATCTCCAGAGACAACAACAGACAGCAGCTGTATCTGCAGATGAACAGTCTGAAGACTGAAGATTCTGCTGTTTATTATT
GTGCTCGAGAT
>AY188786|IGHV2S2*01_Anamin|(F)|V-REGION
GGTCAGACTCTGACAGAA......TCTGAACCA...GTGATTAAAAGGCCTGGAGAATC
ACACAGATTGATCTGTACAGCCTCTGGATTCACATTC............AGCAGCTACGGCATGCACTGGGTCAGACAG
GCTCCTGGAAAAGGACTGGAGTGGATCGCTTATATCAGCAGTGCT......AGTTCTTCTATCTACTACTCTCAGTCAG
TTCAA...GGCCAGTTTACCATCTCCAGAGACAACAACAGACAGCAGGTGTATCTGCAGATGAACAGTCTGAAGACGGA
AGATTCTGCTGTTTATTATTGTGCTCGATAT
>AY188787|IGHV2S3*01_Anamin|(F)|V-REGION
GGTCAGACTCTGACAGAA......TCTGAACCA...GTGGTTAAAAGGCCTGGAGAATCACACAGGTTGACTTGTACAA
CATCTGGATTCACTCTT............AGTAGCTACTGGATGCACTGGGTCAGACAGGCTCCTGGCAAAGGACTGGA
GTGGGTTGCCGCTAATCATGGT............AGCACCAATCACTACTCTCAGTCAGTCCAA...GGCCGGTTTACC
ATCTCCAGAGACAACAACAGACAGCAGGTGTATCTGCAGATGAGCAGTCTGAAGACAGAAGATTCTGCTGTTTATTATT
GTGCAGGGGTA
>AY188779|IGHV3S1*01_Anamin|(F)|V-REGION
GAGATCAAACTGGACCAG......TCTCCCTCT...GAGGTGAAAAGACCTGGAGAGACAGTGAAGATGTCATGTATCA
TATCTGGTTATAGCATG............ACAAGCTACAACATTCACTGGATACAACAGAGGCCAGGGAATGCTCTGGA
GTGGATTGGGTGGATGAACACAGGC......AGCAACTCTGCTAGCTATGGCAGCTCCTTTCAG...AGCCGTTTCATC
ATGACTGAAGATGAGCCCAGCAGCACTCAGTACCTCGAGGTCACGAGTCTGAGAGCAGAAGACTCTGCTGTTTACTTCT
GTGCTCGACAA
>J03616|IGHV1S1*01_Caraur|F|V-REGION
CAGGTGCAGCTGGTGGAG......TCCGGAGGG...GATGTGAAGAAGCCCGGAGACTCTCTGCGCCTCTCCTGCAAAG
CCTCCGGCTACACCTTC............AGCGGCTACACTATGTACTGGGTCCGCCAGGCCCCCGGGAAGGGGCTGGA
GTGGGTCTCACGTATTTACGATGAC......GGGAGTGATGTGTCCTACGCCGACACAGTGAAA...GGTCGATTCACC
ATCTCCAGGGATAATGCCAAGAACCTGCTTTATCTGCAAATGAGCAATTTGAAGCCTGAGGACACCGGCCGCTATTACT
GTGCGAGA
>X61312|IGHV2S1*01_Caraur|ORF|V-REGION
GGTCAGTCTTTGACCTCC......TCAGATTCT...GTGGTGAAAAAGCCTGGAGAATCAGTGACTCTGTCCTGCACTG
CTTCTGGATTCTCAATG............AGCAGCTACTGGATGGGCTGGATCCGTCAGAAACCAGGGAAAGCACTGGA
GTGGATTGGACAGATATCTGGC............TCAACTGTGTATTATGCTCAGTCTCTACAG...GGACAGTTCTCC
ATCACCACAGACACCAGCAAAAACATGCTGCATTTAGAGGTGAAGAGCCTGAAGACTGAAGACACAGCTGTTTATTACT
GTGCAAGAGACT
>X65266|IGHV2S2*01_Caraur|P|V-REGION
GTGGTCAGTCTTTGACCT......CCTCAGAGT...ATGCTGTGAAAAACTGGAAGAACAGTGATTCTGTCCTGCACTG
TGTCTGGAATCTCAATG............AGCAGTCACTGGATGCACTGGATCCGCCAGTAACCAGGGAAAGGACTGGA
GTGGATTGGATGTATAGATACTGGC.........TCAAGTGTATATTATGCTCAGTCTCTAAAG...GGCAGGTTATCC
ATCACCAAAGACACCAGCAAAAACATGCTGTATTTAAAAGTGATTGACCTGAAGACTGAATACACAGCTGTTTATTACT
GTGCACGAGACT
>X61313|IGHV3S1*01_Caraur|P|V-REGION
CTGACTTGAGTTTAAAGA......TCTGAGTCA...GTCATCATCAAACCTGGGAACAATCATAAACTGACCTGTACCT
TCTCTGGGATTGATGTT............GGAGCTGCAGATATTTCATGGACAAGACAAGCTGAAGGAAAAGCGCTTGA
GTGGATCTCATATATTTCTGCTCCAAGT...GGCAGCAGCAAATATTACTTTAAAACTGTTGAA...GGACGATTCACC
ATCTCCAGAGACAAGAGTAAAATGCAGGTGTATCTGCACATGACAAATCTGCAGACTGAAGACACTGCCGTTTATTACT
GTGCTCGAAAAAA
>AF273897|IGHV1S1*01_Danrer|F|V-REGION
GGTCAGTCTTTGACCTCC......TCAGACTCT...GTGGTGAAAAGACCAGGAGAATCAGTCACTCTGTCCTGCACTG
TGTCTGGATTCTCAATG............AGCAGCTACTACATGCACTGGATCCGCCAGAAACCAGGGAAAGGACTGGA
GTGGATTGGATATATAGACACTGGC.........ACAACAGCATATTACGCTCAGTCTTTACAA...GGCCAGTTCACT
ATCACCAAAGACACCAGTAAAAACATGCTGTATTTAGAGGTGAAAAGCCTGAAGAGTGAAGACACAGCTGTTTATTACT
GTGCACGGACT
>AF273899|IGHV1S1*02_Danrer|(F)|V-REGION
..........TGACCTCC......TCAGACTCT...GTGGTGAAAAGACCAGGAGAATCAGTCACACTGTCCTGCACTG
TGTCTGGATTCTCAAAG............AGGAGTTACTACATGCACTGGATCCGCCAGAAACCAGGGAAAGGACTGGA
GTGGATTGGATATATAGACACTGGC.........ACAACAGCATATTACGCTCAGTCTTTACAA...GGCCAGTTCACT
ATCACCAAAGACACCAGTAAAAACATGCTGTATTTAGAGGTGAAAAGCCTGAAGAGTGAAGACAC
>AF273880|IGHV1S2*01_Danrer|(F)|V-REGION
GGTCAGTCTTTGACCTCC......TCAGACTCT...GTGGTGAAAAGACCAGGAGAATCAGTCACTCTGTCCTGCACTG
TGTCTGGAATCTCAATG............AGCAGCTACTACATGCACTGGATCCGCCAGAAACCAGGGAAAGGACTGGA
GTGGATCGGGCGAATTGATGGTGGC.........ACTGGCACTAATTTTGCTCAGTCTTTACAA...GGCCAGTTCACC
ATCACCAAAGACACCAGTAAAAACATGCTGTATTTAGAGGTGAAACAGCTGAAGAGTGAAGACACAGCTGTTTATTACT
GTGCACGAGAA
>AF273886|IGHV1S2*02_Danrer|(F)|V-REGION
GGTCAGTCTTTGACCTCC......TCAGACTCT...GTGGTGAAAAGACCAGGAGAATCAGTCACTCTGTCCTGCACTG
TGTCTGGAATCTCAATG............AGCAGCTACTACATGCACTGGATCCGCCAGAAACCAGGGAAAGGACTGGA
GTGGATCGGGCGATTGATGGTG..........GACCTGGCACTAATTTTGCTCAGTCTTTACAA...GGCCAGTTCACC
ATCACCAAAGACACCAGTAAAAACATGCTGTATTTAGAGGTGAAACAGCTGAAGAGTGAAGACACAGCTGTTTATTACT
GTGCACGAGAA
>AF273889|IGHV1S2*03_Danrer|(F)|V-REGION
GGTCAGTCTTTGACCTCC......TCAGACTCT...GTGGTGAAAAGACCAGGAGAATCAGTCACTCTGTCCTGCACTG
TGTCTGGAATCTCAATG............AGCAGCTACTACACGCACTGGATCCGCCAGAAACCAGGGAAAGGACTGGA
GTGGATCGGGCGAATTGATGGTGGC.........ACTGGCACTAATTTTGCTCAGTCTTTACAA...GGCCAGTTCACC
ATCACCAAAGACACCAGTAAAAACATGCTGTATTTAGAGGTGAAACAGCTGAAGAGTGAAGACACAGCTGTTTATTACT
GTGCACGAGAA
>AF273891|IGHV1S2*04_Danrer|(F)|V-REGION
............................................AAGACCAGGAGAATCAGTCACTCTGTCCTGCACTG
TGTCTGGAATCTCAATG............AGCAGCTACTACATGCACTGGATCCGCCAGAAACCAGGGAAAGGACTGGA
GTGGATCGGGCGAATTGATGGTGGC.........ACTGGAACTAATTTTGCTCAGTCTTTACAA...GGCCAGTTCACC
ATCACCAAAGACACCAGTAAAAACATGCTGTATTTAGAGGTGAAACAGCTGAAGAGTGAAGACACAGCTGTTTATTACT
GTGCACGAGAC
>AF273902|IGHV1S2*05_Danrer|(F)|V-REGION
............................................AAGACCAGGAGAATCAGTCACTCTGTCCTGCACTG
TGTCTGGAATCTCAATG............AGCACCTACTACATGCACTGGATCCGCCAGAAACCAAGGAAAGGACTGGA
GTGGATCGTGCGAATTGATGGTGGC.........ACTGGCACTAATTTTGCTCAGTCTTTACAA...GGCCAGTTCACC
ATCACCAAAGACACCAGTAAAAACATGCTGTATTTAGAGGTGAAACAGCTGAAGAGTGAAGACACAGCTGTTTATTACT
GTGCACGAGACT
>AF273890|IGHV1S3*01_Danrer|(F)|V-REGION
............................................AAGACCAGGAGAATCAGTCACTCTGTCCTGCACTG
TGTCTGGATTTTCAATG............AGCAGGTACTACATGCACTGGATCCGCCAGAAACCAGGGAAAGGACTGGA
GTGGATTGGATATATAGACACTGGC.........ACAACAGCATATTACGGTCAGTCTTTACAA...GGCCAGTTCACT
ATCACCAAAGACACCAGTAAAAACATGCTGTATTTAGAGGTGAAAAGCCTGAAGAGTGAAGACACAGCTGTTTATTACT
GTGCACGGACC
>AF273900|IGHV1S3*02_Danrer|(F)|V-REGION
............................................AAGACCAGGAGAATCAGTCACTCTGTCCTGCACTG
TGTCTGGATTCTCAATG............AGCAGGTACTACATGCACTGGATCCGCCAGAAACCAGGGAAAGGACTGGA
GTGGATTGGATACATAGACACCGGC.........ACAACAGCATATTACGGTCAGTCTTTACAA...GGCCAGTTCACT
ATCACCAAAGAGACCAGTAAAAACATGCTGTATTTAGAGGTGAAAAGCCTGAAGAGTGAAGACACAGCTGTTTATTACT
GTGCACGGACA
>AF273901|IGHV1S3*03_Danrer|(F)|V-REGION
............................................AAGACCAGGAGAATCAGTCACTCTGTCCTGCATTG
TGTCTGGATTCTCAATG............AGCAGTTACTACATGCACTGGATCCGCCAGAAACCAGGGAAAGGACTGGA
GTGGATTGGATATATAGACACTGGC.........ACAACAGCATATTACGCTCAGTCTTTACAA...GGCCAGTTCACT
ATCACCAAAGACACCAGTAAAAACATGCTGTATTTAGAGGTGAAAAGCCTGAAGAGTGAAGACACAGCTGTTTATTACT
GTGCACGGACT
>AF273894|IGHV1S3*04_Danrer|(F)|V-REGION
............................................AAGACCAGGAGAATCAGTCACTCTGTCCTGCACTG
TGTCTGGATTCTCAATG............AACAGGTATTACATGCACTGGATCCGCCAGAAACCAGGGAAAGGACTGGA
GTGGATTGGATATATAGACACTGGC.........ACAACAGCATATTACGCTCAGTCTTTACAA...GGCCAGTTCACT
ATCACCAAAGACACCAGTAAAAACATGCTGTATTTAGAGGTGAAAAGCCTGAAGAGTGAAGACACAGCTGTTTATTACT
GTGCACGGACA
>AF273893|IGHV1S3*05_Danrer|(F)|V-REGION
............................................AAGACCAGGAGAATCAGTCACTCTGTACTGCACTG
TGTCTGGATTCTCAATG............AACAGGTATTACATGCACTGGATCCGCCAGAAACCAGGGAAAGGACTGGA
GTGGATTGGATATATAGACACTGGC.........ACAACAGCATATTACGCTCAGTCTTTACAA...GGCCAGTTCACT
ATCACCAAAGACACCAGTAAAAACATGCTGTATTTAGAGGTGAAAAGCCTGAAGAGTGAAGACACAGCTGTTTATTACT
GTGCACGGACA
>AF273892|IGHV1S4*01_Danrer|(F)|V-REGION
..........TGACCTCC......TCAGACTCT...GTGGTGAAAAGACCAGGAGAATCAGTCACTCTGTCCTGCACTG
TGTCTGGAATCTCAATG............AGTAGCTGGTACATGCACTGGATCCGCCAGAAACCAGGGAAAGGACTGGA
GTGGATTGGATATATAGACACTGGC.........ACAACAGCATATTACGCTCAGTCTTTACAA...GGCCAGTTCACT
ATCACCAAAGACACCAGTAAAAACATGCTGTATTTAGAGGTGAAAAGGCTGAAGAGTGAAGACAC
>AF273896|IGHV1S4*02_Danrer|(F)|V-REGION
..........TGACCTCC......TCAGACTCT...GTGGTGAAAAGACCAGGAGAATCAGTCACTCTGTCCTGCACTG
TGTCTGGAATCTCAATG............AGTAGCTGGTACATGCACTGGATCCGCCAGAAACCAGGGAAAGGACTGGA
GTGGATTGGATATATAGACACTGGC.........ACAACAGCATATTACGCTCAGTCTTTACAA...GGCCAGTTCACT
ATCACCAAAGACACCAGTAAAAACATGCTGTATTTAGAGGTGAAAAGCCTGAAGAGTGAAGACAC
>AF273879|IGHV2S1*01_Danrer|(F)|V-REGION
GAAATTCGATTAGATCAG......TCACCTTCT...GTGACAAAGAGACCTGGAGAAACGGTGATGATCTCCTGTAAAA
TATCTGGGTTTACAATG............ACACGCTACTACATGCACTGGATACGGCAGAAGCCTGGAAAAGCTCTGGA
GTGGATTGGGAGAGTTAACTCTGGC......TCTGGTAGTGCTGATTATGCAGATTCCATGAAA...AACCAATTCACT
CTGAGTGAGGACGTGTCTCAAAATATGCAATATCTTGAAGCCAAGAGTCTGAGAGAAGAGGACACTGCTGTTTATTACT
GTGCTCGGGGA
>AF273887|IGHV2S1*02_Danrer|(F)|V-REGION
GAAATTCGATTAGATCAG......TCACCTTCT...GTGACAAAGAGACCTGGAGAAACGGTGATGATCTCCTGTAAAA
TATCTGGGTTTACAATG............ACACGCTACTACATGCACTGGATACGGCAGAAGCCTGGAAAAGCTCTGGA
GTGGATTGGGAGAGTTAACTCTGGC......TCTGGTAGTACTGATTATGCAGATTCCATGAAA...AACCAATTCACT
CTGAGTGAGGACGTGTCTCAAAATATGCAATATCTTGAAGCCAAGAGACTGAGAGAAGAGGACACTGCTGTTTATTACT
GTGCTCGGGAG
>AF273883|IGHV3S1*01_Danrer|(F)|V-REGION
TGTCAAACACTGACCGAG......TCTGAAGCG...GCGGTCATTAAACATGGAGAATCTCACAGACTTACCTGTACAG
TCTCTGGATTCAGTGAT...............GATCCGTATTTGGCTTGGATCAGACAGACTGCAGGAGGAGGTCTGGA
GTGGCTGGCGTACATCTCAAGTAGT......GGTAGTACTACATACTACTCTCAGTCAGTTCAG...GGACGCTTCACC
ATCTCCAGAGACGACAGCAAGAAACAGATGTATCTGCAGATGAATAATATGAAGAGTGAAGACACTGCTGTATATTATT
GTGCAAGA
>AF273876|IGHV4S1*01_Danrer|(F)|V-REGION
CAAAGTATGGAGTCGATT......GAAAGCTCA...GTGCAGAGAAAGCCTGGAGAAACTCTGACTCTGTCCTGCAGAG
GATCCGGGTTCAGCTTT............AGCTCCTATTACATGCACTGGATCAGGCAACAAGCTGGAAAACCTCTTGT
GTGGATTGGAGGCACTGGC.....................TATGGCTATGTTGAATCCTTTAAA...GGAAGAGGTGAA
ATCACCAGAGATAATTCAAAGAGTATGACATATCTGAAACTATCAGGTCTGACAGTAGAAGATTCAGCCGTGTATTACT
GTGCAAGACAA
>AF273884|IGHV4S1*02_Danrer|(F)|V-REGION
CAAAGTATGGAGTCGATT......GAAAGCTCA...GTGCAGAGAAAGCCTGGAGAAACTCTGACTCTGTCCTGCAGAG
GATCCGGGTTCAGCTTT............AGCTCCTATTACATGCACTGGATCAGGCAACAAGCTGGAAAACCTCTTGT
GTGGATTGGAGGCACTGGC.....................TATGGCTATGTTGAATCCTTTAAA...GGAAGAGGTGAA
ATCTCCAGAGATAATTCAAAGAGTATGACATATCTGAAACTATCAGGTCTGACAGTAGAAGATTCAGCCGTGTATTACT
GTGCAAGACAA
>AF273877|IGHV4S1*03_Danrer|(F)|V-REGION
CAAAGTATGGAGTCGATT......GAAAGCTCA...GTGCAGAGAAAGCCTGGAGAAACTCTGACTCTGTCCTGCAGAG
GATCCGGGTTCAGCTTT............AGTTCCTATTACATGCACTGGATCAGGCAACAAGCTGGAAAACCTCTTGT
GTGGATTGGAGGCACTGGC.....................TATGGCTATGCTGAATCCTTTAAA...GGAAGAGCTGAA
ATCACCAGAGATAATTCAAAGAGTATGACATATCTGAAACTATCAGGTCTGACAGTAGAAGATTCAGCCGTGTATTACT
GTGCAAGACAA
>AF273882|IGHV4S2*01_Danrer|(F)|V-REGION
CAAAGTATGGAGTCAATT......GAAAGCTTA...GTTCAGAAGAAGCCTGGAGAAACTCTGACTCTGTCCTGTAGAG
GATCTGGGTTCACCTTT............AGCTCCTATAGCATGCACTGGATCAGACAACAAGCTGGAAAACCTCTTGT
GTGGATTGGATACACTGGC.....................CAAAACTATGCTGAATCCTTCAAA...GGAAGAGCTGAA
ATCACCAGAGATGATTCAAAGAGTATGACATATCTGAAACTATCAGGCCTGACAGCAGAAGACTCAGCCGTGTATTACT
GTGCAAGAGAA
>AF273885|IGHV4S2*02_Danrer|(F)|V-REGION
CAAAGTATGGAGTCGATT......GAAAGCTTA...GTTCAGAAGAAGCCTGGAGAAACTCTGACTCTGTCCTGTAGAG
GATCTGGGTTCACCTTT............AGCTCCTATAGCATGCACTGGATCAGACAACAAGCTGGAAAACCTCTTGT
GTGGATTGGATACACTGGC.....................CAAAACTATGCTGAATCCTTCAAA...GGAAGAGCTGAA
ATCACCAGAGATAATTCAAAGAGTATGACATATCTGAAACTATCAGGCCTGACAGCAGAAGACTCAGCCGTGTATTACT
GTGCAAGAGAA
>AF273878|IGHV4S3*01_Danrer|(F)|V-REGION
CAAGGCATGGAGTCAATT......GAAAGCTCA...GTTCAGAAAAAGCCTGGAGAAACTCTGACTCTGTCCTGTAGAA
GATCCGGGTTCACCTTT............AGCTACTATCACATGCACTGGATCAGACAACAAGCTGGAAAACCTCTTGT
ATGGATTGGACACACTGGC.....................CAAAACTATGCTGAATCCTTCAAA...GGAAGAGCTGAA
ATCACCAAAGATAATTCAAAGAGTATGACATATCTGAAACTATCAGGCCTGACACCAGAAGATTCAGCCGTGTATTACT
GTGCAAGAGTA
>M26182|IGHV1S1*01_Elosau|(F)|V-REGION
AGCCAGACACTGACTGAG......TCTGAACCA...GCAGTTAAAAAGCCTGGAGAATCCCACAAACTGACCTGCACAG
CCTCTGGGTTCACATTC............AGTAATTATTGGATGGGCTGGATCAGACAGGCTCCTGGGAAGGGACTGGA
GTGGTTGGCAACTCTGAAATATAAC......AGTGCTGAGGAGTATTACTCCCAATCTGTCAAG...GGAAGATTCACC
ATCTCCAGAGACAACAGCAAGAACCAGCTGTATTTACAGATGAACAGTCTAAGAGCTGAAGACACTGCTGTGTATTACT
GTGCCAGA
>M26579|IGHV2S1*01_Elosau|(F)|V-REGION
TGTGTTGAACTCACCCAG......CCAGGTTCT...ATGGCTGTAAAGCCAGGAGAGTCTCTGACCATCTCCTGTAAAG
TCTCTGGTTATTCCCTGACT......GATAGTACCTACTGTACAAACTGGATACGACAGCCTGTGGGGAAAGCATTAGA
ATGGATTGGACGTATTTGTGGCAGT.........GGAAACACTTACTACAAAGATTCTCTTAAG...AACAAATTCACC
ATCTCCAGAGACACCTCCAGCAGCACAGTGAAATTACAAGGACGCAGCCTGCAGACTGAAGACACAGCTGTGTATTACT
GTGCCCGAG
>X58870|IGHV1S1*01_Gadmor|(F)|V-REGION
AGCTTGGAACTTTCCCAG......CCTGTCGCT...GTCGTTGTGAGAACGACAGAGCCATTGGTCCTTACCTGTAAAG
TAACAGGATATTCTGTCAGTAGTGGTAGTGTAGACTACGCCACAAGTTGGATCAGACATCCAAAAGGACAACCACTGGA
GTGGATTTCCCATATCTGGGACAAC.........GGAGATATCTATAAAAACAATGCGCTGTCT...AGCAAGTTCACA
ATTTCTCGTGACTCAACTAGTAACTCAGTTTCTTTAAGAGGCCAGAATTTGCAGGAGAGTGATACAGCTGTGTATTACT
GTGCTCGC
>AJ279353|IGHV1S1*02_Gadmor|(F)|V-REGION
AGCTTGGAACTTTCCCAG......CCTGTCGCT...GTCGTTGTGAGAACGACAGAGCCATTGGTCCTTACCTGTAAAG
TAACAGGATATTCTGTCAGTAGTGGTAGTGTAGACTACGCCACAGGTTGGATCAGACATCCAAAAGGAAAACCACTGGA
GTGGATTTCCCATATCTGGGACAAC.........GGAGATATCTATAAAAACAATGCGCTGTCT...AGCAAGTTCACA
ATTTCTCGTGACTCAACTAGTAACTCAGTTTCTTTAAGAGGCCAGAATTTGCAGGACAGTGATACAGCTGTGTATTACT
GTGCTCGC
>AJ274705|IGHV1S1*03_Gadmor|(F)|V-REGION
AGCTTGGAACTTTCCCAG......CCTGTCGCT...GTCGTTGTGAGAACGACAGAGCCATTGGTCCTTACCTGTAAAG
TAACAGGATATTCTGTCAGTAGTGGTAGTGTAGACTACGCCACAGGTTGGATCAGACATCCAAAAGGAAAACCACTGGA
GTGGATTTCCCATATCTGGGACAAC.........GGAGATATCTATAAAAACAATGCGCTGTCT...AGCAAGTTCACA
ATTTCTCGTGACTCGACTAGTAACTCAGTTTCTTTAAGAGGCCAGAATTTGCAGGAGAGTGATACAGCTGTGTATTACT
GCGCCAGG
>AJ279354|IGHV1S2*01_Gadmor|(F)|V-REGION
AGCTTGGAACTTTCCCAG......CCTGTCGCT...GTCGTTGTGAGAACGACAGAGCCATTGGTCCTTACCTGTAAAG
TAACAGGATATTCTGTCAGTAGTGGTAATGCAGACTACGCCACAGGTTGGATCAGACATCCAAAAGGAAAACCACTGGA
GTGGATTTCCCATATCTGGGACGAC.........GGAGATATCTTTAAAAACAATGCGCTGTCT...AACAAGTTCACA
ATTTCTCGTGACTCGACTAGTAACTCAGTTTCTTTAAGAGGCCAGAATTTGCAGGAGAGTGATACAGCTGTGTATTACT
GCGCCAGG
>X76510|IGHV2S1*01_Gadmor|(F)|V-REGION
GGCCAGCAACTCACCTCC......TCAGAATCG...GTGGTCAAAAGGCAAGGAGAACCGGTTACACTGTCCTGTCACG
TGACCGGAGTCTCC..................CTCACTTATCTTCACTGGATTCGCCAGAGGTCAGGACATGGCCTGGA
GTGGATTGGACGGATAGATGATGGA.........ACCGGAACAATTTTTGCAGCGTCTCTTCAA...GGGCAGTTCACC
ATCACCAAAGACAGCACCAGAGAGGAGGTTTACTTAAATGTGAAGAGTCTGAAGCCAGAGGACTCAGCTCTTTATTATT
GTGCTAAA
>AJ274709|IGHV2S1*02_Gadmor|(F)|V-REGION
GGCCAGCAACTCACCTCC......TCAGAATCG...GTGGTCAAAAGGCAAGGAGAACCGGTTACACTGTCCTGTCACG
TGACCGGAGTCTCC..................CTCACTTATCTTCACTGGATTCGCCAGAGGTCAGGACATGGCCTGGA
GTGGATTGGACGGATAGATGATGAA.........ACCGGAACAATTTTTGCAGCGTCTCTTCAA...GGGCAGTTCACC
ATCACCAAAGACAGCACCAGAGAGGAGGTTTACTTAAATGTGAAGAGTCTGAAGCCAGAGGACTCAGCTCTTTATTATT
GTGCTAAA
>AJ279362|IGHV2S2*01_Gadmor|(F)|V-REGION
GGCCAGCAACTCACCTCC......TCAGAATCG...GTGGTCAAAAGGCAAGGAGAACCGGTTACACTGTCCTGTCACG
TGACCGGAGTCTCT..................CTCACTTATCTTCACTGGATTCGCCAGAGGTCAGGACATGGCCTGGA
GTGGATTGGACGGATAGATAGTGGA.........ACCGGAACAACTTTTGCAGCGTCTCTTCAA...GGGCAGTTCACC
ATTACCAAAGACAGCACCAGAGAGGAGGTTTACTTAAATGTGAAGAGTCTGAAGCCAGAGGACTCAGCTCTTTATTATT
GTGCTAAA
>AJ279363|IGHV2S2*02_Gadmor|(F)|V-REGION
GGCCAGCAACTCACCTCC......TCAGAATCG...GTGGTCAAAAGGCAAGGAGAACCGGTTACACTGTCCTGTCACG
TGACCGGAGTCTCT..................CTCACTTATCTTCACTGGATTCGCCAGAGGTCAGGACATGACCTGGA
GTGGATTGGACGGATAGATAGTGGA.........ACCGGAACAACTTTTGCAGCGTCTCTTCAA...GGGCAGTTCACC
ATTACCAAAGACAGCACCAGAGAGGAGGTTTACTTAAATGTGAAGAGTCTGAAGCCAGAGGACTCAGCTCTTTATTATT
GTGCTAAA
>AJ274715|IGHV3S1*01_Gadmor|(F)|V-REGION
TGTGAACAGCTTACTCAG......CCAGGGTCT...CTGACTGTCCGACCTGGTCAACCTCTGACCATCCGCTGTCAGG
TCTCTTATTCTGTTAGT...............AGCCAGTATACAGCTTGGATCAGACAACCTGATGGAAAGGGACTGGA
ATGGATAGGCGATGAA........................GGAAATCTGAAAGACTCCCTAGGT...AGCAAATTCAGT
ATTTCTGTTGACGAGGACAGCAACACAGCTATTTTACAAGGACAAAACATGCAGCCTGGAGACTCAGCTGTGTATTACT
GTGCCAGG
>AJ274742|IGHV3S1*02_Gadmor|(F)|V-REGION
TGTGAACAGCTTACTCAG......CCAGGGTCT...CTGACTGTCCGACCTGGTCAACCTCTGACCATCCGCTGTCAGG
TCTCTTATTCTGTTAGT...............AGCCAGTATACAGCTTGGATCAGACAACCTGATGGAAAGGGACTGGA
ATGGATAGGCGATGAA........................GGAAATCTGAAAGACTCCCTAGGT...AGCAAATTCAGT
ATTTCTGTTGACGAGGACAGCAACACAGCTACTTTACAAGGACAAAACATGCAGCCTGGAGACTCAGCTGTGTATTACT
GTGCCAGG
>AJ274722|IGHV3S2*01_Gadmor|(F)|V-REGION
TGTGAACAGCTTACTCAG......CCAGAGTCT...CTGACTGTCCGACCTGGTCAACCTCTGACCATCCTCTGTCAGG
TCTCTTATTCTGTTAGT...............AGCCACTACACAGCTTGGATCAGACAACCTGATGGAAAGGGACTGGA
ATGGATAGGCTATGAA........................GGAAATCTGAAAGACTCCCTAGGT...AGCAAATTCAGT
ATTTCTGTTGACGGCTCCAGCAACACAGCTACTTTACAAGGACAAAACATGCAGCCTGGAGACTCAGCGGTGTATTACT
GTGCCAGG
>AJ274729|IGHV3S2*02_Gadmor|(F)|V-REGION
TGTGAACAGCTTACTCAG......CCAGGGTCT...CTGACTGTCCGACCTGGTCAACCTCTGACCATCCTCTGTCGGG
TCTCTTATTCTGTTAGT...............AGCCACTATACAGCTTGGATCAGACAACCTGATGGAAAGGGACTGGA
ATGGATAGGCGATGAA........................GGAAATCTGAAAGACTCCCTAGGT...AGCAAATTCAGT
ATTTCTGTTGACAAGGCCAGCAACACAGCTACTTTACAAGGACAAAACATGCAGCCTGGAGACTCAGCTGTGTATTACT
GTGCCAGG
>AJ279366|IGHV3S3*01_Gadmor|(F)|V-REGION
TGTGAACAGCTTACTCAG......CCAGAGTCT...CTGACTGTCCGACCTGGTCAACCTCTGACTATCCGCTGTCAGG
TCTCTTATTCTGTTAGT...............ACCTACTACACACATTGGATAAGACAACCTGATGGAAAGGGACTGGA
ATGGATAGGCAATGAA........................GGACATCTGAAAGACTCCCTAAGT...AGCAAATTCAGT
ATTTCTGTTGACGAGGCCAGCAACACAGCTACTTTACAAGGACAAAACATGCAGCCTGTAGACTCAGCTGTGTATTACT
GTGCCAGG
>AJ279365|IGHV3S3*02_Gadmor|(F)|V-REGION
...............................................................ACCATCCGCTGTCAGG
TCTCTTATTCTGTTAGT...............GGCGACTATACAGCTTGGATCAGACAACCTGATGGAAAGGGACTGGA
ATGGATAGGCAATGAA........................GGACATCTGAAAGACTCCCTAAGT...AGCAAATTCAGT
ATTTCTGTTGACGAGGCCAGCAACACAGCTACTTTACAAGGACAAAACATGCAGCCTGTAGACTCAGCTGTGTATTACT
GTGCCAGG
>AJ279368|IGHV3S4*01_Gadmor|(F)|V-REGION
TGTGAACAGCTTACTCAG......CCAGGGTCT...CTGACTGTCCGACCTGGTCAACCTCTGACCATCCGCTGTCAGG
TCTCTTATTCTGTTAGT...............AGCTACGCGACAGCTTGGATCAGACAACCTGATGGAAAGGGACTGGA
ATGGATAGGCGATGAA........................GGAAATCTGAAAGACTCCCTAGGT...AGCAAATTCAGT
ATTTCTGTTGACGAGGCCAGCAACACAGCTACTTTACAAGGACAAAACATGCAGCCTGGAGACTCAGCTGTGTATTACT
GTGCCAGA
>AJ279369|IGHV3S4*02_Gadmor|(F)|V-REGION
TGTGAACAGCTTACTCAG......CCAGGGTCT...CTGACTGTCCGACCTGGTCAACCTCTGACCATCCGTTGTCAGG
TCTCTTATTCTGTTAGT...............AGCTACGCGACAGCTTGGATCAGACAACCTGATGGAAAGGGACTGGA
ATGGATAGGCGATGAA........................GGAAATCTGAAAGACTCCCTAGGT...AGCAAATTCAGT
ATTTCTGTTGACGAGGCCAGCAACACAGCTACTTTACAAGGACAAAACATGCAGTCTGGAGACTCAGCTGTGTATTACT
GTGCCAGG
>AJ279367|IGHV3S4*03_Gadmor|(F)|V-REGION
AGTGAACAGCTTACTCAA......CCCGAGTCT...CTGACTATCCGACCTGGTCAGTCTCTGACCATCCACTGTCAGG
TCTCTTATTCTGTTAGT...............ACCTTCGCCACAGCTTGGTTCAGACAACCTGATGGAAACGGACTGGA
ATGGATAGGCGATGAA........................GAAAATCTGAAAGACTCCCTAGGT...AGCAAATTCAGT
ATTTCTGTTGACGAGGCCAGCAACACAGCTACTTTACAAGGACAAAACATGCAGCCTGGAGACTCAGCTGTGTATTACT
GTGCCAGC
>AJ274745|IGHV3S5*01_Gadmor|(F)|V-REGION
AGTGAACAGCTTACTCAG......CCAGAGTCT...CTGACTCTCCGACCTGGTCAACCTCTGACCATCCGCTGTCAGG
TCTCTTATTCTGTTAGTAGC.........ACTGGCTACGCGACACATTGGATCAGACAACCTGATGGAAGAGGACTGGA
ATGGATTGGAGGGATTAGGATT............GGTTGGAAAGGAGCGAAAGACTCCCTAAGT...AGTCAATTCAGT
CTTGCCGTTGATGGCTCCAGTAAAACAATTACTTTGCAAGGGCAGAACATGCAGCCTAGAGACTCAGCTGTGTATTTCT
GTGCCAGAG
>AJ274755|IGHV3S5*02_Gadmor|(F)|V-REGION
..................................................CGCTCAACCTCTGACCATCCGCTGTCAGG
TCTCTTATTCTGTTAGTAGC.........ACTGGCTACGCGACACATTGGATCAGACAACCTGATGGAAGAGGACTGGA
ATGGATTGGAGGGATTAGGATT............GGTTGGAAAGGAGCGAAAGACTCCCTAAGT...AGTCAATTCAGT
CTTGCCGTTGATGGCTCCAGTAAAACAATTACTTTGCAAGGGCAGAACATGCAGCCTGGAGACTCAGCTGTGTATTACT
GTGCCCGG
>AJ274726|IGHV3S5*03_Gadmor|(F)|V-REGION
AGTGAACAGCTTACTCAG......CCAGAGTCT...CTGACTCTCCGACCTGGTCAACCTCTGACCATCCGCTGTCAGG
TCTCTTATTCTGTTAGTAGC.........ACTGGCTACGCGACACATTGGATCAGACAACCTGATGGAAGAGGACTGGA
ATGGATTGGAGGGATTAGGATT............GGTTGGAAAGGAGCGAAAGACTCCCTAAGT...AGTCAATTCAGT
CTTGCCGTTGATGGCTCCAGTAAAACAATTACTTTGCAAGGGCAGAACATGCAGCCTGGAGACTCAGCTGTGTATTACT
GTGCCAGA
>AJ274718|IGHV3S6*01_Gadmor|(F)|V-REGION
TGTGAACAGCTTACTCAG......CCAGAGTCT...CTGACTCTCCGACCTGGTCAACCTCTGACCATCCGCTGTCAGG
TCTCTTATTCTGTTAGT...............AGCTACGAGACACATTGGATCAGACAACCTGATGGAAGAGGACTGGA
ATGGATTGGAGGGATTAGGATT............GGTTGGAAAGGAGCGAAAGACTCCCTAAGT...AGTCAATTCAGT
CTTGCCGTTGACAGCTCCGTTAACACAGTAACTTTGCAAGGGCAAAACATGCAGCCTGGTGACTCAGCTGTGTATTACT
GTGCCAGA
>AJ274736|IGHV3S6*02_Gadmor|(F)|V-REGION
AGTGAACAGCTTACTCAG......CCAGAGTCT...CTGACTCTCCGACCTGGTCAACCTCTGACCATCCGCTGTCAGG
TCTCTTATTCTGTTAGT...............AGCTACGAGACACATTGGATCAGACAACCTGATGGAAGAGGACTGGA
ATGGATTGGAGGGATTAGGATT............GGTTGGAAAGGAGCGAAAGACTCCCTAAGT...AGTCAATTCAGT
CTTGCCGTTGACAGCTCCGGTAACACAGTAACTTTGCAAGGGCAAAACATGCAGCCTGGTGACTCAGCTGTGTATTACT
GTGCCAGC
>AJ274748|IGHV3S7*01_Gadmor|(F)|V-REGION
TGTGAACAGCTTACTCAG......CCCGAGTCT...CTGACTGTCCGACCTGGTCAACCTCTGACCATCCTCTGTCAGG
TCTCTTATTCTGTTAGT...............AGCTACAGCACGCATTTGATCAGACAACCTGATGGAAGAGGACTGGA
ATGGATTGGAGGGATTCATACT............GGTTGGAAAGGACTGAAAGGCTCCCTTAGT...AGTAAATTCAGT
CTTGCCGTTGACGGCTCCAGTAACACAGTAACTTTGCAAGGGCAGAACATGCAGCCTGGAGACTCAGCTGTGTATTACT
GTGCCAGA
>AJ279370|IGHV3S8*01_Gadmor|(F)|V-REGION
TGTGAACAGCTTACTCAG......CCCGAGTCT...CTGACTGTCCGACCTGGTCAACCTCTGACCATCCTCTGTCAGG
TCTCTTATTCTGTTAGT...............AGCTACAGCACACATTGGATAAGACAACCTGATGGAAAGGGACTGGA
ATGGATTGGAGGGATTAATACT............GGTTGGAAAGGAGCAAAAGACTCCCTAAGT...AGTAAATTCAGT
CTTTCCCTTGACGTGGCCAGTAAAACAGTAACTTTGCAAGGGCAGAACATGCAGCCTGGAGACTCAGCTGTGTATTACT
GTGCCAGA
>AJ274750|IGHV3S9*01_Gadmor|(F)|V-REGION
TGTGAACAGCTTACTCAG......CCAGAGTCT...CTGACTGTCCGACCTGGTCAACCTCTGACCATCCGCTGTCAGG
TCTCTTTTTCTGTTAGT...............AGCTACGCGACAGCTTGGATCAGACAACCTGATGGAAAAGGACTGGA
ATGGATTGGATGGATTTATACC............AGTGACAAAAAAGTGAAAGACTCCTTTAAT...AGTAAATTCAGT
CTTTCCCTTGACGAGGCCAGTAAAACAATAACTTTGCAAGGGCAAAACATGCAGCCTGGAGACTCAGCTGTGTATTACT
GTGCCGAA
>AJ274719|IGHV3S9*02_Gadmor|(F)|V-REGION
TGTGAACAGCTTACTCAG......CCAGAGTCT...CTGACTGTCCGACCTGGTCAACCTCTGACCATCCGCTGTCAGG
TCTCTTATTCTGTTAGT...............AGCTACTTGACAGCTTGGATCAGACAACCTGATGGAAAAGGACTGGA
ATGGATTGGATGGATTTATACC............GCGGACAAAAAAGTGAAAGACTCCCTTAGT...AGTAAATTCAGT
CTTTCCCTTGACGAGGCCAGTAAAACAGGCACTTTGCAAGGGCAAAACATGCAGCCTGGAGACTCTGCTGTGTATTACT
GTGCCGGG
>AJ274731|IGHV3S9*03_Gadmor|(F)|V-REGION
TGTGAACAGCTTACTCAG......CCAGAGTCT...CTGACTGTCCGACCTGGTCAACCTCTGACCATCCGCTGTCAGG
TCTCTTATTCTGTTAGT...............AGCTACTTGACAGCTTGGATCAGACAACCTGATGGAAAAGGACTGGA
ATGGATTGGATGGATTTATACC............GCGGACAAAAAAGTGAAAGACTCCCTTAGT...AGTAAATTCAGT
CTTTCCCTTGACGAGGCCAGTAAAACAGTCACTTTGCAAGGGCAAAACATGCAGCCTGGAGACTCTGCTGTGTATTACT
GTGCCAGA
>AJ279371|IGHV3S9*04_Gadmor|(F)|V-REGION
TGTGAACAGCTTACTCAG......CCAGAGTCT...CTGACTGTCCGACCTGGTCAACCTCTGACCATCCGCTGTCAGG
TCTCTTATTCTGTTAGT...............AGCTACTTGACAGCTTGGATCAGACAACCTGATGGAAAAGGACTGGA
ATGGATTGGATGGATTTATACC............GCGGACAAAAAAGTGAAAGACTCCCTTAGT...AGTAAATTCAGT
CTTTCCCTTGACGAGGCCAGTAAAACAGTCACTTTGCAAGGGCAAAACATGCAGCCTGGAGACTCAGCTGTGTATTACT
GTGCCAGA
>AJ274721|IGHV3S10*01_Gadmor|(F)|V-REGION
TGTGAACAGCTTACTCAG......CCAGAGTCT...CTGACTGTCCGACCTGGTCAACCTCTGACCATCCGCTGTCAGG
TCTCTTATTCTGTTAGT...............AGCTATTGGACACATTGGATCAGACAACCTGAAGGAAACTCACTGGA
ATGGATTGGATTCATTTATACC............AGTGACAAAAAAGTGAAAGACTCCCTTACT...AGTAAACTCAGT
CTTTCCCTTGACGAGGCCAGTAAAACAGTCACTTTGCAAGGGCAAAACATGCAGCCTGGAGACTCAGCTGTGTATTACT
GTGCCAGG
>AJ274730|IGHV3S10*02_Gadmor|(F)|V-REGION
TGTGAACAGCTTACTCAG......CCAGAGTCT...CTGACTGTCCGACCTGGTCAACCTCTGACCATCCGCTGTCAGG
TCTCTTATTCTGTTAGT...............AGCTATTGGACACATTGGATCAGACAACCTGAAGGAAACTCACTGGA
ATGGATTGGATTCATTTATACC............AGTGACAAAAAAGTGAAAGACTCCCTTACT...AGTAAATTCAGT
CTTTCCCTTGACGAGGCCAGTAAAACAGTCACTTTGCAAGGGCAAAACATGCAGCCTGGAGACTCAGCTGTGTATTACT
GTGCCAGG
>AJ274737|IGHV3S11*01_Gadmor|(F)|V-REGION
TGTGAACAGCTTACTCAG......CCAGGGTCT...CTGACTATCCAACCTGGTCAACCTCTGACCATCCGCTGCCAGG
TCTCCTATACACTT..................AACTACTGGACACATTGGATCAGACAACCTGAAGGAAACTCACTGGA
ATGGATTGGATTCATTTATACC............GGGGACAAAAAAGTGAAAGACTCCCTTAGT...AGTAAATTCAGT
CTTTCCCTTGACGAGGCCAGTAAAACAGTCACTTTGCAAGGGCAAAACATGCAGCCTGGAGACTCAGCTGTGTATTACT
GTGCCGGA
>AJ279375|IGHV3S11*02_Gadmor|(F)|V-REGION
TGTGAACAGCTTACTCAG......CCAGGGTCT...CTGACTATCCAACCTGGTCAACCTCTGACCATCCGCTGTCAGG
TCTCCTATACACTT..................AACTACTGGACACATTGGATCAGACAACCTGAAGGAAACTCACTGGA
ATGGATTGGATTCATTTATACC............GGGGACAAAAAAGTGAAAGACTCCCTTAGT...AGTAAATTCAGT
CTTTCCCTTGACGAGGCCAGTAAAACAGTCACTTTGCAAGGGCAAAACATGCAGCCTGGAGACTCAGCTGTGTATTACT
GTGCCAGG
>AJ274756|IGHV3S11*03_Gadmor|(F)|V-REGION
......................................................................TCTGCGGCC
GCTCCTATACACTT..................AACTACTGGACACATTGGATCAGACAACCTGAAGGAAACTCACTGGA
ATGGATTGGATTCATTTCTACC............GGGAACAAAAAAGTGAAAGACTCCCTTAGC...AGTAAATTCAGT
CTTTCCCTTGACGAGGCCAGTAAAACAGTCACTTTGCAAGAGCAAAACATGCAGCCTGGAGACTCAGCTGTGTATTACT
GTGCCAGG
>AJ274741|IGHV3S12*01_Gadmor|(F)|V-REGION
TGTGAACAGCTTACTCAG......CCAGAGTCT...CTGACTGTCCGACCTGGTCAACCTCTGACCATCTGCTGTCAGG
TCTCTTATTCTGTTAGT...............AGCTACGAGACACATTGGATAAGACAACCTGAAGGAAACTCACTGGA
ATGGATTGGATGGATTGATACC............GGGGACCAACACCTGAAAGACTCTCTTAGT...AGTAAATTCAGT
CTTGCCGTTGACGGCTCCAGTAAAACAGTAACTTTGCAAGGGCAAAGCATGCAGCCTGGAGACTCAGCTGTGTATTACT
GTGCCAGA
>AJ279385|IGHV3S12*02_Gadmor|(F)|V-REGION
TGTGAACAGCTTACTCAG......CCAGAGTCT...CTGACTGTCCGACCTGGTCAACCTCTGACCATCTGCTGTCAGG
TCTCTTATTCTGTTAGT...............AGCTACGAGACACATTGGATAAGACAACCTGAAGGAAACTCACTGGA
ATGGATTGGATGGATTGATACC............GGGGACCAACACCTGAAAGACTCTCTTAGT...AGTAAATTCAGT
CTTGCCGTTGACGGCTCCAGTAAAACAGTAACTTTGCAAGGGCAAAACATGCAGCCTGGAGACTCAGCTGTGTATTACT
GTGCCAGA
>AJ279378|IGHV3S13*01_Gadmor|(F)|V-REGION
TGTGAACAGCTTACTCAG......CCAGAGTCT...CTGACTGTCCGACCTGGTCAACCTCTGACCATCCGCTGTCAGG
TCTCTTATTCTGTTAGT...............AGCTACGAGACACATTGGATCAGACAACCTGAAGGACACGCACTGGA
ATGGATTGGATGGATTGATACC............GGGGACAAAAGAGTGAAAGATTCCCTTGGT...AGTAAATTCAGT
CTTTCCCTTGATGAGGCCAGTAAAACAGTAACTTTGCAAGGGCAAAACATGCAGCCTGGAGACTCAGCTGTGTATTACT
GTGCCAGA
>AJ274754|IGHV3S14*01_Gadmor|(F)|V-REGION
TGTGAACAGCTTACTCAA......CCCGAGTCT...CTGACTGTCCGACCTGGCCAACCTCTGACCATCCGCTGTCAGG
TCTCTTATTCTGTTAGT...............GGCCACTACACAGCTTGGATCAGACAACCCGAAGGACAGGCACTGGA
ATGGATTGGATGGATTTATACC............GGGGACAAAAAAGTGAAAGACTCCCTTAGT...AGTAAATTCAGT
CTTTCCCTTGACGAGGCCAGTAAAACAGTCACTTCGCAAGGGCAAAACATGCAGCCTGGAGACTCAACTGTGTATTACT
GTGCTAGG
>AJ274740|IGHV3S15*01_Gadmor|(F)|V-REGION
TGTGAACAGCTTACTCAA......CCCGAGTCT...CTGACTGTCCGACCTGGCCAACCTCTGACCATCCGCTGTCAGG
TCTCTTATTCTGTTAGT...............AGCTACTGGACAGCTTGGATCAGACAACCTGAAGGACAGGCACTGGA
ATGGATTGGCATGTTAGTTACT............GGGACCAAATACCAGAAAGACTCCCTTAGC...AGTAAATTCAGC
CTTTCCCTTGACGAGGCCAGTAAAACAGTAACTTTGCAAGGGCAGAACATGCAGGCTGGAGACTCAGCTGTGTATTACT
GTGCCAGA
>AJ279376|IGHV3S15*02_Gadmor|(F)|V-REGION
AGTGAACAGCTTACTCAA......CCCGAGTCT...CTGACTGTCCGACCTGGCCAACCTCTGACCATCCGCTGTCAGG
TCTCTTATTCTGTTAGT...............AGCTACTACACAGCTTGGATCAGACAACCTGAAGGACAGGCACTGGA
ATGGATTGGCATGTTAGTTACT............GGGACCAAATACCAGAAAGACTCCCTTAGC...AGTAAATTCAGC
CTTTCCCTTGACGAGGCCAGTAAAACAGTAACTTTGCAAGGGCAGAACATGCAGGCTGGAGACTCAGCTGTGTATTACT
GTGCCAGA
>AJ279377|IGHV3S16*01_Gadmor|(F)|V-REGION
TGTGAACAGCTTACTCAG......CCCGAGTCT...CTGACTGTCCGACCTGGTCAACCTCTGACCATCCGCTGTCAGG
TCTCTTATTCTGTTAGT...............AGCCACTGGACAGCTTGGATCAGACAACCTGAAGGACACGCACTGGA
ATGGATTGGAATGATTTATACT............GGGAACAAATTAATGAAAGACTCCCTGAGT...AGTAAATTCAGT
CTTTCCCTTGATGAGGCCAGTAAAACAGTAACTTTGCAAGGGCAGAACATGCAGGCTGGAGACTCAGCTGTGTATTACT
GTGCAGAA
>AJ279380|IGHV3S17*01_Gadmor|(F)|V-REGION
TGTGAACAGCTTACTCAG......CCAGAGTCT...CTGACTATCCGACCCGGTCAACCTCTGACCATCCGCTGTCAGG
TCTCTTATTCTGTT..................GGTAGCTGGACAGCTTGGATAAGACAACCTGAAGGACACGCACTGGA
ATGGATTAGCATGATAAATACT............GGGGGCAAACACCAGAAAGACTCTCTTAGT...AGTAAATTCAGT
CTCACCCTTGACGTGGCCAGTAAAACAATTACTTTGCAAGGGCAGAACATGCAGCCTGGAGACTCAGCTGTGTATTACT
GTGCCGGT
>AJ279381|IGHV3S17*02_Gadmor|(F)|V-REGION
TGTGAACACGTTACTCAG......CCAGAGTCT...CTGACTATTCGCACCGGTCAACCTCTGACCATCCGTTGTCAGG
TCTCTTATTCTGTT..................GGTAGCTGGACAGCTTGGATAAGACAACCTGAAGGACACGCACTGGA
ATGGATTAGCATGATAAATACT............GGGGGCAAACACCAGAAAGACTCTCTTAGT...AGTAAATTCAGT
CTCACCCTTGACGTGGCCAGTAAAACAATTACTTTGCAAGGGCAGAACATGCAGCCTGGAGACTCAGCTGTGTATTACT
GTGCCGTT
>X76508|IGHV3S18*01_Gadmor|(F)|V-REGION
ACACAACAGCTTACTCAG......CCAGAGTCT...CTGATTGTCCGACCTGGTCAATCTCTGAACATCCGCTGTCAGG
TCTCTTATTCTGTTAGT...............AGCTACTACACGCAATGGATAAGACAACCTGATGGAAACCCACTGGA
ATGGATTGGTTATATTCGTGCC............GATGGCAAAAAAGTGAAAGACTCCCTTAGT...AGTAAATTCAGT
CTTGCCGTTGACGAGGCCAGTAAAACAGTAACTTTGCAAGGCCAAAACATGCAGCCTGGAGACTCAGCTGTGTATTATT
GTGCCAGA
>AJ279382|IGHV3S18*02_Gadmor|(F)|V-REGION
TGTGAACAGCTTACTCAG......CCAGAGTCT...CTGATTGTCCGACCTGGTCAATCTCTGAACATCCGCTGTCAGG
TCTCTTATTCTGTTAGT...............AGCTACTACACGCAATGGATAAGACAACCTGATGGAAACCCACTGGA
ATGGATTGGTTATATTCGTACC............GATGGCAAAAAAGTGAAAGACTCCCTTAGT...AGTAAATTCAGT
CTTGCCGTTGACGAGGCCAGTAAAACAGTAACTTTGCAAGGCCAAAACATGCAGCCTGGAGACTCAGCTGTGTATTATT
GTGCCAGA
>X76509|IGHV3S19*01_Gadmor|(F)|V-REGION
TGTGAACAGCTTACTCAG......CCCGAGTCT...CTGACTGTCCGACCTGGTCAACCTCTGACCATCCGCTGTCAGG
TCTCTTATTCTCTT..................AATTATTGGACAGCTTGGATCAGGCAACCTGAAGGACATGCACTGGA
ATGGATTGGACATATTGATTCT............TCGAGCAAAAGAGTGAAAGACTCTCTTGGT...AGTAAATTCAGT
CTTGCCGTTGACGGCTCCAGTAACACAGTTATTCTGCAAGGGCAGAACATGCAGCCTGGAGACTCAGCTGTGTATTACT
GTGCCAGA
>X76515|IGHV3S19*02_Gadmor|(F)|V-REGION
................................................CCTGGTCAACCTCTGACCATCCGCTGTCAGG
TCTCTTATTCTCTT..................GTTTACTGGACAGCTTGGATCAGAAAACCTGAAGGACACGCACTGGA
ATGGATTGGACGTATTGATTCT............TCAAACAAAAATGTGAAAGACTCTCTTGGT...AGTAAATTCAGT
CTTGCCGTTGACGGCTCCAGTAACACAGTTATTCTGCAAGGACAAAACATGCAGCCTGTAGACTCAGCTGTGTATTACT
GTGCCAGA
>AJ274749|IGHV3S19*03_Gadmor|(F)|V-REGION
TGTGAACAGCTTACTCAG......CCCGAGTCT...CTGACTGTCCGACCTGGTCAACCTCTGACCATCCGCTGTCAGG
TCTCTTATTCTCTT..................AGTTATTGGACAGCTTGGATCAGGCAACCTGAAGGACACGCACTGGA
ATGGATTGGACATATTGATTCT............TCAAGCAAAAGAGTGAAAGACTCTCTTGGT...AGTAAATTCAGT
CTTGCCGTTGACGGCTCCAGTAACACAGTTCTTCTGCAAGGACAAAACATGCAGCCTGGAGACTCAGCTGTGTATTACT
GTGCCAGA
>X76513|IGHV3S20*01_Gadmor|(F)|V-REGION
TGTGAACAGCTTACTCAG......CCCGAGTCT...CTGACTATCCAACCTGGTCAACTACTGACCATCCACTGTCAGG
TCTCTTATTCAGTTAGT...............ACCTACGGGACACATTGGATAAGACAACCTGAAGGACACGCTTTGGA
ATGGATTGGATGGATTTATACT............GGGGACAAAAAAGTGAAAGACTCCCTTAGT...AGTAAATTCAGT
CTTGCCGTTGACGGCTCCAGTAACACAGTAACTTTGCAAGGGCAGAACATGCAGGCTGGAGACTCAGCTGTGTATTACT
GTGCCAGA
>AJ279386|IGHV3S21*01_Gadmor|(F)|V-REGION
TGTGAACAGCTTACTCAG......CCAGAGTCT...CTGACAATTCAACCTGGTCAACTTCTGACCATCCGCTGTCAGG
TCTTTTATTCTGTTAGT...............ACCTACGCGACACATTGGATCAGACAACCTGAAGGACATGCACTGGA
ATGGATTGGATATATTTATACC............GGGGGCAAAAGAGTGAAAGACTCCCTCAGT...AGTAAATTCAGT
CTTGCCGTTGACAGCTCCACTAAAACAGTAACTTTGCAAGGGCAAAACATGCAGCTTGGAGACTCAGCTGTGTATTACT
GTGCCAGA
>AJ279387|IGHV3S21*02_Gadmor|(F)|V-REGION
TGTGAACAGCTTACTCAG......CCAGAGTCT...CTGACAATTCAACCTGGTCAACCTCTGACCATCCGCTGTCAGG
TCTCTTATTCTGTTAGT...............ACCTACGCGACACATTGGATCAGACAACCTGAAGGACATGCACTGGA
ATGGATTGGATATATTTATACC............GGGGGCAAAAGAGTGAAAGACTCCCTCAGT...AGTAAATTCAGT
CTTGCCGTTGACAGCTCCACTAAAATAGTAACTTTGCAAGGGCAAAACATGCAGCTTGGAGACTCAGCTGTGTATTACT
GTGCCAGG
>AJ279389|IGHV3S22*01_Gadmor|(F)|V-REGION
TGTGAACAGCTTACTCAG......CCAGAGTCT...CTGACTGTCCGACCTGGTCAACCTCTGACCATCCGCTGTCAGG
TCTCTTATTCTGTTAGT...............AGCTACTGGACAGCTTGGGTCAGACAACCTGAAGGACATGGACTGGA
ATGGATTGGATGGATTTATACT............GGGGGCAAACACCAGAAAGATTCCCTTAGT...AGTAAATTCAGT
CTTGTCGTTGATGGCTCCAGTAACACAGTAACTTTGCAAGGGCAAAACATGCAGCCTGGAGACTCAGCTGTGTATTACT
GTGCCGGA
>AJ279391|IGHV3S23*01_Gadmor|(F)|V-REGION
..........................................GTCCGACCTGGTCAACCTCTTACCATCCGCTGTCAGG
TCTCTTATTCTGTTAGT...............AGCTCCTGGACACATTGGATCAGACAACCTGAAGGACATGCACTGGA
ATGGATTGGAAGGATTTATACC............GGGGACAAAAAAGTGAAAGACTCCCTTAGT...AGTAAATTCAGT
CTTGTCGTTGACGACTCCAGTAGTACAGTAACTTTGCAAGGGCAGAACATGCACCCTGGAGACTCAGCGGTGTATTACT
GTGCCGGC
>AJ274735|IGHV3S24*01_Gadmor|(F)|V-REGION
TGTGAACAGCTTACTCAG......CCCGAGTCT...CTGACTGTCCGACCTGGTCAACCTCTGACCATCCGCTGTCAGG
TCTCTTATTCTGTTAGT...............AGCTACTACACACATTGGATCAGACAACCTGAAGGACACGCACTGGA
ATGGATTGGACGGATTGTTCCT............GGGGGCAAAACAGTGAAAGATTCCCTTAGT...AGTAAATTCAGT
CTTGACGTTGACGGCTCCAGTAACACAGTAACCCTGCAAGGGCAGAACCTGCAGCCTGGAGACTCAGCTGTGTATTATT
GTGCCGGG
>AJ279392|IGHV3S24*02_Gadmor|(F)|V-REGION
TGTGAACAGCTTACTCAG......CCCGAGTCT...CTGACTGTCCGACCTGGTCAACCTCTGACCATCCGCTGTCAGG
TCTCTTATTCTGTTAGT...............AGCTACTACACACATTGGATCAGACAACCTGAAGGACACGCACTGGA
ATGGATTGGACGGATTGTTCCT............GGGGGCAAAACAGTGAAAGATTCCCTTAGT...AGTAAATTCAGT
CTTGTCGTTGACGGCTCCAGTAACACAGTAACCCTGCAAGGGCAGAACCTGCAGCCTGGAGACTCAGCTGTGTATTATT
GTGCCAGA
>AJ274751|IGHV3S25*01_Gadmor|(F)|V-REGION
TGTGAACAGCTTACTCAG......CCCGAGTCT...CTGACTGTCCAACCTGGTCAACCTCTGACCATCCGCTGTCAGG
TCTCTTATTCTGTTAGT...............AGCTACTACACAGCTTGGATCAGACAACCTGAAGGACACGCACTGGA
ATGGATTGGATGGATTTATACC............GGGGGCAAAACAGTGAAAGATTCCCTTAGT...AGTAAATTCAGT
CTTGCCGTTGACGGCTCCAGTAACACAGTAACCCTGCAAGGGCAGAACCTGCAGCCTGGAGACTCAGCTGTGTATTATT
GTGCCAGA
>AJ274728|IGHV3S26*01_Gadmor|(F)|V-REGION
TGTGAACAGCTTACTCAG......CCCGAGTCT...CTGACTGTCCGACCTGGTCAACCTCTGACCATCCGCTGTCAGG
TCTCTTATTCTGTTAAT...............AGCTACTACACAGCTTGGATCAGACAACCTGAAGGACGCGCACTGGA
ATGGATTGGATGGATTTATACC............GGGGGCAAAAGAGTGAAAGATTCCCTTAGT...AGTAAATTCAGT
CTTGTCGTTGACGGCTCCAGTAACACAGTAACTTTGCAAGGGCAGAACCTGCAGCCTGGAGACTCAGCTGTGTATTATT
GTGCCAGA
>X76507|IGHV3S27*01_Gadmor|(F)|V-REGION
TGTGAACAGCTTACTCAG......CCGGAGTTT...CTTACTATCCGACCTGGTCAACCTCTGACCATCCGCTGTCAGG
TTTCTTATTCTGTTAGT...............AGCTACTACACAGCTTGGATCAGACAACCTGAGGGACATGCACTGGA
ATGGATTGGCATGATAAAGACT............GGGGACAAACACCAGAAAGACTCTCTTAGT...AGTAAATTCAGT
CTTGCCGTTGACGGCTCCAGTAAAACAGTAACTTTGCAAGGGCAAAACATGCAGCCTGGAGACTCAGCTGTGTATTACT
GTGATAGAA
>AJ279393|IGHV3S27*02_Gadmor|(F)|V-REGION
TGTGAACAGCTTACTCAG......CCCGAGTCT...CTGACTGTCCGACCTGGTCAACCTCTGACCATCCGCTGTCAGG
TCTCTTATTCTGTTAGT...............AGCCACTACACAGCTTGGATCAGACAACCTGAAGGACACGCACTGGA
ATGGATTGGATGGATTGTTACC............GGGGACAAAAGAGTGAAAGATTCCCTTAGT...AGTAAATTCAGT
CTTGCCGTTGACGGCTCCAGTAACACAGTAACTTTGCAAGGGCAGAACCTGCAGCCTGGAGACTCAGCTGTGTATTACT
GTGCCAGA
>AJ279394|IGHV3S28*01_Gadmor|(F)|V-REGION
TGTTTACAGCTTACTCAG......CCCGAGTCT...CTGACTGTCCGACCTGGTCAACCTCTGACCATCCGCTGTCAGG
TCTCTTATGCTGTTAGT...............GGCCACTGGACAGCTTGGATCAGACAACCTGAAGGACATGCACTCGA
ATGGATTGGACGGATTTATACT............GGGGACAAACTAATGAAAGATTCCCTTAGT...AGTAAATTCAGT
CTTGCTGTTGACGGCTCCAGTAATACATTAACTTTGCAAGGGCAAAACATGCAGCCTGGAGACTCAGCTGTGTATTACT
GTGCCAGC
>AJ274744|IGHV3S28*02_Gadmor|(F)|V-REGION
TGTTTACAGCTTACTCAG......CCCGAGTCT...CTGACTGTCCGACCTGGTCAACCTCTGACCATCCGCTGTCAGG
TCTCTTATGCTGTTAGT...............GGCCACTGGACAGCTTGGATCAGACAACCTGAAGGACATGCACTCGA
ATGGATCGGACAGATTTATACT............GGGGACAAACTAATGAAAGATTCCCTTAGT...AGTAAATTCAGT
CTTGCTGTTGACGGCTCCAGTAATACATTAACTTTGCAAGGGCAAAACATGCAGCCTGGAGACTCAGCTGTGTATTACT
GTGCCAGA
>X76512|IGHV3S29*01_Gadmor|(F)|V-REGION
TGTGAACAACTTACTCAG......CCAGGGTCT...CTGACCGTCCGACTTGGTCAACCTCTGACCATCCGCTGTCAGG
TCTCTTATTCTGTTAGT...............AGCTACTACACAGCTTGGATCAGACAACCTGAAGGACATGCACTGGA
ATGGATTGGATGGATTTATACC............GGGGAGAAAAAAGTGAAAGACACCCTAAGT...AGTAAATTCAGT
CTTGCCGTTGACGGCTCCAGTAACACAGTAACTTTGCAAGGGCAGAACATGCAGCCTGGAGACTCAGCTGTGTATTACT
GTGCCAGA
>X76514|IGHV3S29*02_Gadmor|(F)|V-REGION
.................A......GCAGGGTCT...CTGGCTGTCCGACTTGGTCAACCTCTGACCATCCGCTGTCAGG
TCTCTTATGCTGTTAGT...............GGCTACTGGACAGCTTGGATCAGACAACCTGAAGGACATGCACTGGA
ATGGATTGGATGGATTTATACC............GGGGAGAAAAAAGTGAAAGACACCCTAAGT...AGTAAATTCAGT
CTTGCCGTTGACGGCTCCAGTAACACAGTAACTTTGCAAGGGCAGAACATGCAGCCTGGAGACTCAGCTGTGTATTACT
GTGCCAGA
>X76511|IGHV3S29*03_Gadmor|(F)|V-REGION
TGTGAACAACTTACTCAG......CCAGGGTCT...CTGGCTGTCCGACTTGGTCAACCTCTGACCATCCGCTGTCAGG
TCTCTTATGCTGTTAGT...............GGCTACTGGACAGCTTGGATCAGACAACCTGAAGGACATGCACTGGA
ATGGATTGGATGGATTTATACC............GGGGAGAAAAAAGTGAAAGACACCCTAAGT...AGTAAATTCAGT
CTTGCCGTTGACGGCTCCAGTAACACAGTAACTTTGCAAGGGCAGAACATGCAGCCTGGAGACTCAGCTGTGTATTACT
GTGCCAGT
>AJ274724|IGHV3S30*01_Gadmor|(F)|V-REGION
TGTGAACAGCTTACTCAG......CCCGAGTCT...CTGACTGTCCGACCTGGTCAACCACTGACCATCCGCTGTCAGG
TCTCTTATTCTGTTAGT...............AGCTACTGGACAGCTTGGATCAGACAACCTGAAGGACATGCACTGGA
ATGGATTGGATGGATTTATACC............GGGGACAAAAAAGTGAAAGACACCCTAAGT...AGTAAATTCAGT
CTTGCCGTTGACGGCTCCAGTAACACAGTAACCTTGCAAGGGCAGAACATGCAGCCTGGAGACTCAGCTGTGTATTACT
GTGCCAGA
>AJ274723|IGHV3S31*01_Gadmor|(F)|V-REGION
TGTGAACGGCTTACTCAG......CCCGAGTCT...CTGACTGTCCGACCTGGTCAACCACTGACCATCCGCTGTCAGG
TCTCTTATTCTGTTAGT...............AGCTACTGGACAGCTTGGATCAGACAACCTGAAGGACATGCACTGGA
ATGGATCGGTTGGATTCGTACC............GATGGCAAAAAAGTGAAAGACTCCCTTAGT...AGTCAATTCAGT
CTTGCAGTTGACGGATCCAGTAACACAGTAACTTTGCAAGGGCAGAACATGCAGCCTGGAGACTCAGCTGTGTATTACT
GTGCCAGA
>AJ274725|IGHV3S31*02_Gadmor|(F)|V-REGION
TGTGAACAGCTTACTCAG......CCCGAGTCT...CTGACTGTCCGACCTGGTCAACCACTGACCATCCGCTGTCAGG
TCTCTTATTCTGTTAGT...............AGCTACTGGACAGCTTGGATCAGACAACCTGAAGGACATGCACTGGA
ATGGATTGGTTGGATTCGTACC............GATGGCAAAAAAGTGAAAGACTCCCTTAGT...AGTCAATTCAGT
CTTGCAGTTGACGGATCCAGTAACACAGTAACTTTGCAAGGGCAGAACATGCAGCCTGGAGACTCAGCTGTGTATTACT
GTGCCAGA
>AJ279395|IGHV3S32*01_Gadmor|(F)|V-REGION
TGTGAACAGCTTACTCAG......CCCGAGTCT...CTGACTGTCCGACCTGGTCAACCTCTGACCATCCGCTGTCAGG
TCTCTTATTCTGTTAGT...............AGCCACTACACAGCTTGGATCAGACAACCTGAAGGACATGCACTGGA
ATGGATTGGTTGGATTCGTACC............GATGGCAAAAAAGTGAAAGACTCCCTTAGT...AGTCAATTCAGT
CTTGCAGTTGACGGATCCAGTAACACAGTAACTTTGCAAGGGCAGAACATGCAGCCTGGAGACTCAGCTGTGTATTACT
GTGCCAGA
>AJ274746|IGHV3S32*02_Gadmor|(F)|V-REGION
TGTGAACAGCTTACTCAG......CCCGAGTCT...CTGACTGTCCGACCTGGTCAACCTCTGACCATTCGCTGTCAGG
TCTCTTATTCTGTTAGT...............AGCCACTACACAGCTTGGATCAGACAACCTGAAGGACATGCACTGGA
ATGGATTGGTTGGATTCGTACC............GATGGCAAAAAAGTGAAAGACTCCCTTAGT...AGTCAATTCAGT
CTTGCAGTTGACGGATCCAGTAACACAGTAACTTTGCAAGGGCAGAACATGCAGCCTGGAGACTCAGCTGTGTATTACC
GTGTTGCG
>AJ274753|IGHV3S32*03_Gadmor|(F)|V-REGION
TGTGAACAGCTTACTCAG......CCCGAGTCT...CTGACTGTCCGACCTGGTCAACCTCTGACCATCCGCTGTCAGG
TCTCTTATTCTGTTAGT...............AGCCACTACACAGCTTGGATCAGACAACCTGAAGGTCACGCACTGGA
ATGGATTGGTTGGATTCGTACC............GATGGCAAAAAAGTGAAAGACTCCCTTAGT...AGTCAATTCAGT
CTTGCAGTTGACGGATCCAGTAACACAGTAACTTTGCAAGGGCAGAACATGCAGCCTGGAGACTCAGCTGTGTATTACT
GTGCCAGA
>AJ274720|IGHV3S32*04_Gadmor|(F)|V-REGION
TGTGAACAGCTTACTCAG......CCCGAGTCT...CTGACTGTCCGACCTGGTCAACCTCTGACCATCCGCTGTCAGG
TCTCTTATTCTGTTAGT...............AGCCACTACACAGCTTGGATCAGACAACCTGAAGGACATGCACTGGA
ATGGATTGGTTGGATTCGTACC............GATGGCAGAAAAGTGAAAGACTCCCTTAGT...AGTCAATTCAGT
CTTGCAGTTGACGGATCCAGTAACACAGTAACTTTGCAAGGGCAGAACATGCAGCCTGGAGACTCAGCTGTGTATTACT
GTGCCAGA
>AJ274743|IGHV3S32*05_Gadmor|(F)|V-REGION
TGTGAACAGCTTACTCAG......CCCGAGTCT...CTGACTGTCCGACCTGGTCAACCTCTGACCATCCGCTGTCAGG
TCTCTTATTCTGTTAGT...............AGCCACTACACAGCTTGGATCAGACAACCTGAAGGACATGCACTGGA
ATGGATTGGTTGGATTCGTACC............GATGGCAAAAAAGTGAAAGACTCCCTTAGC...AGTCAATTCAGT
CTTGCAGTTGACGGATCCAGTAACACAATAACTTTGCAAGGGCAGAACATGCAGCCTGGAGACTCAGCTGTGTATTACT
GTGCCAGA
>AJ274717|IGHV3S33*01_Gadmor|(F)|V-REGION
TGTGAACAGCTTACTCAG......CCCGAGTCT...CTGACTGTCCGACCTGGTCAACCTCTGACCATCCGCTGTCAGG
TCTCTTATTCTGTTAGT...............AGCCACTACACAGCTTGGATCAGACAACCTGAAGGACATGCACTGGA
ATGGATTGGTTGGACTCGTACC............GATGGCAAAAAAGTGAAAGACTCCCTTAGT...AGTCAATTCAGT
CTTGCAGTTGACGGATCCAGTAACACAGTAACTTTGCAAGGGCAGAACATGCAGCCTGGAGACTCAGCTGTGTATTACT
GTGCCAGC
>AJ274716|IGHV3S34*01_Gadmor|(F)|V-REGION
TGTGAACAGCTTACTCAG......CCCGAGTCT...CTGACTGTCCGACCTGGTCAACCTCTGACCATCCGCTGTCAGG
TCTCTTATTCTGTAAGT...............AGCTACTGGACAGCTTGGATCAGACAACCTGAAGGACACGCACTGGA
ATGGATTGGATGGATTCATACC............GGGGGCAAAAGAGTGAAAGATTCCCTTAGT...AGTAAATTCAGT
CTCACCCTTGACGAGGCCAGTAAAACAATTACTTTGCAAGGACAAAACATGCAGCCTGGAGACTCAGCTGTGTATTACT
GTGCCAGA
>AJ274711|IGHV4S1*01_Gadmor|(F)|V-REGION
GCTCAGACAATAACACAA......TCTGAACCA...GTTGTTGCAGAGCTGATGGAATCACATACATTGACATGCACAT
ATTCTGGACTACCAACT...............AGTAGTGCATTTGCCTGGATCAGGCAGAACGAAGAGAAGGGACTGGA
ATGGATTGCATATATAACAGGACCTAGT...GGGGGCACCAAGTCCTACTCTGTGTCGGTCAAG...GGCCGCTTCACC
ATCTCAAGGGACAATGACAACCAGCAAGTACATCTCCAGATGGACCAGCTGGAGACTGCGGACTCCGCTGTCTATTATT
GTGCTAGA
>AJ274712|IGHV4S1*02_Gadmor|(F)|V-REGION
GCTCAGACAATAACACAA......TCTGAACCA...GTTGTTGCAAAGCTGATGGAATCACATACATTGACATGCACAT
ATTCTGGACTACCAACT...............AGTAGTGCATTTGCCTGGATCAGGCAGAACGAAGAGAAGGGACTGGA
ATGGATTGCATATATAACAGGACCTAGT...GGGGGCACCAAGTCCTACTCTGTGTCGGTCAAG...GGCCGCTTCACC
ATCTCAAGGGACAATGACAACCAGCAAGTACATCTCCAGATGGACCAGCTGGAGACTGCGGACTCCGCTGTCTATTATT
GTGCTAGA
>AJ274713|IGHV4S1*03_Gadmor|(F)|V-REGION
GCTCAGACAATAACACAA......TCTGAACCA...GTTGTTGCAAAGCTGATGGAATCACATACATTGACATGCACAT
ATTCTGGACTACCAACT...............AGCAGTGCATTTGCCTGGATCAGGCAGAACGAAGAGAAGGGACTGGA
ATGGATTGCATATATAACAGGACCTAGT...GGGGGCACCAAGTCCTACTCTGTGTCGGTCAAG...GGCCGCTTCACC
ATCTCAAGGGACAATGACAACCAGCAAGTACATCTCCAGATGGACCAGCTGGAGACTGCGGACTCCGCTGTCTATTATT
GTGCTAGA
>U09719|IGHV1S1*01_Ictpun|F|V-REGION
GGACAGTCCCTGACCTCC......TCTGCTTCT...GTGGTGAAGAGACCTGGAGAGTCAGTCACTCTGTCCTGTACTG
TCTCCGGATTCTCAGTG............GGCAGCTACTACATGCACTGGATCCGTCAGAAACCTGGAAAAGGATTGGA
GTGGATCGGGCGCATTGACAGTGGC.........ACTGGCACAACATTCGATCAATCTCTGCAG...GGCCAGTTCTCC
ATCACTAAAGACACCAATAAAAACATGCTGTACCTAGAAGTGAAGAGTCTGAAAGCTGAAGACACGGCTGTTTATTACT
GTGCACGACACT
>AF068137|IGHV1S2*01_Ictpun|F|V-REGION
GGACAGTCCCTGACCTCC......TCGGCTTCT...GTGGTGAAGAGACCTGGTGAGTCAGTCACTCTGTCCTGTACTG
TCTCCGGATTCTCAGTG............GGCAGCAACTGGATGAGCTGGATCCGTCAGAAACCAGGAAGAGGACTGGA
GTGGATTGGATACATTGACACTGGC.........ACTGGCACTGGCTTTGCCCAGTCTCTGCAG...GGCCAGTTTTCC
ATCACTAAAGACACCAATAAAAACATGCTGTACCTAGAAGTGAAAAGTCTGAAAGCTGAAGACACGGCTGTTTATTACT
GTGCACGAGACT
>AF068137|IGHV1S3*01_Ictpun|(F)|V-REGION
GGACAGTCCCTGACCTCC......TCTGCTTCT...GTGGTGAAGAGGCCTGGAGAGTCAGTCACTCTGTCCTGTACTG
TCTCCGGATTCTCAATG...............AGCAGCTACATCCACTGGATCCGTCAGAAACCAGGAAAAGGATTGGA
GTGGATCGGATACATTGACACTGCC.........ACTGGCACAACATTCGCTCAGTCTCTGCAG...GGCCAGTTCTCC
ATCACTAAAGACACCAATAAAAACATGCTGTACTTAGAAGTGAAGAGTCTGAAAGCTGAAGACACGACTGTTTATTACT
GTGCAGGAGAC
>M27230|IGHV1S4*01_Ictpun|(F)|V-REGION
GGACAGTCCCTGACCTCC......TCGGCTTCT...GTGGTGAAGAGACCTGGTGAGTCAGTCACTCTGTCCTGTACTG
TTTCCGGATTCTCAGTG............GGCAGCAACTGGATGAGCTGGATCCGTCAGAAATCAGGAAGAGGACTGGA
CTGGATTGGATACATTGACACTGGC.........ACTGGCACTGGCTTTGCCCAGTCTCTGCAG...GGCCAGTTTTTC
ATCACTAAAGACACCAATAAAAACATGCTGTACCTAGAAGTGAAAAGTCTGAAAGCTGAAGACACGGCTGTTTATTACT
GTGCACGGGTC
>M58673|IGHV1S5*01_Ictpun|(F)|V-REGION
GGACAGTCCCTGACCTCT......CTTGGTTCT...GTGGTGAAGAGACCTGGAGAGTCAGTCACTCTCTCCTGTACTC
TCTCCGGATTCTCATTG............GACAGCTACTGGATGAGTTGGATCCGTCAGAAACCAGGCAAGGGATTGGA
GTGGATCGGGCGCATTGACAGTGGC.........ACTGGCACAACATTCACTCAGTCTCTGCAG...GGCCAATTCTCC
ATCACTAAAGACACCAATAAAAACATGCTGTACCTTGAAGTGAAGAGTCTGAAAACTGAAGACATGGCTGTTTATTACT
GTGCACGGTTA
>U67437|IGHV1S6*01_Ictpun|(F)|V-REGION
GGACAGTCCCTGACCTCC......TCTGCTTCT...GTGGTGAAGAGACCTGGAGAGTCAGTCACTCTGTCCTGTACTG
TCTCTGGATTCTCAATG............GGCAGCAACTACATGCACTGGATCCGTCAGAAACCTGGAAAAGGATTGGA
GTGGATCGGGCGCATTGACCGTGGC.........ACTGGCACAACATTCGCTCAGTCTCTGCAG...GGCCAGTTCTCC
ATCACTAAAGACACAAATAAAAACATGCTGTACCTAGAAGTGAAGAGTCTGAAAGCTCAAGAAACGGCTGTTTATTACT
GTGCAGGAGAA
>U67439|IGHV1S7*01_Ictpun|(F)|V-REGION
.....GTCCCTGACCTCC......TCTGCTTCT...GTGGTGAAGAGACCTGGAGAGTCAGTCACTCTGTCCTGTACTG
TCTCCGGATTCTCAATG............AGCAGCTACTGGATGAGCTGGATCCGTCAGAAACCACGAAGAGGACTGGA
ATGGATTGGATACATTAATTATGGC.........ACTGGCACTGGCTTCACTCAGTCTCTTCAG...GGCCAGTTCTCC
ATCACTAAAGACACCAATAAAAACATGCTGTACCTAGAAGTGAAGAGTCTGAAAGCTGAAGACACGGCTGTTTATTACT
GTGCACGACAC
>AF161275|IGHV1S8*01_Ictpun|(F)|V-REGION
........................................................................TGTACTG
TCTCCGGATTCTCAATG............GGCAGCTACTACATGAGCTGGATCCGTCAGAAACCAGGAAGGGGACTGGA
GTGGATCGGATACGTTGACACTGGC.........ACTAGCACAACATTCGCTCAGTCTCTGCAG...GGCCAGTTCTCC
ATCGCTAAAGACACAAATAAAAACATGCTGTACCTAGAAGTGAAGAGTCTGAAAGCTGAAGACACGGCTGTTTATTACT
GTGCACGGTTC
>AF161276|IGHV1S9*01_Ictpun|(F)|V-REGION
........................................................................TGTACTG
TCTCCGGATTCTCAATG............GCCGGCAACTTCATGCACTGGATCCGTCAGAAACCTGGAAAAGGATTGGA
GTGGATCGGGCGTATTGACAGTGGC.........ACTGTCACAACATTCGCTCAATCTCTGCAG...AGCCAGTTCTCC
ATCATTAAAGACACCGATAAAAACGTCCTCTACCTAGAATTGAAGAGTCTGAAAGCTGAAGACACGGCTGTTTATTACT
GTGGACGGCCA
>AF161278|IGHV1S10*01_Ictpun|(F)|V-REGION
........................................................................TGTACTG
TCTCCGGATTCTCAATG............GGCAGCTACTGGATGAGCTGGATCCGTCAGAAACCAGGAAGAGGACTGGA
GTGGATTGGATACATTGACACTGGC.........ACTCATACTGGCTTTGCCCAGTCTCTGCAG...GGCCAGTTTTCC
ATCACTAAAGACACCAATAAAAACATACTGTACCTTGAAGTGAAGAGTCTGAAAGCTGAAGACACGGCTGTTTATTACT
GTGCACGAAAA
>AF161283|IGHV1S11*01_Ictpun|P|V-REGION
..............................................................................T
GCAACGTGTCCGGACTC............TCGCTTAGCTGGCTCCACTGGATCCGTCAGAAACCAGGAAAAGGACTGGA
GTGGATCGGGCGAATTGACAGTGGC.........ACCGGCACTATATTCGCTCAGTCTCTGCAG...GGCCAGTTCTCC
ATCACTAAAGATACCAATAAAAACATGGTGTACCTAGAAGTGAAGAGTCTGAAAGCTGAAGACACGGCTGTTTATTACT
GTGCATGAGGA
>M58671|IGHV2S2*01_Ictpun|(F)|V-REGION
GGTGAGGAACTGACTCAG......CCTGCTTCC...ATGACAGTCCAGCCAAGCCAGAGTCTCTCCATCAACTGCAAGG
TTTCGTATTCAGTTACC...............AGCTATTATACAGCTTGGATCCGACAACCTGCAGGAAAAGCTCTGGA
GTGGATTGGATACATCAGTAACAAT.........GGGGGTACAGTTTACAGTGACAAACTGAAA...AATAAGTTCAGC
ATTTCCAGAGACACTGCTACTAACACAATAACAATTCGAGGACAGAATCTGCAAACTGAAGACACAGCTGTGTATTACT
GTGCAAGGGCTG
>M58670|IGHV2S3*01_Ictpun|(F)|V-REGION
GGAGAGGAACTGACTCAG......CCTGCTTCC...ATGACAGTCCAGCCAGGCCAGAGTCTCTCCATCAACTGCAAGG
TTTCATATTCAGTTACA...............AGCTATTATACAACTTGGATCCGACAACCTGCAGGAAAAACTCTGGA
GTGGATTGGATACATCAGTGGTGGT.........GGTAATACATATTACAGTGACAAACTGAAA...AATAAGTTCAGC
ATCTCCAGAGACACTGCTACTAACACAATAACAATTCGAGGACAGAATCTGCAAACTGAAGACATAGCTGTGTATTACT
GCGCAAGAGCGT
>M58675|IGHV2S4*01_Ictpun|(F)|V-REGION
GGTATTGAACTGACTCAG......CCTACTTCC...ATGACAGTCCAGCCAGGCCAGAGTCTCTCCATCAAGTGCAAGG
TTTCATATTCAGTTACC...............AGCGACCATACAGCTTGGATCCGACAACCTGCAGGAAAACCTCTGGA
GTGGATTGGAAACATCTATACCAGT.........GGGGGTACAGCTTACATTGACAAACTGAAA...AATAAGTTCAGC
ATATCCAGAGACACTGCTACTAACACAATAACAATTGGAGGACAGAATCTGCAAACTGAAGACACAGCTGTGTATTACT
GTGCAAGACTG
>U67441|IGHV2S5*01_Ictpun|(F)|V-REGION
GGTGTTGAACTGACTCAG......CCTGCTTCC...ATGACAGTCCAGCCAGGCCAGAGTCTCTCCATGAACTGCAAGG
TTTCATATTCAATTGCC...............ATCTATGATACAGCTTGGATCCGACAACCTGCAGGAAAAGCTCTGGA
GTGGATTGCATACATTCATGGCAGT.........GGGAGTATATCGTACAGTGACACACTGAAA...AATAAATTCACC
ATCTCCAGAGACACTACTACTAACACAATAACAATTGGGGGACAGAATCTGCAAACTGAAGACACGGCTGTGTATTACT
GCGCAAGATAT
>AF161279|IGHV2S6*01_Ictpun|(F)|V-REGION
...............................................................................
..TGCAAGGTTTCATATTCA......GTTACCAGCTGTTGTACAGCTTGGATCCGACAACCTGCAGGAAAAGCTCTGGA
GTGGATTGGAAACATCTATAGCGGT.........GGAAGTACAGTTTACAGTGACAAACTGAAA...AATAAGTTCAGC
ATCTCCAGAGACGCTGCTACTAACACAATAACAATTGGAGGACAGAATCTGCAAACTGAAGACACAGCTGTGTATTACT
GCGCAAGAGGG
>U09721|IGHV3S1*01_Ictpun|F|V-REGION
AGTCAGACTCTTATCGAG......TCTGATTCA...GTGATCATCAAACCTGATCAGTCTCATAAACTGACCTGCACAG
CTTCTGGATTGGACATT............AGTAGCTATTACATGGCTTGGATCAGACAGGCGCCTGGAAAAGGGCTGGA
ATTTGTTGCAACTAACCACGGC............AGTAACAAGTATTACTCCAGTGCAGTTAAT...GGCCGCTTCACC
ATCTCCAGAGATGACAGTAAGAAGCAGGTATATCTGCACATGACCAGCGTGAGGACAGAAGACACTGCAGTGTATTACT
GCGCCCGTGACC
>AF068137|IGHV3S2*01_Ictpun|F|V-REGION
AGTCAGACACTGATTGAG......TCCGATTCA...GTGATCATCAAACCTGATCAGTCTCACAAACTGACCTGCACAG
CTTCAGAATTTAAATTT............GGTGGCTCTAGGATGGCTTGGATCAGACGGGCACCTGGAAAAGGGCTGGA
ATTTGTTTGCACTATTTCAGACACC......AGTAATAGCATACATTACTCCAGTGCAGTTAAT...GGCCACTTCACC
ATCTCCAAAGACAACAGTAAGATGCAGGTGCATCTGCACATGAACGGCATGAGGACAGAAGACACTGCAGTGTATTACT
GCACTAGAGAAG
>M58672|IGHV3S3*01_Ictpun|(F)|V-REGION
AGTCAGACACTGATCGAG......TCCGATTCA...GTGATCATCAAACCTGATCAGTCTCATAAACTGACCTGCACAG
CGTCTGGATTTAACTTT............GGTGGCTCTTGGATGGCTTGGATCAGACAGTCACCTGGAAAAGGGCTGGA
ATGGGTTGCAACTATCTCAGACACC......AGTGGTAGCAAGTATTACTCCAGTGCAGTTAAT...GGCCGCTTCACC
ATCTCCAGAGACAACAGTAAGATGGAGGTGTATCTGCACATGGCCAGTGTGAGGACAGAAGACACTGCAGTGTATTACT
GCACTAAAGAC
>M58699|IGHV3S4*01_Ictpun|(F)|V-REGION
AGTCAGACTCTTATCGAG......TCTGATTCA...GTGATCATCAAACCTGATCAGTCTCATAAACTGACCTGCACAG
CTTCTGGATTGGACATT............AGTAGCTCGTGGATGGCTTGGATCAGACAGGCGCCTGGAAAAGGGCTGGA
ATTTGTTGCAATTATTGAGAATGAT......AGTGATAGGAAGTTTTACTCCAATGCAGTTAAT...GGCCGCTTCACC
ATGTCCAGAGACAACAGTAAGAAGCAGGTGTATCTGCAGATGAACAACGTGAGGACAGAAGACACTGCAGTGTATTACT
GCGCCCGTGAC
>U67442|IGHV3S5*01_Ictpun|(F)|V-REGION
.........................................TCATAAACCTGAACAGTCTCATAAACTGACCTGCACAG
CTTCTGGATTGGACAGT............AGTAGCTACTGGATGGCTTGGAGCCGACAGGCGCCTGGAAAAGGACTGGA
ATTTGTTGCAACTATCGAGTATGAT......AGTGATAGCACGTATGACTCCAGTGCAGTTAAT...GGCCGCTTCACC
ATCTCCAGAGACGACAGTAAGAAGCAGGTGTTTCTGCACATGAACAGCGTGAGGACAGAGGACACTGCAGTGTATTACT
GCGCCCGGGGC
>AF161272|IGHV3S6*01_Ictpun|(ORF)|V-REGION
...............................................................................
.....GGTGGC........................TACTGGATGGCTTGGATCAGACAGGCTCCTGGAAAAGGGCTGGA
ATTTGTTGCAGCAACCTACGATACC.........AGTAACATACGCTACTCTAGTGCAGTTAAT...GGCCGCTTCACC
ATCTCCAGAGACAACAGTAAGAAGCAGGTGTATCTGCAGATGAACAGTGTGAGGACAGAAGACACTGCAGTGTATTATC
GCGCCCGTGAC
>AF161273|IGHV3S7*01_Ictpun|(F)|V-REGION
........................................................................TGCACAG
CTTCTGGATTCGACTTT............AGTAGCTACTGGATGGCTTGGATCAGACAGGCGCCTGGAAAAGGACTGGA
ATTTGTTGCAACTGTCTACAGC............AGTAGCAAGTATTACTCCAGTGCAGTTAAT...GGCCGCTTCACC
AACTCCAGAGACGACAGTAAGAAGCAGGTATATCCGCACATGACCAGCGTGAGGACAGAAGACACTGCAGTGTATTACT
GCGCCCGTGGG
>AF161274|IGHV3S8*01_Ictpun|(F)|V-REGION
........................................................................TGCACAG
CCTCTGGATTGGACATT............AGTAGTTACTGGATGGCTTGGATCCGACAGGCGCCTGGAAAAGGGCTGGA
GTTTGTTGCAACTATCGAGTATGATAGT...GATAGCAAGTATTACTCCAGTGCAGTTAATGGC...CGCTTCACCATC
TCCAGAGGC...GGTAGTAAGAAGCAGGTGTATCTGCAGATGAACAGTGTGAGGACGGAAGACACTGCAGTGTATTACT
GCGCCCGGCGT
>AF161277|IGHV3S9*01_Ictpun|(F)|V-REGION
........................................................................TGCACAG
CGTCTGGATTTAACTTT............GGTGGCTCTTGGATGGCTTGGATCAGACAGGCGCCTGGAAAAGGGCTGGA
ATGGGTTGCAACTATCTCAGACACC......AGTGGTAGCAAGTATTACTCCAGTGCAGTTAAT...GGCCGCTTCACC
ATCTCCAGAGACAACAGTAAGATGCAGGTGTATCTGCACATGGCCAGTGTGAGGACAGAAGACACTGCAGTGTATTACT
GCACTAGAGCC
>U09722|IGHV4S1*01_Ictpun|F|V-REGION
GCAGTAGAACTCACTCAG......GTCACCTCA...GTGATGTTAAAGCCAGGAGATTCTTTAACCCTCAGCTGTAAAG
TATCCGGCTACTCTGTTACT......GATAACAGCTACGCCACAGCTTGGATTCGACAACCTGCAGGAAAAACTCTGGA
ATGGATAAACTACATTTGGGGTGGT.........GGAAGTAGTTATCATAAAGATTCTCTAAAA...AGCAAGTTCAGT
ATTTCTAAAGATGGCTCCAGCAGCACGGTGACTCTGAGAGGACAGAATCTGCAGACAGAAGACACAGCTGTGTATTACT
GCACCCGCCACA
>M58668|IGHV4S2*01_Ictpun|(F)|V-REGION
GCAGTAGAACTCACTCAG......GTCACCTCA...GTGATGTTAAAGTCAGGAGATTCTTTAACCCTCAACTGTAAAG
TATCCGGCTACTCTGTTACT......GATAACAACTACGCCACAGGTTGGATTCGACAACCTGCAGGAAAAACTCTGGA
ATGGATAAACTACATTTGGGGTGGT.........GGAAGTACTTATCATAAAGATTCTCTAAAA...AGCAAGTTCAGT
ATTTCTAAAGATGGCTCCAGCAGTACGGTGACTCTGAGAGGACAGAATCTGCAGACAGAAGACACAGCTGTGTATTACT
GCACCCGCCATC
>U67443|IGHV4S3*01_Ictpun|(F)|V-REGION
.......................................ATGTTAAAGTCAGGAGATTCTTTAACCCTCAACTGTAAAG
TATCCGGCTTCTCTGTTACT......GATAACAGCTACGCCACAGCTTGGATTCGACAACCTGCAGGAAAGCCTCTGGA
ATGGATAAATCACATTTGGGGTGGT.........GGAATTACTTATCATAAAGATTCTCTAAAA...AGCAAGTTCAGT
ATTTCTAAAGACGGGTCCAGCAGCACGGTGACTCTGAGAGGACAGAATCTGCAGACAGAAGACACAGCTGTGTATTGCT
GCACCGGAGGG
>AF161282|IGHV4S4*01_Ictpun|(F)|V-REGION
........................................................................TGTAAAG
TATCCGGCTACTCTGTTACT......GATAACACGTACGCCACAGCTTGGATTCGACAACCTGCAGGAAAAACTCTGGA
ATGGATAAATCACATTTGGGGTGGT.........GGAAGTACTTATCATAAAGATTCTCTAAAA...AGCAAGTTCAGT
ATTTCTAAAGACGGCTCCAGCAGCACGGTGACTCTGAGAGGACAGAATCTGCAGACAGAAGACACAGCTGTGTATTACT
GCACCCGCTACG
>M58674|IGHV5S2*01_Ictpun|(F)|V-REGION
GCTACTGAGCTCATCCAG......CCAGACTCA...GTGGTTATAAAGCCAGGAGAGACTTTAACCATCACCTGTAGAG
TGTCTGGAGCTTCTATCACTGATAGCAGCAGCCACTATGGAACAGCTTGGATTCGACAACCTGCAGGAAAATCTCTGGA
ATGGTTCAACAGCATTTATTATGAT.........GGGGGTATTAATAAGAAAGATTCACTTAAA...GACAAGTTTGTC
ATCTCTCGAGACACGTCCAGCAGCACAGTAATATTAACAGGGCAGGACATGCAGACTGAAGACACAGCTGTGTATTACT
GCGCTCGTGAA
>U67444|IGHV5S3*01_Ictpun|(F)|V-REGION
.............................................AAGCCAGGAGAGACTTTAACCATCACCTGTAGAG
TGTCTGGAGCTTCTATCACTGATAGCAGCAGCCACTATAGAACAGCTTGGATTCGACAACCTGCAGGAAAAGCTTTAGA
ATGGATCAACAGCATTGATTATGAT.........GGGGGTATTTATAAGAAAGATTCACTCAAA...GACAAGTTTGTT
GTCTCTCGAGACACTTCCAGTAACACTCTGACCTTACGGGGACAGAACATGCAGACTGAAGACACAGCTGTGTATTACT
GTCGTCGTGCG
>AF161281|IGHV5S4*01_Ictpun|(F)|V-REGION
........................................................................TGTAGAG
TGTCTGGAGCTTCTATCACTGATAGCAGCAGCCACTATGGAACAGCTTGGATTCGACAACCTGCAGGAAAATCTCTGGG
ATGGATCAACAGCATTTATTATGAT.........GGGGGGATTAATAAGAAAGATTCACTTAAA...GACAAGTTTGTC
ATCTCTCGAGACACATCCAGCAGCACAGTAATATTAACAGGGCAGAACATGCAGACTGAAGACACAGCTGTGTATTACT
GCGCTCGTAGA
>U09724|IGHV6S1*01_Ictpun|F|V-REGION
TGTGTTGAGCTGATCCAG......CCCGGATCC...ACACTCATAACCCCTGTTCAGTCAATGACTCTGACCTGCAAAG
TGTCTGGATATTCAGTAACT......GATAGCAGCTACTGTACAGACTGGATAAGACAACCTGCAGGAAAAGCTCTGGA
GTGGGTCGCAGGAGCATGTGGTGAT.........GGTAAAACCTACCACAGTGAGAAACTGAAA...AGCAGGTTTCAG
GTTTCCAGAGACACGTCCAACGGCACAGTAACACTAACAGGGCAGAACATGCAGACTGAAGACTCAGCTGTGTATTACT
GCGCTCGTGAAC
>M64400|IGHV6S2*01_Ictpun|(F)|V-REGION
TGTGTTGAGTTGATTCAA......CCTGGAGCA...ATGATTTTATCCCCGGGGCAGTCAATGACTCTGACCTGTAAAA
TGTCTGGATATTCAGGAAGT......GATGGCAACTACTGGACACACTGGATACGACAACCTGCAGGAAAAGCTCTGGA
GTATATCGGACAAATATCTGGTAGT.........GGTAGTACTTACTACAGTGAGAAACGGAAA...ACCAGGTTTCAG
GTTTCCAGAGACACGTCCAGCACCACAGTAACATTAACAGGGCAGAACATTCAGACTGAAGACACAGCTGTGTATTACT
GCGCTCGTGAAC
>U67445|IGHV6S3*01_Ictpun|(F)|V-REGION
.......................................ATTTTATCCCCGGGGCAGTCAATGACTCTGACCTGTAAAG
TGTCTGGATATTCATTAACT......GATAGCAACTACTGTACAAACTGGATACGACAACCTGCAGGAAAAGCTCTGGA
GTGGGTCGGACGGATATGTAGTAGC.........GGTAACACTTACTACAGCGAGAAACTGAAA...ACCAGGTTTCAG
GTTTCCAGAGACACGTCCAGCAGCACAGTAACATTAACAGGGCAGAACATGCAGACTGAAGACACAGCTGTGTATTACT
GCGCTCGGGGT
>AF161271|IGHV6S4*01_Ictpun|(F)|V-REGION
........................................................................TGTAAAG
TGTCTGGATATTCAGTAAGT......GATGGCAGCTACTGGACACACTGGATACGACAACCTGCAGGAAAAGCTCTGGA
GTGGGTCGCACAAATATCTGGTAGT.........GGTAGGACTTACTACAGTGAGAAACTGAAA...AGCAGGTTTCAG
GTTTCCAGAGACACGTCCAGCACCACAGTAACATTAACAGGGCAGAACATGCAGACTGAAGACACAGCTGTGTATTACT
GCGCTCGTGAA
>AF161280|IGHV6S5*01_Ictpun|(F)|V-REGION
........................................................................TGTAAAG
TGTCTGGATATTCATTAACT......GATAGCGACTGCTGTACACACCGGATACGACAACCTCCTGGAAAAGCTCTGGA
GTGGGTCGGACAGATATGTGGTAGC.........GGTTACACTTACTACAGTGAGAGACTAAAA...AGCAGATTTCAG
GTTTCCAGACACACGTCCAGCAGCACAGTAACATTAACAGGGCAGAACATGCAGACTGAAGATACAGCTGTGTATTACT
GCTCGCGCTCT
>U34411|IGHV7S2*01_Ictpun|(F)|V-REGION
GAGATCAGACTGGACCAG......TCTCCTGCT...GTGGTAAAGAGACCTGGAGAAACTGTGAAGATCTCGTGTAAAA
TAAGTGGATATTCAATG............ACAAGCTACAACATACACTGGATCCAACAGAAACCAGGGAAAGTTCTGGA
ATGGAGTGGCTGGATGAATACAGGC......AATAATAAAGGAACATATGCAGAGTCTGTGAAA...AACCGGCTTTTT
TTTTCAGAGGACGTCTCAGCAAGTACACAGTACTTAGAGGCCAAGAGTCTGAGGACAGAGGACACTTCGGTTTATTACT
GTGCCCGAACG
>U34410|IGHV7S3*01_Ictpun|(F)|V-REGION
GAGATCAGACTGGACCAG......TCTTCTGCT...GTGGTAAAGAGACCTGGAGAATCTGTGAAGATCTCGTGTAAAA
TAAATGGCCTTGATATG............ACAGCCCACTACATGCACTGGATCCGACAGAAACCAGGGAAAGCTCTGGA
ATGGGTTGGTAGGATGGATGCTGGC......AAAAATCAAGCAATATATGCAGAGTCTGTAAAG...AACCAATTCACA
CTAACAGAAGACGTCCCGGCAAGCACACAGTGCTTAGAGGTCAAGAGTCTGAGGACAGAGGACACTGCGGTTTATTACT
GTGCTCGAACG
>U67446|IGHV7S4*01_Ictpun|(F)|V-REGION
GAGATCAGACTGGACCAG......TCTTCTGCT...GTGGTAAAGAGACCTGGAGAATCTGTGAAGATCTCGTGTAAAA
TAAATCGCTTTGATATG............ACAACCTACTACATGCACTGGATCCGACAGAAACCAGGGAAAGCTCTGGA
ATGGCTTGGTAGGATGGATGCTGGC......AAAAATCAAGCAATATATGCAGAGTCTGTAAAG...AACCGATTCACA
CTAACAGAAGACGTCCCGGCAAGTATACAGTACTTTGAGGTCAAGAGTCTGAGGACAGACGACATTGCGGTTTATTACT
GTGCCCGAGAA
>M57442|IGHV1S1*01_Oncmyk|F|V-REGION
GGTCAGACACTGACGGAG......TCTGAATCA...GTGGTTAAAAAGCCTGGAGAATCCCACAAACTGACCTGTACAT
ATTCTGGGTTTGGTGGC...............AACAATTGGAATGCTTGGATCAGACAGGCTCCTGGGAAAGGACTGGA
GTGGGTTTCAGCTATTACCAGCAGTGAT...GGTGGCAGCACTTACTACTCCCAGTCTGTTCAG...GGTCAGTTCACC
ATCTCCAGAGACAACAGCAAGCAGCAGGTGTATCTCCAGATGAACAGCTTGAAGACTGAAGACTCTGCTGTTTATTATT
GTGCCAGA
>X92501|IGHV1S2*01_Oncmyk|F|V-REGION
AGTCAGATGCTGACTGAA......TCTGAATCA...GTGGTTAAAACGTTTGAAGAATCCCACAAACTGACTTGCACAT
ATTCTGGGTTTGGTGGC...............AACTATTGGAATGCTTGGATCAGGCAGGCTCCAGGGAAAGGGCTAGA
ATGGGTTGCAACAATTAGTGATTCA......AGCAGTTATATCTACTACTCCCAGTCTATTCAG...GGTCGGTTCACC
ATCTCCAGAGACAACAGCAAGCAGCAGGTGTATGTCCAGATGAACAGCCTGAAGACTGAAGACTCTGCTGTTTATTATT
GTGCCAGAGA
>S63348|IGHV1S3*01_Oncmyk|(F)|V-REGION
AGTCAAACACTGACTGAG......TCTGGACCA...GTGGTTAAAAAGCCTTTAGAAGCCCACAAACTGACCTGTACAG
CCTCTAATTTAGACATA............AATGGCTATTGGATTGCATGGATCAAACAGGCTCCTGGTAAAGGACTAGA
ATTTGTGGCAGCGCATTATGACATT.........AGAAATATTGTCTACTCTCAGTCTGTTCAG...GGTCGGTTCACC
ATCTCCAGAGACAACAGCATGAAGCAGGTGTATCTCCAGATGAACAGCCTGAAGACTGAAGACTCTGCTGTGTATTATT
GTGCCAGA
>X81490|IGHV1S4*01_Oncmyk|(F)|V-REGION
GGTCAGACACTAACTGAG......TCTGGACCA...GTTGTAAAAATAACTGGAGAACCACACAAAGTGACCTGTACAG
CTTCTGGCTTCACATTC............AGTAACTACTGGATGGCTTGGATCAGACAGGCTCCTGGGAAAGGACTTGA
ATGGATTGCTCATTATAAATATGAT......AGTGCTGAAATCTACTACTCCCAGTCAGTCCAG...GGTCGGTTCACC
ATCTCCAGAGACAACAGCAAGCAGCAGGTGTATCTCCAGATGAACAGCCTGAAGACTGAAGACTCTGCTGTTTATTATT
GTGCCAGA
>L28741|IGHV1S5*01_Oncmyk|(F)|V-REGION
AGTCAGACATTGACCGAG......TCTGGACCA...GTAGTTAAAAATCCTGGGGAACCACACAAACTGACCTGTACTT
ATGATGGAATGTCAAAC............AATAATGCTGATATTAGCTGGATAAGACAGGCTCCTGGTAAAGGGCTGGA
GTGGGTTTGTCATATTTCTGCACCAAGT...GGAGCTGACAAATACTACTCCAAGTCAGTCCAA...GGTCGGTTCACC
ATCTCCAGAGACAACAGCAAGCAGCAGGTGTATCTCCAGATGAATAACCTGAAGACTGAAGACTCTGCTGTGTATTATT
GTGCCGGA
>X81484|IGHV1S6*01_Oncmyk|(F)|V-REGION
..............................CCA...GTTGTAAAAATAACTGGAGAACCACACAAAGTGACCTGTACAG
CTTCTGGCTTCACATTC............AGTAACTACTGGATGGCTTGGATCAGACAGGCTCCTGGGAAAGGACTTGA
ATGGATTGCCATTATAAAATATGAT......AGTGCTGAAATCTACTACTCCCAATCAGTCCAG...GGTCGGTTCACC
ATCTCCAGAGACAACAGCAAGCAGCAGGTGTATCTCCAGATGAACAGCCTGAAGACTGAAGACTCTGCTGTTTATTATT
GTGCCAGA
>Y08597|IGHV1S7*01_Oncmyk|(F)|V-REGION
GGTCAGACACTAACTGAG......TCTGGACCA...GTTGTAAAAATAACTGGAGAACCACACAAAGTGACCTGTACAG
CTTCTGGCTTCACATTC............AGTAACTACTGGATGGCTTGGATCAGACAGGCTCCTGGGAAAGGACTTGA
ATGGATTGCCATTATAAAATATGAT......AGTGCTGAAATGTACTACTCCCAGTCAGTCCAG...GGTCGGTTCACC
ATCTCCAGAGACAACAGCAAGCAGAAGGTGTATCTCCAGATGAACAGCCTGAAGACTGAAGACTCTGCTGTTTATTATT
GTGCCGGC
>X81509|IGHV2S1*01_Oncmyk|(F)|V-REGION
GGTCAGAGTCTGGAGTCCATTCCCTCCAATTCA...GTCATGAAAAAGCCTGGAGAAACTCTCAGTCTCTCCTGTAAGG
GATCTGGGTATACCTTT............AGTAGCTACAACACACATTGGATTAGACAACCTGCTGGGAAAGCATTGGA
ATGGATGGGTTATTCTGGATTA............GGCCTAGGCTACCATGCTAAAAGCTTTGCA...GGACGTATGGAA
ACGACTAAAGATAATTCCAACAGCATGATGACTCTGAAGCTGTCTGGTCTGAGAGCAGAGGACTCTGCTGTGTATTACT
GTGCACGA
>X65262|IGHV2S2*01_Oncmyk|(F)|V-REGION
GGTCAGAGTCTGGAGTCCATTCCCTCTAGTCCA...GTCCAGAAAAATCCCGGAGAAACTCTCAGTCTGTCCTGTAAGA
TATCTGGATTCACCTTT............GACAGCCACAACACACACTGGATACGACAGCCAGCAGGAAAATCCCTGGA
GTGGTTGGGTTTTTCTGGATTA............GGCCTAGGTTACCATGCTAAAAGGTTTGAA...GGACGTATGGAA
ACCACTAAAGATACTAGTAACAGCATGTTGACTTTGATGCTGTCTGGTCTGAGAACAGAGGACTCTGCTGTGTATTACT
GTGCAAGA
>X81512|IGHV2S3*01_Oncmyk|(F)|V-REGION
..................ATTCCCTCCAGTCCA...GTCCTGAAAAAGCCTGGAGAAACTCTCAGTCTGTCCTGTAAGA
TATCTGGATACACTGTT............GACAGCCACAGCACACACTGGATACGACAACCAGCAGGAAAATCTCTGGA
GTGGATGGGTTATTCTGGATTA............GGCCTAGGTTACCATGCTAAAACTTTTGAA...GGACGTATGGAA
ACCACTAAAGATAACTCCAACAGCATGTTGACTCTGAAGCTGTCTGGTCTGAGAGCAGAGGACTCTGCAGCGTATTACT
GTGCAAGA
>X81510|IGHV3S1*01_Oncmyk|(F)|V-REGION
CAGACTGAGCTCACACAG......CCAGGCTTT...TTGACCCTGCAGCCTGGACAGCCTCTGACCCTCTCCTGTAAGG
TCTCTGGGTATTCTTTAACC......AGTACCAGCTACTGTACAGGTTGGGTACGACAGCCTGCAGGAAAAGCACTGGA
GTGGGTTGGAAACATGTGTGGCAGT.........GGTAACATATACATCAGTGATAAGCTGAAA...AACAAATTCAGT
ATGTCCAGAGACACTTCCAGCAGCACAGTGACTTTAACAGGACAGAGTCTGCAGACTGAAGACACAGCTGTATATTATT
GTGCTCGA
>L28742|IGHV3S2*01_Oncmyk|(F)|V-REGION
CAGACTGAGCTCACACAG......CCAGGCTCT...TTGACCCTGCAGCCTGGACAGCCTCTGACCCTCTCCTGTAAGG
TCTCTGGGTATTCTTTAACC......AGTACCAGCTACTGTACAGGTTGGGTACGACAGCCTGCAGGAAAAGCACTGGA
GTGGGTTGGATACATGTGTGGCAGT.........GGTAACATATACTACAGTGATAAGCTGAAA...AACAAATTCAGT
ATCTCCAGAGACACTTCCAGCACCACAGTGACTTTAACAGGACAGAGTCTGCAGACTGAAGACACAGTTGTGTATTATT
GTGCTCGA
>L28805|IGHV3S3*01_Oncmyk|(F)|V-REGION
CAGACTGAGCTCACACAG......CCAGGCTCT...TTGACCCTGCAGCCTGGACAGCCTCTGACCCTCTCCTGTAAGG
TCTCTGGGTATTCTTTAACC......AGTACCAGCTACTGTACAGGTTGGGTACGACAGCCTGCAGGAAAAGCACTGGA
GTGGGTTGGATACATGTGTGGCAGT.........GGTAACATATACTACAGTGATAAGCTGAAA...AACAAATTCAGT
ATCTCCAGAGACACTTCCAGCAGCACAGTGACTTTAACAGGACAGAGTCTGCAGACTGAAGACACAGCTGTGTATTATT
GTGCTCGA
>Y08595|IGHV3S4*01_Oncmyk|(F)|V-REGION
CAGACTGAGCTCACACAG......CCAGGCTTT...TTGACCCTGCAGCCTGGACAGCCTCTGACCCTCTCCTGTAAGG
TCTCTGGGTATTCTTTAACC......AGTACCAGCTACTGTACAGGTTGGGTACGACAGCCTGCAGGAAAAGCACTGGA
CTGGGTTGGAAACATGTGTGGCAGT.........GGTAACATATACTACAGTGATAATCTGAAA...AACAAATTCAGT
ATCTCCAGAGACACTTCCAGCAGCACAGTGACTTTAACAGGACAGAGTCTGCAGACTGAAGACACAGCTGTATATTATT
GTGCTCGA
>L28744|IGHV4S1*01_Oncmyk|(F)|V-REGION
...GATGAGATGGATCAG......TCTCCTTCT...CAGGTGAAAAGACCTGGAGACAAGTTTAAATTGTCATGTAAAA
TCTCTGGGTTTGATATG............ACAAACTATTACATGCACTGGATAAGACAGAAACCAGGCAAAGCTCTGGA
GTGGATTGGGGTTATTAACTCTGGTTCA...ACAGATGCTCCAGTCTACTCAGACTCCCTGAAA...GGCCAGTTCACC
CTGACCGAGGACGTCTCTACAAGCACACAGTTCTTAGAGGCCAAGAGTCTGAGTTCAGAGGACTCTGCTGTTTATTATT
GTGCTCGC
>X81513|IGHV5S1*01_Oncmyk|(F)|V-REGION
GGTCAGACACTGACTGAG......TCTGGACCA...GTAGTTAAAAAGCCTGGAGAATCCCACAAACTGACCTGTACAG
CCTCTGGCTTCACATTC............AGTAGCTATAGGATGGGTTGGATCAGACAGGCTCCTGGGAAAGGACTGGA
GTGGATTGCTTATATTAGCACACAG......AGTAATCCAATCTCTTATTCCCAGTCAGACCAG...GGTAGATTCACT
ATCTCCAGAGATGACTCCAGCAGTAAGCTGTACCTACAGATGAACAGTCTGAGGATGGAGAACACAGCAGTGTATTACT
GTGCTAGA
>L28745|IGHV5S2*01_Oncmyk|(F)|V-REGION
GGTCAGACACTGACTGAG......TCTGGACCA...GGGATTAAAACGCCTGGAGAATCCAACACACTGAGTTGTACCA
CCTCTGGGTTCACATTC............AGTAGCTACCATATGGCTTGGATGAAACAGGCTCCTGGGAAAGGACTTGA
GTTTGTTGCCTTTATACACACTGGT......GGATCGAGTCCATTCTATTCTCAGTCAATACAG...GGTAGATTCACC
ATCTCCAGAGATGACTCCAGCAGTAAGCTGTACCTACAGATGAACAGTCTGAAGAGTGAGGACACAGCATTGTATTACT
GTGCCCGG
>U04616|IGHV5S3*01_Oncmyk|(F)|V-REGION
GGTCAGACACTGACTGAG......TCTGGACCA...GTGGTTAAAAAGCCTGGTGAATCACACAAACTGACCTGTACAG
CCTCTGGGTTCACATTC............AGTAGCTATGCGATGAACTGGGTCAGACAGGCTCCTGGGAAAGGATTAGA
GTGGATTGCTTATATCAGCACAGCT......AGTACACCCATATATTACTCCCAGTCAGTCCAG...GGTAGATTCACC
ATCTCTAGAGATGACTCCAGCAGTAAGCTGTACCTACAGATGAACAGTCTGAAGAGTGAAGACACAGCGGTGTATTACT
GTGCCCGG
>U04615|IGHV5S4*01_Oncmyk|(F)|V-REGION
GGTCAGACATTGACTGAG......TCTGGACCA...GTGGTTAAAAATCCTGGAGAATCACACAAACTGACCTGTACAG
GCTCTGGGTTCACATTC............AGTAGCTATGGGATGAACTGGATCAGACAGGCTCCTGGGAAAGGATTGGA
GTGGATTGCCTATAGTTATAGT............ACTACTACATATTACTCCCAGTCATTTCAG...GGTAGATTCACC
ATCTCCAGAGATGACTCCAGCAGTAAGCTATACCTACAGATGAACAGTCTGAGGAGTGAGGACACAGCAGTGTATTACT
GTGCTAGA
>X81493|IGHV5S5*01_Oncmyk|(F)|V-REGION
GGTCAGACACTGACTGAG......TCTGGACCA...GGGATTAAAACGCCTGGAGAATCCAACACACTGAGTTGTACCA
CCTCTGGGTTCACATTC............AGTAGTTACCATATGGCTTGGATGAAACAGGCTCCTGGGAAAGGACTTGA
GTTTGTTGCCTTTATACACACTGGT......GGATCGAGTCCATCTATTCTCAGTCGAATACAG...GGTAGATTCACC
ATCTCCAGAGATGACTCCAGCAGTAAGCTGTACCTACAGATGAACAGTCTGAAGAGTGAGGACACAGCATTGTATTACT
GTGCCCGG
>X81492|IGHV5S6*01_Oncmyk|(F)|V-REGION
GGTCAGACACTGACTGAG......TCTGGACCA...GGGATTAAAACGCCTGGAGAATCCAACACACTGAGTTGTACCA
CCTCTGGGTTCACATTC............AGTAGCTACCACATGGCTTGGATGAAACAGGCTCCTGGGAAAGGACTTGA
GTTTGTTGCCTTTATACACACTGGT......GGATCGAGTCCATTCTATTCTCAGTCAATACAG...GGTAGATTGACC
ATCTCCAGAGATGACTCCAGCAGTAAGCTGTACCTACAGATGAACAGTCTGAAGAGTGAGGACACAGCACTGTATTACT
GTGCCCGG
>X81491|IGHV5S7*01_Oncmyk|(F)|V-REGION
GGTCAGACACTGACTGAG......TCTGGACCA...GGGGTTAAAACGCCTGGAGAATCCAACACACTGAGTTGTACCA
CCTCTGGGTTCACATTC............AGTAGCTACCACATGGCTTGGATGAAACAGGCTCCTGGGAAAGGACTTGA
GTTTGTTGCCTTTATACACACTGGT......GGATCGAGTCCATTCTATTCTCAGTCAATACAG...GGTAGATTCACC
ATCTCCAGAGATGACTCCAGCAGTAAGCTGTACCTACAGATGAACAGTCTGAAGAGTGAGGACACAGCATTGTATTACT
GTGCCCGG
>Y08596|IGHV5S8*01_Oncmyk|(F)|V-REGION
GGTCAGACACTGACTGAG......TCTGGACCA...GGGATTAAAACGCCTGGAGAATCCAACACACTGAGTTGTACCA
CCTCTGGGTTCACATTC............AGTAGCTACCATATGGCTTGGATGAAACAGGCTCCTGGGAAAGGACTTGA
GTTTCTTGCCCTTTATACACACTGG......TGGATCGAGTCCATTCTATCTCAGTCAATACAG...GGTAGATTCACC
ATCTCCAGAGATGACTCCAGCAGTAAGCTGTACCTACAGATGAACAGTCTGAAGAGTGAGGACACAGCATTGTATTACT
GTGCCCGG
>Y08599|IGHV5S9*01_Oncmyk|(F)|V-REGION
GGTCAGACACTGACTGAG......TCTGGACCA...GGGATTAAAACGCCTGGAGAATCCAACACACTGAGTTGTACCA
CCTCTGGGTTCACATTC............AGTAGCTACCATATGGCTTGGATGAAACAGGCTCCTGGGAAAGGACTTGA
GTTTGTTGCCTTTATACACACTGGT.........GGATCGAGTCCATCTATCTCAGTCAATCAG...GGTAGATTCACC
ATCTCCAGAGATGACTCCAGCAGTAAGCTGTACCTACAGATGAACAGTCTGAAGAGTGAGGACACAGCATTGTATTACT
GTGCACAC
>X81481|IGHV6S1*01_Oncmyk|(F)|V-REGION
...GAAGAACTCACTCAG......CCAGCCTCT...ATGACTGTCCAGTCAGGTCAACCACTGACCATCTCTTGTAAGG
TTTCATATTCTGTAGGT...............AGCTATTACACAGCTTGGATCCGGCAGCCTGCAGGGAAAACACTGGA
GTGGATTGGAATGAAATATACT............GGAGGAACGCACCACAAAGACTCCCTGAAA...AATAAGTTCAGC
CTCACAGTAGACTCCTCCAGCAATACTGTGACTTTAACAGGACAGAGTCTGCAGACTGAGGACACAGCTGTGTATTATT
GTGCTCGC
>L28746|IGHV6S2*01_Oncmyk|(F)|V-REGION
...TATGAACTCTCCCAG......CCAGCATCT...ATGACTGTCCTGCCAGGTCAACCACTGACCATCTCCTGTAAGG
TCTCATATTCAGTTACT...............AACGCTTGGACAGCTTGGATCCGAAAGCCTGCAGGGAAAACACTGGA
GTGGATTGGAAATGTATATTCT............GGAGTCACACAATACAAGGATTCGCTGAAG...AACAAGTTCAGC
CTCTCAGTAGACTCTAGCAGTAATACTGTGTTTTTAAAAGGGCAGAACCTTCAGACTGAAGGCTCAACTGTGTATTATT
GTGCCCTA
>X81496|IGHV6S3*01_Oncmyk|(F)|V-REGION
...GAAGAACTCACTCAG......CCAGCCTCT...ATGACTGTCCAGTCAGGTCAACCACTGACCATCTCTTGTAAGG
TTTCATATTCTGTAGGT...............ACGTATTACACAGCTTGGATCCGGCAGCCTGCACCCAAAACACTGGA
GTGGATTGGAATGAAATATACT............GGAGGAACGCACCACAAAGACTCCCTGAAA...AATAAGTTCAGC
CTCACAGTAGACTCCTCCAGCAATACTGTGACTTTAACAGGACAGAGTCTGCAGACTGAGGACACAGCTGTGTATTATT
GTGCTCGC
>X81494|IGHV6S4*01_Oncmyk|(F)|V-REGION
...TATGAACTCACTCAG......CCAGCCTCT...TTGACTGTCCAGCCAGGTCAACCACTGACCATCTCCTGTAAGG
TCTCATATTCAGTTAGT...............AGCTACTACACGGCTTGGATTCGACAGCCTGCAGGGAAAACACTGGA
GTGGATTGGATATATTAGTAGTGGT.........GGAGGCACAGCTTATAAAGATTCACTGAAA...AACAAGTTCAGC
ATCACCAGAGACACGTCCAGCAACACATTGTTTTTAAAAGGACAGAGTCTGCAGACTGAAGACACAGCTGTGTATTATT
GTGCTCGC
>X81497|IGHV6S5*01_Oncmyk|(F)|V-REGION
...GAAGAACTCACTCAG......CCAGCCTCT...ATGGCTGTCCAGCCAGGTCAACCACTGACCATCTCCTGTAAGG
TCTCATATTCTGTTGCT...............AGCTATTGGACAGCTTGGATCCGACAACCTGCAGGGAAAGGACTGGA
GTGGATTGGGCAAATATATACT............GGAAACACAATCTACAAGGATTCACTGAAA...AACAAGTTCAGC
CTCACTTTAGACTCCACTAACAAGATAGTGACTTTAACAGGACAGAACCTGCAGACTGAAGACACAGCTGTGTATTATT
GTGCCCGA
>X81487|IGHV6S6*01_Oncmyk|(F)|V-REGION
........................CCAGCCTCT...ATGACTGTCCAGCCAGGTCAACCACTGACCATGTCCTGTAAGG
TCTCATATTCTGTTGCT...............AGCTATTGGACAGCTTGGATCCGACAACCTGCAGGGAAAGGACTGGA
GTGGATTGGGCAAATATATACT............GGAAACACAATCTACAAGGATTCACTGAAA...AACAAGTTCAGC
CTCACTTTAGACTCCTCTAACAAGATAGTGACTTTAACAGGACAGAACCTGCAGACTGAAAACACAGCTGTGTATTATT
GTGCCCGA
>X81495|IGHV6S7*01_Oncmyk|(F)|V-REGION
...GAAGAACTCACTCAG......CCAGCCTCT...ATGACTGTCCAGTCAGGTCAACCACTGACCATCTCTTGTAAGG
TTTCATATTCTGTAGGT...............AGCTATTACACAGCTTGGATCCGGCAGCCTGCACCCAAAACACTGGA
GTGGATTGGAATGAAATATACT............GGAGGAACGCACCACAAAGACTCCCTGAAA...AATAAGTTCAGC
CTCACAGTAGACTCCTCCAGCAATACTGTGACTTTAACAGGAACGAGTCTGCAGACTGAGGACACAGCTGTGTATTATT
GTGCTCGC
>Y08600|IGHV6S8*01_Oncmyk|(F)|V-REGION 
...GAAGAACTCACTCAG......CCAGCCTCT...ATGACTGTCCAGCCAGGTCAACCACTGACCATATCCTGTAAGG
TCTCATATCCTGTTACT...............AGTTATTGGACAGCTTGGATCCGACAACCTGCAGGGAAAGGACTGGA
GTGGATTGGGCAGATATATACT............GGAAACACAATCTACAAGGATTCACTGAAA...AACAAGTTCAGC
CTCACTTTAGACTCCTCTAACAAGATAGTGACTTTAACAGGACAGAACCTGCAGACTGAAGACACAGCTGTGTATTATT
GTGCCCGA
>Y08602|IGHV6S9*01_Oncmyk|(F)|V-REGION 
...GAAGAACTCACTCAG......CCAGCCTCT...ATGACTGTCCAGTCAGGTCAACCACTGACCATCTCTTGTAAGG
TTTCATATTCTGTAGGT...............AGCTATTACACAGCTTGGATCCGGCAGCCTGCAGGGAAAACACTGGA
GTGGATTGGAATGAAATATACT............GGAGGAACGCACCACAAAGACTCCCTGAAA...AATAAGTTCAGC
CTCACAGTAGACTCCTCCAGCAATACTGTGACTTTAACACCACAGAGTCTGCAGACTGAGGACACAGCTGTTTATTATT
GTGCTCGC
>L28747|IGHV7S1*01_Oncmyk|(F)|V-REGION
GGTCTTGAACTCAGCCAG......CCAAATGTA...ATGGTTGTAAAGCCTGGAGAGTCTCTGAGCATCACCTGTAAGG
TCTCTGGGTATTCTGTTAGTGATAGCAGCATAAGCTTTGCCACAGGTTGGGTTCGAAAGCCTGCAGGGAAAGCAATGGA
GTGGATTTCCCATATATGGGATAAT.........GGAGACATATACAAAAATGATGCATTGAAA...AACAAGTTCAGC
ATTTCAACACATGCCTCCAGCAACTCTGTGTCTTTACAAGGGAAGAGCCTGCAACCTGAAGACACAGCTGTGTATTACT
GTGCTCGG
>X81482|IGHV8S1*01_Oncmyk|(F)|V-REGION
CAGGTCGTACTCACACAG......GCTGAACAGTCAGTCCAGGGGACCCCTGCAGGATCCCTCAAACTCACATGTGCCT
GTAGTGGATTCACTCTA............AGCAGCAGTTACATGCACTGGATCCGCCAGGCACCTGGAAAAGGACTTGA
ATGGATAATTTACTATTACTCTGAT.........AGTAACAAGAGCAATGCCCCTGTAGTACAG...GGTAGATTCACA
GCGTTGAAGGAC......AGCACTAATTTCTATCTGCACATGAACCTGTTGAAGCCAGAGGACTCCGCAGAGTATTACT
GTGCTAGA
>X81501|IGHV8S2*01_Oncmyk|(F)|V-REGION
CAGATTGTACTCACACAG......GCTAGTCAG......CCAGGGACTCCTGCAGGATCCCTCAAACTCACATGTGCCT
GTAGTGGATTCACTCTA............AGCAGGGGTAATATGTTTTGGATCCGCCAGGCACCTGGAAAAGGACTTGA
ATGGATCATTTACTATTATTCTGAC.........AGTGACAAGAGCAATGCCCCTGTAGTACAG...GGTCGATTCACT
GGATCAAAGGAC......AGCAGTAATTTCTATCTCCACATGAGCCAGTTGAAGCCAGAGGACTCTGCAGTGTATTACT
GTGCTAGA
>X81503|IGHV8S3*01_Oncmyk|(F)|V-REGION
CAGATTGTACTCACACAG......GCTGAGTCA...GTCCAGGGGACTCCTGCAGGATCCCTCAAACTCACATGTGCCT
GTAGTGGATTCACTCTA............AGCAGCACTAATATGTTTTGGATCCGCCAGGCACCTGGAAAAGGACTTGA
ATGGATCATTTACTATTATTCTGAC.........AGTGACAAGAGCAATGCCCCTGTAGTACAG...GGTCGATTCACT
GCATCAAAGGAC......AGCAGTAATTTCTATCTCCACATGAGCCAGTTGAAGCCAGAGGACTCTGCAGAGTATTACT
GTGCTTAT
>X81499|IGHV8S4*01_Oncmyk|(F)|V-REGION
CAGGTCGTACTCACACAG......ACTGAACAGTCAGTCCAGGGGACTCCTGCAGGATCCCTCAAACTCACATGTGCCT
GTAGTGGATTCACTCTA............AGCAGCACTAATATGCACTGGATCCGCCAAGCACCTGGAAAAGGACTTGA
ATGGATCATTTACTATTATTCTGAC.........AGTGACAAGAGCAATGCCCCTGTAGTACAG...GGTCGATTCACT
GCATCAAAGGAC......AGCAGAAATTTCTATCTCCACATGAGCCAGTTGAAGCCAGAGGACTCTGCAGTGTATTACT
GTGCTAGA
>X81488|IGHV8S5*01_Oncmyk|(F)|V-REGION
.........................................................TCCCTCAAACTCACGTGTGCCT
GTAGTGGATTCACTCTA............AGCAGCACTAATATGCACTGGATCCGCCAAGCACCTGGAAAAGGACTTGA
ATGGATCATTTACTATTATTCTGAC.........AGTGACAAGAGCAATGCCCAGGTAGTACAG...GGCCGATTCACT
GCATCAAAGGAC......AGCAGTAATTTATATCTGCACATGAGCCAGTTGAAGCCAGAGGACTCTGCAGTGTATTACT
GTGCTAGA
>X81498|IGHV8S6*01_Oncmyk|(F)|V-REGION
CAGGTCGTACTCACACAG......GCTGAACAGTCAGTCCAGGGGACCCCTGCAGGATCCCTCAAACTCACATGTGCCT
GTAGTGGATTCACTCTA............AGCAGTAGTTACATGCACTGGATCCGCCAGGCACCTGGAAAAGGACTTGA
ATGGATCATTTACTATTACTCTGAT.........AGTAACAAGAGCAATGCCCCTGTAGTACAG...GGTCGATTCACT
GAATCAAAGGAC......AGCAGTAATTTCTATCTCCACATGAGCCAGTTGAAGCCAGAGGACTCTGCAGTGTATTACT
GTGCTAGA
>X81502|IGHV8S7*01_Oncmyk|(F)|V-REGION
CAGGTCGTACTCACACAG......GCTGAACAGTCGGTCCAGGGGACACCTGGGGGATCCCTCAAACTCACATGTGCCT
GTAGTGGAATCACTCTC............AGCAGCTCTTATATGCACTGGATTCGCCAAGCACCTGGAAAAGGACTTGA
ATGGATAATTTACTATTATTCTGAC.........AGTTACAAGAGCAATGCCCAGGTAGTACAG...GGTCGATTCACT
GCATCGAAGGAC......AGCACTAATTTCTATCTGCACATGAGCCAGTTGAAGTCAGAGGACTCTGCAATGTATTACT
GTGCTAAA
>X81500|IGHV8S8*01_Oncmyk|(F)|V-REGION
CAGGTCGTACTCACACAG......GCTGAACAGTCAGTCCAGGGGACCCCTGCAGGATCCCTCAAACTCACATGTGCCT
GTAGTGGATTCACTCTA............AGCAGCAGTTACATGCACTGGATCCGGGAGGCACCTGGGAAAGGACTTGA
ATGGATAATTTACTATTACTCTGAT.........AGTAACAAGAGCAATGCCCCTGTAGTACAG...GGTAGATTCACA
GAGTTGAAGGAC......AGCACTAATTTCTATCTGCACATGAACCTGTTGAAGCCAGAGGACTCGGCAGTGTATTACT
GTGCTAGA
>X81483|IGHV8S9*01_Oncmyk|(F)|V-REGION
CAGGTCGTACTCACACAG......GCTGAACAGTCAGTCCAGGGGACCCCTGCAGGATCCCTCAAACTCACATGTGCCT
GTAGTGGATTCACTCTA............AGCAGCAGTTACATGCACTGGATCCGCCAAGCACCTGGAAAAGGACTTGA
ATGGATAATTTACTATTACTCTGAT.........AGTAACAAGAGCAATGCCCCTGTAGTACAG...GGTAGATTCACA
GCGTTGAAGGAC......AGCACTAATTTCTATCTGCACATGAACCTGTTGAAGCCAGAGGACTCGGCAGTGTATTACT
GTGCTAGA
>Y08601|IGHV8S10*01_Oncmyk|(F)|V-REGION
CAGATCGTCCTCACACAG......GCTGAGTCA...GTCCAGGGGACTCCTGCAGGATCCCTCAAACTCACATGTGCCT
GTAGTGGATTCACTCTA............AGCAGCATAATTATATTTTGGATCCGCCAGGCACCTGGAAAAGGACTTGA
ATGGATCATTTACTATTATTCTGAC.........AGTGACAAAAGCAATGCCCCTGTAGTACAG...GGTCGATTCACT
GCATCAAAGGAC......AGCAGTCCTTTCTATCTCCACATGAGCCAGTTGAAGCCAGAGGACTCTGCAGTGTATTACT
GTGCTAGG
>Y08889|IGHV8S11*01_Oncmyk|(F)|V-REGION
CAGGTCGTACTCACACAG......GCTGAACAGTCAGTCCAGGGGACCCCTGCAGGATCCCTCAAACTCACATGTGCCT
GTAGTGGATTCACTCTA............AGCAGTAGTTACATGCACTGGATCCGCCAGGCACCTGGAAAAGGACTTGA
ATGGATCATTTACTATTACTCTGAT.........AGTAACAAGAGCAATGCCCCTGTAGTACAG...GGTCGATTCACT
GGATCAAAGGAC......AGCAGTAATTTCTATCTCCACATGAGCCAGTTGAAGCCAGAGGACTCTGCAGTGTATTACT
GTGCTAGA
>X81505|IGHV9S1*01_Oncmyk|(F)|V-REGION
GGACAGTCACTCACCTCC......TCTGAGTCA...GTGGTGAAGAAACCTGGAGAGTCAGTAACACTGTCATGTACTG
TGTATGGTTTCTCCATG............GGTAGCTACTACATGCACTGGATCCGTCAGAAACCAGGGAAAGGTCTAGA
GTGGATTGGACGGATTGACACTGGC.........ACTGGCACTGTATTTGCTCAGTCCCTCCAG...GGCCAGTTCACC
ATCACCAAAGACAACTCCAAAAACCAGTTGTATTTAGAGGTGAAAAGCCTGAAGACTGAAGACTCTGCTGTTTATTATT
GTGCCAGG
>X81504|IGHV9S2*01_Oncmyk|(F)|V-REGION
GGACAGTCACTCACCTCC......TCTGAGTCA...GTGGTGAAGAGCCCTGGAGAGTCAGTAACACTGTCATGTACTG
TGTCTGGTTTCTCCATG............GATAGCTACTACATGCACTGGATCCGTCAGAAACCAGGGAAAGGTCTAGA
GTGGATTGGCCTTATTGACACTGGC.........ACTGGCACTGTATTTGCTCAGTCCCGCCAG...GGCCAGTTCACC
ATCACCAAAGACAACTCCAAAAACCAGTTGTACTTAGAGGTGAAAAGCCTGAAGACTGAAGACTCTGCTGTTTATTATT
GTGCAAGA
>X81507|IGHV9S3*01_Oncmyk|(F)|V-REGION
GGGCAGTCACTCACCTCC......TCTGAGCCA...GTAGTGAAGAGACCTAGTGAGTCAGTAACACTGTCCTGTACTG
TGTCTGGATTCTCCATG............GGTAGCTACTGGATGCAATGGATCCGTCAGAAACCAGGGAAAGGATTGGA
GTGGATTGGATTCATTGACACT..........GGAACCACTGCTTATTATGCCCAGTCTCTCCA...GGCCAGTTCACC
ATCACCAAAGACACCTCCAAAAACCAGCTGTACTTAGAGATGAAAAGTCTGAGGACTGAAGACTCTGCTGTTTATTATT
GTGCCAGA
>X81506|IGHV9S4*01_Oncmyk|(F)|V-REGION
GGGCAGTCACTCACCTCC......TCTGAGCCA...GTCGTGAAGAGACCTAGTGAGTCAGTAACACTGTCCTGTACTG
TGTCTGGATTCTCCATG............GGTAGTTGCTGGATGCAATGGATCCGTCAGAAACCAGGGAAAGGATTGGA
GTGGATTGGATTCATTGACACTGGA.........ACCACTGCTTATTATGCCCAGTCTCTCCAG...GGCCAGTTCACC
ATCACCAAAGACACCTCCAAAAACCAGCTGTACTTAGAGATGAAAAGTCTGAAGACTGAAGACTCTGCTGTTTATTATT
GTGCCAGA
>Y08603|IGHV9S5*01_Oncmyk|(F)|V-REGION
GGGCAGTCACTCACCTCC......TCTGAAGCC...GTCGTGAAGAGACCTAGTGAGTCAGTAACACTGTCCTGTACTG
TGTCTGGATTCTCCATG............GGTAGCTACTGGATGCAATGGATCCGTCAGAAACCAGGGAAAGGATTGGA
GTGGATTGGATTCATTGACACTGGA.........ACCACTGCTTATTATGCCCAGTCTCTCCAG...GGCCAGTTCACC
ATCACCAAAGACACCTCCAAAAACCAGCTGTACTTAGAGATGAAAAGTCTGAAGACTGAAGACTCTGCTGTTTATTATT
GTGCCAGA
>Y08604|IGHV9S6*01_Oncmyk|(F)|V-REGION
GGGCAGTCACTCACCTCC......TCTGAGCCA...GTAGTGAAGAGACCTAGTGAGTCAGTAACACTGTCCTGTTCTG
TGTCTGGATTCTCCATG............GGTAGCTACTGGATGCAATGGATCCGTCAGAAACCAGGGAAAGGATTGGA
GTGGATTGGATTCATTGACACTGGA.........ACCACTGCTTATTATGCCCAGTCTCTCCAG...GGCCAGTTCACC
ACCACCAAAGACACCTCCAAAAACCAGGTGTACCTCCAGATGAACAGCCTGAAGACTGAAGACTCTGCTGTTTATTATT
GTGCCAGG
>X81508|IGHV10S1*01_Oncmyk|(F)|V-REGION
GATATTGAACTCATCCAG......TCTGGTCCA...GTGGTTATAGAACCAGGAGTGTCTTTCAGCATCTCCTGCAAAT
TCTCTGGGTTTTCTATA............TCTTCTTATTGTCTTGGATGGATACGACAAGCTGAAGGGAAAGCTTTGGA
GCATGTTGGTGTTACATGCAGT............AGTAGTACTTACACTGTAGACTCACTAAAG...AGCAAGATCACT
TCTAGATATGACAGTTCCAGCAGTACAGTGTTTCTACAAGGGAACAACTTCCAGACTGAAGACACAGCTGTGTATTATT
GTGCTAGG
>X81511|IGHV11S1*01_Oncmyk|(F)|V-REGION
AGCATTAGTTTGACCTCC......TCCCCTGCT...CAACTCAAACCCCCTGGAGAGTCAGTGAAACTATCTTGCCAAG
TCTCTGGCTATGCCCTG............ACAAGCCAAGGTACAGGTTGGATACGACAGCAGCCAGGGAAAACACTGGA
GTGGATTGGGATCATCTGGAGTGGT.........GGATCAATTGAATCTGGAGCCTCTTTTAAG...AGGAGATTCACC
ATCTCCAGAGAC...AGTAGTAATGTACTGTACTTAGACATCACCAGTCTGCAGGCTGAGGACACAGCTGTGTATTATT
GTGCTCGG
>AB052658|IGHV1S1*01_Paroli|(F)|V-REGION
TGTCAAACTTTGACGCAG......CCAGCCTCT...GCGACTGTGCAGCCAGGTCAACCTCTGACCATCAGCTGTCAGG
TCTCTTATTCTATGAGC...............AGCTACAGCACAGCTTGGATCAGACAGCCTGCAGGGAAAGGACTGGA
GTGGATTGGGGCGAAATATACA............GGAGCTTCATACTATAAAGAGTCACTGAAG...AACAAGTTCAGC
ATCGACTTAGACACTTCCAGCAACACAGCGACTCTAAAGGGACAGAACATGCAGCCTGGAGACACTGCTGTGTATTACT
GTGCCAGA
>AB052744|IGHV1S2*01_Paroli|(F)|V-REGION
TGTGAAACTTTGACGCAG......CCAGCCTCT...GTGACTGTGCGGCCAGGTCAACCTCTGACCATCAGCTGTCAGG
TCTCTTATTCTGTCAGC...............AGCTACCACACAGGTTGGATCAGACAACCTGCAGGAAAAGGACTGGA
GTGGATTGGAAGCAGGCGTTCTGGA.........GGGGACACTTACTATAAAGAGTCACTAAAG...AACAAGTTCAGT
ATCGACTTAGACACTTCCAGCAACACAGTGAGTCTAAAGGGACAGAACATGCAGCCTGGAGACACTGCTGTGTATTACT
GTGCCAGA
>AF226284|IGHV1S3*01_Paroli|(F)|V-REGION
TGTGAAACTTTGACGCAG......CCAGCCTCT...GTGACTGTGCAGCAAGGTCAACCTCTGACCATCAGCTGTCAGG
TCTCTTATTCTTTTAGC...............AGCTACGGCTCAACTTGGATCAGACAGCCTGCAGGAAAAGGACTGGA
GTGGATTGGAAGCACGCGTTATGGA.........TACAGCACATACTATAAAGAGTCACTAAGG...AACAAGTTCGGT
ATCCACTTGAACTATTCCAGCAACACAGCGACTCTAAAGGGACAGAACATGCAGCCTGGAGACACTGCTGTGTATTACT
GTGCCAGA
>AJ000361|IGHV1S1*01_Salalp|(F)|V-REGION
GGTCAGACACTGACTGAG......TCTGAATCA...GTGGTTAAAAAGCCTGGAGATTCTCACAAATTGACCTGTACAT
ATTCTGGGTTTGGTGGC...............AACTATTGGAATGCTTGGATCAGACAGGCTTCTGGGAAAGGACTGGA
GTGGGTTGCAACTATCAGTGATGGT.........GGCAGGACTTACTACTCTCAGTCTGTTCAG...GGTCAGTTCACC
ATCTCCAGAGACAACAGCAAGCAGCAGGTGTATCTCCAGATGAACAATCTGAACACTGAAGACTCTGCTGTTTATTATT
GTGCCAGA
>AJ000367|IGHV1S2*01_Salalp|(F)|V-REGION
GGTCAGACACTGACTGAG......TCTGAATCA...GTGGTTAAAAAGCCTGGAGATTCTCACAAATTGACCTGTACAT
ATTCTGGGTTTGGTGGC...............AACTATTGGAATGCTTGGATGAGACAGGCTTCTGGGAAAGGACTGGA
GTGGGTTGCAACTATCAGTGATGGT.........GGCAGGACTTACTACTCTCAGTCTGTTCAG...GGTCAGTTCACC
ATCTCCAGAGACAACAGCAAGCAGCAGGTGTATCTCCAGATGAACAATCTGAACACTGAAGACTCTGCTGTTTATTATT
GTGCCAGA
>AJ000360|IGHV2S1*01_Salalp|(F)|V-REGION
GGTCAGAGTATGGAGTCCATTCCCTCTGGTCCA...GTCCCGAAAAAGCCTGGAGATACTCTCAGCCTCTCCTGTAAGG
GATCTGGCTTTACATTT............AGTAGCTATGGCATGCACTGGTTAAGACAACCTGCAGGAAAAGCACTGGA
TTGGATGGGACTGATCTATTATGAT......GCCAGCAAAACAATCTATTCAAAAAATATTGAA...GGACGTATAGAA
GTCACCAGAGATAATTCTAACAGCATGGTGTATCTGAAGCTGTCTGGTCTGAGAGCAGAGGACTCTGCTGTGTATTACT
GTGCAAGA
>AJ000363|IGHV2S2*01_Salalp|(F)|V-REGION
GGACAGAGTCTGGAGTCCAGTCCCTCCAGTTCA...GTCCTGAAAAAGCTTGGAGAAACTATAAGTCTCTCCTGTAAGA
TATCTGGATTCACCTTT............GGCAGCCACAACACACACTGGATACGACAGCCAGCTGGAAAGTCCCTGGA
ATGGATGGGTTACTCTGGATTA............GGCCTAGGTTACCATGCTAAAAGGTTTGAA...GGACGCATGGAA
ACAACTAAAGCTAATTCCAACAGCATGATGACTCTGAAGCTGTCTGGTCTCAAAGCAGAGGACTCTGCTGTGTATTACT
GTGCACGA
>AJ000366|IGHV3S1*01_Salalp|(F)|V-REGION
...AGTGAACACAACCAG......CCAAACTCA...TTGAGTGTAAAGCGTGAAGAAACTTTGACTATTAGTTGTGCAA
TCTCGGGGTATTCTCTTACA......GACAACAGCTATGTGGTAGCCTGGAACCGACAGCCTGCAAAGAAACCAATGGA
ATGTATTTTTTATATTTGGGGTGGT.........GGTAGTTTTTACCTTAACAACGCACTAAAA...AACAAGTTCAGC
TTTAGAAGAGACATGTCCAGCAGTACTTCAACTCTAACAGGACAGAACCTGCAGACTGAAGATACAGCTGTGTATTATT
GTGCTCGG
>AJ000368|IGHV4S1*01_Salalp|(F)|V-REGION
GATATAAGGCTGGATCAG......TCTCCTCCT...CAAGTGAAAAGACCTGGAGACACTGTTAAATTGTCCTGTACAA
TCTCTGGTTTCTCAATG............AGTGGCTTCTGGATACACTGGATGAGGCAGAACCAAGGCAAAGCCCTAGA
GTGGATCGGGAGAATGAATAGC............AACTCTCCAGTCTACTCAGACTCCCTGAAA...GGCCAGTTCGCC
CTGACTGAGGACGTCTCCACAAGCACACAGTTCTTAGAGGCCAAGAGTCTGAGATCAGAGGACTCTGCTGTTTATTATT
GTGCCCGA
>AJ000359|IGHV5S1*01_Salalp|(F)|V-REGION
GGTCAGACACTGACTGAG......TCTGGACCA...GTAGTTAAAAGGCCTGGAGAATCCCACAAACTGACCTGTGCGG
CGCCTGGGTTCACGTTC............AGTAGCTATTATATGGGCTGGATCAGACAAGCTAAAGGGAAAGAGTTTGA
GTGGATTGGTCATATTCATGGT............GGTAATACGTATTACTCCCAGTCATTTCAG...GGTAGATTCACC
ATCTCCAGGGAAGACTCCAGCAGTAAACTGTACATACAGATGAACAGCCTGAAGAGTGAGGACACAGCAGTGTATTACT
GTGGCCGG
>AJ000358|IGHV5S2*01_Salalp|(F)|V-REGION
GGTCAGACACTGACTGAG......TCTGGACCA...GTTGTTAAAAAGCCTGGAGAATCCAACACACTGAGTTGTACAG
CCTCTGGGTTCACATTC............AGTAGCTACCATATGGCTTGGATGAAACAGGCTCCTGGGAAAGGACTTGA
GTTTGTTGCCTTTATACACACTGGT......GGATCGAGTCCATTCTATTCCCAGACAGTCCAG...GGTAGATTCACC
ATCTCCAGAGATGACTCCAGCAGTAAACTGTTTCTACAGATGAACAGCCTGAAGAGTGAGGACACAGCACTGTATTACT
GTGCCCGG
>AJ000364|IGHV5S3*01_Salalp|(F)|V-REGION
GGTCAGACACTGACTGAG......TCTGGACCA...GTGGTTAAAACACCTGGAGAATCCCACAAACTGACCTGTACAG
CTTCTGGGTTCACTTTC............AGTAGCTACTGGATGGCTTGGATCAGACAGGCTCCTGGGAAAGGACTGGA
GTGGATAGCTTATAGTCATAGC............ACTACTGCTTACTACTCCCAGTCATTTCAG...GGTAGATTCACC
ATCTCCAGAGATGACTCCAGCAGTAAGCTGTACCTACAGATGAACAGCCTGAAGAGTGAGGACACAGCAGTGTATTACT
GTGCTAGA
>AJ000369|IGHV6S1*01_Salalp|(F)|V-REGION
...GAAGAACTCACTCAG......CCAGCCTCT...ATGACTGTCCAGCCAGGTCAATCACTGACCATCTCCTGTAAGG
TCTCATATTCTGTTACT...............AGCTATTGGACAGCTTGGATCCGACAGCCTGCAGGGAAAACACTGGA
GTGGATTGGGCAAATATATACT............GGAAACACAATCTACAAGGATTCACTGAAA...AACAAGTTCAGC
CTCACTTTAGACTCCTCTGACAAGATAGTGGCTCTAACAGGGCAGAACCTGCAGACTGAAGACACAGCTGTGTATTATT
GTTCCCGA
>AJ000370|IGHV6S2*01_Salalp|(F)|V-REGION
...GAAGAACTCACTCAG......CCAGCCTCT...ATGACTGTCCAGCCAAGTCAACTACTGACCATCTCCTGTAAGG
TCTCATATTCTGTTACT...............AGTGTTACTACATTCTGGATTCGACAGCCTGCTGGGAAAACATTGGA
GTGGATTGGATATATCAATAATGCT.........GGAAGCACAGCTTATAAAGATTCACTGAAA...AACAAGTTCAGC
ATCACCAGAGACACTTCCAGCAACACATTGTTTTTAAAAGGACAGAGTCTGCAGACTGAAGACACAGCTGTGTATTATT
GTGCTCAC
>AJ000362|IGHV8S1*01_Salalp|(F)|V-REGION
CAGGTCGTACTCACACAG......GCTGAACAGTCAGTCCAGGGGACCCCCGGGGGATCCCTCAAACTCACATGTGCCT
GCAGTGGATTTACTCTA............AGCAGCTACAGAATGCACTGGATCCGGCAAGCACCTGGAAAAGGACTTGA
ATGGATAATTTACTATCATTCTGAC.........ACTGACAAGAGCAATGCCCAGGTAGTACAG...GGCCGATTCACT
GCATCAAAGGAC......AGCACTAATTTCTATCTGCACATGAGCCAGTTGAAGCCAGAGGACTCTGCATTGTATTACT
GTGCTAGT
>AJ000365|IGHV11S1*01_Salalp|(F)|V-REGION
AGCATTAGTTTGACCTCC......TCCCCTGCT...CAACTCAAACCTCCTGGAGAGTCAGTGAAACTATCTTGCCAAG
TCTCTGGCTATGCCCTG............ACAGACTATGGTACAGGTTGGATACGACATCAGGCAGGGAAAACACTGGA
GTGGATTGGGATCATTTGGGCCGGT.........GGATCCATCATCTCTGGAGACTCTTTTAAG...AGCAGATTCACC
ATCTCCAGAGAC...AGTAGTAATGTACTGTACTTAGACATCACCAGTCTGCAGGCTGAGGACACAGCTGTGTATTATT
GTGCTCGG
>AJ296096|IGHV1S1*01_Scomax|(F)|V-REGION
...............................................................................
...............................................................................
..TGGGCATGCACTGGATTGGAATGAGATCTACTGGAGTTTCATACTACAAAGATTCATTAAAG...AACAAGTTCAGT
ATCGACTTAGACACTTGCAGCAAAACTGTGACTCTAAATGGACAGAATGTGCAGCCTGAAGACACTGCTGTGTATTACT
GTGCCAAG
>AF273397|IGHV1S1*01_Salsal|(F)|V-REGION
GGTCAGACACTGACTGAG......TCTGGACCA...GTGGTTAAAAAACCTGGAGAATCCCACCAACTGACCTGTACAG
GCTCTGGGTTCACTTTC............AGTAGCTACTGGATAACTTGGATCAGACAGGCTCCTGGGAAAGGACTAGA
ATTTATAGCAGCACATTATAACAGC.........ATAAATATTGCCTACTCCCAGTCTGTTCAG...GGTCGGTTCACC
ATCTCTAGAGATGACAGCAAGCAGCAGGTGTATCTCCAGATGAACAGCCTGAACACTGAAGACTCCGCTGTTTATTATT
GTGCCAGA
>AF273398|IGHV1S1*02_Salsal|(F)|V-REGION
GGTCAGACACTGACTGAG......TCTGGACCA...GTGGTTAAAAAACCTGGAGAATCCCACCAACTGACCTGTACAG
GCTCTGGGTTCACTTTC............AGTAGCTACTGGATAGCTTGGATCAGACAGGCTCCTGGGAAAGGACTAGA
ATTTATAGCAGCACATTATAACAGC.........ATAAATATTGCCTACTCCCAGTCTGTTCAG...GGTCGGTTCACC
ATCTCTAGAGATGACAGCAAGCAGCAGGTGTATCTCCAGATGAACAGCCTGAACACTGAAGACTCCGCTGTTTATTATT
GTGCCAGA
>AF273399|IGHV1S1*03_Salsal|(F)|V-REGION
GGTCAGACACTGACTGAC......TCTGGACCA...GTGGTTAAAAAACCTGGAGAATCCCACCAACTGACCTGTACAG
GCTCTGGGTTCACTTTC............AGTAGCTACTGGATAGCTTGGATCAGACAGGCTCCTGGGAAAGGACTAGA
ATTTATAGCAGCACATTATAACAGC.........ATAAATATTGCCTACTCCCAGTCTGTTCAG...GGTCGGTTCACC
ATCTCTAGAGATGACAGCAAGCAGCAGGTGTATCTCCAGATGAACAGCCTGAACACTGAAGACTCCGCTGTTTATTATT
GTGCCAGA
>AF273396|IGHV1S2*01_Salsal|(F)|V-REGION
GGTCAGACACTAACTGAG......TCTGGACCA...GTTGTTAAAAAGCCTCAGGAATCCCACAAACTGACCTGTACAG
CCTCTGGTTTTACTTTC............AGTAGCTACTGGATGGCTTGGATCAGACAGGCTCCTGGGAAAGGACTGGA
GTGGGTGTCCTATATTAGCAGTGAT......GGTGGCAGCACTTACTACCCCCAGTCTGTTCAG...GGTCGGTTCACC
ATCTCCAGAGACAACAGCAAGCAGCAGGTGTATCTCCAAATGAACAGCCTGAAGACTGAAGACTCTGCTGTTTATTATT
GTGCCAGA
>AF273402|IGHV2S1*01_Salsal|(F)|V-REGION
GGCCAGAGTCTGGAGTCCATTCCCTCTAGTCCA...GTCCTGAAAAAGCCTGGTGAAACTCTCAGTTTGTCCTGTAAGA
TATCTGGATACACATTT............GACAGCCACCACACACACTGGATACGACAGCCAGCAGGAAAATCTCTGGA
GTGGATGGGTTATTCTGGACTA............GGCCTAGGTTACCATGCTAAAAGGTTTGAA...GGACGTATGGAA
ACCACTAAAGCTACAAGCAACAGCATGTTGACTTTGAAGCTGTCTGGTCTGAGAGCAGAGGACTCTGCTGTGTATTACT
GTGCACGG
>AF273401|IGHV2S2*01_Salsal|(F)|V-REGION
GGTCAGAGTCTGGAGGTCATTCCCTCCAGTCCA...GTCCAGAAAAAGCCTGGAGAAACTCTCAGTCTGTCCTGTAAGA
TATCTGGATATACCGTT............ACCAGCCACCACACACACTGGATACGACAGCCAGCAGGAAAATCCCTGGA
GTGGATGGGTTTTTCTGGATTA............GGCCTAGGTTACCATGCTAAAAAGTTTGAA...GGACGTATGGAA
ACCACTAAAGATACTAGAAACAGCATGTTGACTTTGATGCTGTCTGGTGTGAGAGCAGAGGACTCTGCTGTGTATTACT
GTGCAAGA
>AF269073|IGHV2S2*02_Salsal|(F)|V-REGION
GGTCAGAGTCTGGAGGTCATTCCCTCCAGTCCA...GTCCAGAAAAAGCCTGGAGAAACTCTCAGTCTGTCCTGTAAGA
TATCTGGATATACCGTT............ACCAGCCACCACACACACTGGATACGACAGCCAGCAGGAAAATCCCTGGA
GTGGATGGGTTTTTCTGGATTA............GGCCTAGGTTACCATGCTAAAAAGTTTGAA...GGACGTATGGAA
ACCACTAAAGATACTAGAAACAGCATGTTGACTTTGATGCTGTCTGGTGTGAGAGTAGAGGACTCTGCTGTGTATTACT
GTGCAAGA
>AF269072|IGHV2S3*01_Salsal|(F)|V-REGION
GGTCAGAGTCTGGAGGCCATTCCCTCCAGTCCA...GTCCTGAAAAACCCTGGAGAACCTGTCAGCCTCTCCTGTAAGG
GATCTGGCTTTACCTTT............GGTAGCTACCATATGGGCTGGATAAGACAACCAGCAGGAAAAGCTCTAGA
ATGGATAGGCATTATATGGAATGAT......GCTAGTGGAACTGCATACGCAAAAAGTGTTGAA...GGGCGTATAGAA
GTCACCAGAGATAATTCTAACAGCATGGTGTATCTGAAGCTGTCTGGTCTGAGAGCAGAGGACTCTGCTGTGTATTACT
GTGCAAGA
>AF273404|IGHV3S1*01_Salsal|(F)|V-REGION
GGTCAAACAATGGAATCCATTCCCTCCAGTCCA...CTCCAGAAAAAGCCAGGAGAAACTCTCAACCTCTCGTGCAGAG
GAACTGGGTATACCTTT............ACAAGCTATGGTATGAACTGGATTCGCCAACCTACAGGGAAACCATTGGA
ATGGATGGGCTGGATCAACACCAAT......ACTGGAGCAGCAGGCTATGCCAAAACCCTGGAG...GGACGGATTGAA
CTGACCAAAGACAGCTCAGTGAGCATGACTCATCTGAAACTGTCTGGTCTGAAGGCAGAGGACTCTGCTGTGTATTACT
GTGCACGC
>AF273405|IGHV3S1*02_Salsal|(F)|V-REGION
GGTCAAACAATGGAATCCATTCCCTCCAGTCCA...CTCCAGAAAAAGCCAGGAGAAACTCTCAACCTCTCGTGCAGAG
GAACTGGGTATACCTTT............ACAAGCTATGGTATGAACTGGATTCGCCAACCTACAGGGAAACCATTGGA
ATGGATGGGCTGGATCAACACCAAT......ACTGGAGCAGCAGGCTATGCCAAAACCCTGGAG...GGACGGATTGAA
CTGACCAAAGACAGCTCAGTGAGCATGACTCATCTGAAACTGTCTGGTCTGAAGGCAGAGGACTCTACTGTGTATTACT
GTGCACGC
>AF273407|IGHV3S1*03_Salsal|(F)|V-REGION
GGTCAAACAATGGAATCCATTCCCTCCAGTCCA...CTCCAGAAAAAGCCAGGAGAAACTCTCAACCTCTCGTGCAGAG
GAACTGGGTATACCTTT............ACAAGCTATCCTATGAACTGGATTCGCCAACCTACAGGGAAACCATTGGA
ATGGATGGGCTGGATCAACACCAAT......ACTGGAGCAGCAGGCTATGCCAAAACCCTGGAG...GGACGGATTGAA
CTGACCAAAGACAGCTCAGTGAGCATGACTCATCTGAAACTGTCTGGTCTGAAGGCAGAGGACTCTGCTGTGTATTACT
GTGCACGC
>AF273408|IGHV3S1*04_Salsal|(F)|V-REGION
GGTCAAACAATGGAATCCATTCCCTCCAGTCCA...CTCCAGAAAAAGCCAGGAGAAACTCTCAACCTCTCGTGCAGAG
GAACTGGGTATACCTTT............ACAAGCTATGGTATGAACTGGATTCGCCAACCTACAGGGAAACCATTGGA
ATGGATGGGCTGGATCAACACCAAT......ACTGGAGCAGCAGGCTATGCCAAAACCCTGGAG...GGACGGATTGAA
CTGACCAAAGACAACTCAGTGAGCATGACTCATCTGAAACTGTCTGGTCTGAAGGCAGAGGACTCTGCTGTGTATTACT
GTGCACGG
>AF273409|IGHV3S1*05_Salsal|(F)|V-REGION
GGTCAAACAATGGAATCCATTCCCTCCAGTCCA...CTCCAGAAAAAGCCAGGAGAAACTCTCAAGGTCTCGTGCAGAG
GAACTGGGTATACCTTT............ACAAGTTATGGTATCAACTGGATTCGCCAACCTACAGGGAAACCATTGGA
ATGGATGGGCTGGATCAACACCAAT......ACTGGAGCAGCAGGCTATGTCAAAACCCTGGAG...GGACGGATTGAA
CTGACCAAAGACAGCTCAGTGAGCATGACTCATCTGAAACTGTCTGGTCTGAAGGCAGAGGACTCTGCTGTGTATTACT
GTGCACGC
>Y12452|IGHV5S1*01_Salsal|F|V-REGION
GGTCAGACACTGACTGAG......TCTGGACCA...GTGGTTAAAAAGCCTGGAGAATCCCACAAACTGACCTGTACAC
GCTCTGGCTTCACATTC............ACTAGCTATTATATGGGCTGGATCAGACAAGCTAAAGGGAAAGAGTTTGA
GTGGATTGGTCATATTCATGGT............GGTACCACTTACTACTCCCAGTCATTTCAG...GGTAGATTCACC
ATTTCCAGAGATGACTCCAGCAGTAAGCTGTACCTACAGATGAACAGCCTGAAGAGTGAGGACACAGCAGTGTATTACT
GTGCCCGGTACA
>Y12454|IGHV5S2*01_Salsal|P|V-REGION
GGTCAGACATTGACTGAG......TCTGGACCA...GTGGTTAAAAAGCCTGGAGAATCCCACCAACTGACCTGTACAG
TCTCTGGGTTCACATTC............AGTAGCTATGGGATGGGTTGGATCAGACAGGCTCCTGGGAAAGGACTGGA
GTGGATTGCTTATATTAGCACACAG......AGTAATCGAATCTCTTATTCCCAGTCAGTCCAG...GGTAGATTCACC
ATCTCCAGAGACGACTCTAGCAGTAAACTGTACTTACAGCTGAACAGCCTGAAGAGTGAGGACACAGCAGTGTATTATT
GTGCATGAGAGT
>Y12455|IGHV5S4*01_Salsal|P|V-REGION
GGCCAGACACTGACTGAG......ACTGGACCA...GTGGTTAAAAAGCCTGGAGAATCCCACAAACAGACCTGTACAG
CCTCTGGGTTCACATTC............AGTAGCTATGAGATGAACTGGATCAGACAGGCCCCTGGGAAAGGACTGGA
GTAGGTTGCTTTTATTAGCACAGCT......AGTACTCCCATCTCTTACTCACAGTCAGTCCAG...GGTAGATTCACC
ATCTCCAGAGATGACTCAAGCAGTAAGCTGTACCTACAGATGAACAGTCTGAAGAATGAGGACACAGCAGTGTATTACT
GTGCTAGAGAGT
>AF273412|IGHV5S5*01_Salsal|(F)|V-REGION
GGTCAGACATTGACTGAG......TCTGGACCA...GTGGTTAAAAAGCCTGGAGAATCCCACCAACTGACCTGTACAG
CCTCTGGGTTCACATTC............AGTAGCTATGGGATGGGTTGGATCAGACAGGCTCCTGGGAAAGGACTGGA
GTGGATTGCTTATATAGACACAGCT......AGTACTCCCATCTCCTACTCCAAGTCAGTCCAG...GGTAGATTTACC
ATCTCCAGAGACGACTCTAGCAGTAAACTGTACTTACAGATGAACAGCCTGAAGAGTGAGGACACAGCAGTGTATTATT
GTGCTAGAGAT
>AF273410|IGHV5S6*01_Salsal|(F)|V-REGION
GGTCAGACACTGACTGAG......TCTGGACCA...GTAGTTAAAAAGCCTGGAGAATCCCACAAACTGACCTGTACAG
CCTCTGGGTTCACATTC............AGTATCTACTACATGGCTTGGATCAGACAGGCTCCTGGGAAAGGACTGGA
GTTGGTTGCTTATATAGGCACATCT......AGTAGTCCAATCTCTTACTCCCAGTCAGTCCAG...GGTAGATTCACC
ATCTCCAGAGATGACTCCAGCAGTAAGCTGTACCTACAGATGAACAGCCTGAAGAGTGAGGACACAGCAGTGTATTACT
GTGCTAGAGAG
>AF269078|IGHV5S7*01_Salsal|(F)|V-REGION
...CAGACATTGACTGAG......TCTGGACCA...GTAGTTAAAAAGCCTGGAGAATCCCACCAACTGACCTGTACAG
CCTGTGGGTTCACATTC............AGTAGCTACTACATGGCTTGGATTAGACAGGCTCCTGGGAAAGGACTGGA
GTGGGTTGCTTATATAGGCACATCT......AGCAGTCCAATCTCTTACTCCCAGTCAGTCCAG...GGTAGATTCACT
ATCTCCAGAGATGACTCCAGCAGTAAGTTGTACCTACAGATCAACAGTTTGAAGAGTGAAGACACAGCAGTGTATTACT
GTGCTAGAGAG
>AF269069|IGHV5S8*01_Salsal|(F)|V-REGION
..................................................................CTGTCCTGTAAAG
TTTCTGGGTTCACATTC............AGTAGCTATGGAATGAACTGGATCAGACAGGCTCCTGGGAAAGGACTGGA
GTGGATTGCTTATAGCCATAGT............ACTACTGTTTACTACTCCCAGTCAGTCCAG...GGTAGATTCACC
ATCTCCAGAGATGACTCCAGCAGTAAGCTGTACCTACAGATGAACAGCCTGAAGAGTGAGGACACAGCAGTGTATTACT
GTGGCCGGTCC
>AF273413|IGHV5S9*01_Salsal|(F)|V-REGION
AGTCAGACATTGACTGAG......TCTGGACCA...GTGGTTAAAAAGCCTGGAGAATCCCACCAACTGACCTGTACAG
CCTCTGGGTTCACATTC............AGTAGCTACTGGATGGCTTGGATCAGACAGGCTCCTGGGAAAGGACCGGA
ATGGATTGCTTCTAGTTATAGT............ACTACTACATATTACTCCCAGTCAGTCCAG...GGTAGATTTACC
ATCTCCAGAGATGACTCCAGCAGCAAGCTGTACCTACAGATGAGCAGCCTGAAGAGTGAGGACACAGCAGTGTATTACT
GTGCTAGAGAG
>AF273417|IGHV5S9*02_Salsal|(F)|V-REGION
AGTCAGACATTGACTGAG......TCTGGACCA...GTGGTTAAAAAGCCTGGAGAATCCCACCAACTGACCTGTACAG
CCTCTGGGTTCACATTC............AGTAGTTACTGGATGGCTTGGATCAGACAGGCTCCTGGGAAAGGACCGGA
ATGGATTGCTTCTAGTTATAGT............ACTACTACATATTACTCCCAGTCAGTCCAG...GGTAGATTTACC
ATCTCCAGAGATGACTCCAGCAGCAAGCTGTACCTACAGATGAGCAGCCTGAAGAGTGAGGACACAGCAGTGTATTACT
GTGCTTGTTTA
>AF273416|IGHV5S9*03_Salsal|(F)|V-REGION
AGTCAGACATTGACTGAG......TCTGGACCA...GTGGTTAAAAAGCCTGGACAATCCCACCAACTGACCTGTACAG
CCTCTGGGTTCACATTC............AGTAGCTACTGGATGGCTTGGATCAGACAGGCTCCTGGGAAAGGACCGGA
ATGGATTGCTTCTAGTTATAGT............ACTACTACATATTACTCCCAGTCAGTCCAG...GGTAGATTTACC
ATCTCCAGAGATGACTCCAGCAGCAAGCTGTACCTACAGATGAGCAGCCTGAAGAGTGAGGACACAGCAGTGTATTACT
GTGCTAGAGTA
>AF273411|IGHV5S9*04_Salsal|(F)|V-REGION
AGTCAGACATTGACTGAG......TCTGGACCA...GTGGTTAAAAAGCCTGGAGAATCCCACCAACTGACCTGTACAG
CCTCTGGGTTCACATTC............AGTAGCTACTGGATGGCTTGGATCAGACAGGCTCCTGGGAAAGGACCGGA
ATGGATTGCTTCTAGTTATAGT............ACTACTACATATTACTCCCAGTCAGTCCAG...GGTAGATTTACC
ATCTCCAGAGATGACTCCAGCAGCAAACTATACCTACAGATGAGCAGCCTGAAGAGTGAGGACACAGCAGTGTATTACT
GTGCTAGAGGG
>AF273414|IGHV5S9*05_Salsal|(F)|V-REGION
AGTCAGACATTGACTGAG......TCTGGACCA...GTGATTAAAAAGCCTGGAGAATCCCACCAACTGACCTGTACAG
CCTCTGGGTTCACATTC............AGTAACTACTGGATGGCTTGGATCAGACAGGCTCCTGGGAAAGGACCGGA
ATGGATTGCTTCTAGTTATAGT............ACTACTACATATTACTCCCAGTCAGTCCAG...GGTAGATTTACC
ATCTCCAGAGATGACTCCAGCAGCAAGCTGTACCTACAGATGAGCAGCCTGAAGAGTGAGGACACAGCAGTGTATTACT
GTGCTAGAGAG
>AF269077|IGHV5S9*06_Salsal|(F)|V-REGION
.....................................................................ACCTGTAAAG
TCTCTGGGTTCACATTC............AGTAGCTACTGGATGGCTTGGATCAGACAGGCTCCTGGGAAAGGACCGGA
ATGGATTGCTTCTAGTTATAGT............ACTACTACATATTACTCCCAGTCAGTCCAG...GGTAGATTTACC
ATCTCCAGAGATGACTCCAGCAGCAAGCTGTACCTACAGATGAGCAGCCTGAAGAGTGAGGACACAGCAGTGTATTACT
GTGCTAGAGAG
>AF269070|IGHV5S9*07_Salsal|(F)|V-REGION
..................................................................CTGTCCTGTACAG
TTTCTGGGTTCACATTC............AGTAGCTACTGGATGGCTTGGATCAGACAGGCTCCTGGGAAAGGACCGGA
ATGGATTGCTTCTAGTTATAGT............ACTACTACATATTACTCCCAGTCAGTCCAG...GGTAGATTTACC
ATCTCCAGAGATGACTCCAGCAGTAAGCTATACCTACAGATGAACAGCCTGAAGAGTGAGGACACAGCAGTGTATTACT
GTGCTAGAGAG
>AF269076|IGHV5S10*01_Salsal|(F)|V-REGION
GGTCAGACACTGACTGAG......TCTGGACCA...GTAGTTAAAAAGCCTGGAGAATCCCACAAACTGACCTGTACAG
CCTCTGGGTTCACATTC............AGTAGCTATGAGATGAGCTGGATCAGACAGGCTCCTGGGAAAGGACTGGA
GTGGATTGCTTATAGTTATAGT............ACTAATACATATTACTCACAGTCAGTCCAG...GGTAGATTTACC
ATCTCCAGAGATGACTCCAGCAGTAAGCTATACCTACAGATGAACAGCCTGAAGAGTGAGGACACAGCAGTGTATTACT
GTGCTAGAGAC
>AF269071|IGHV5S10*02_Salsal|(F)|V-REGION
GGTCAGACACTGACTGAG......TCTGGACCA...GTAGTTAAAAAGTCTGGAGAATCCCACAAACTGACCTGTACAG
CCTCTGGGTTCACATTC............AGTAGCTATGAGATGAGCTGGATCAGACAGGCTCCTGGGAAAGGACTGGA
GTGGATTGCTTATAGTTATAGT............ACTAATACATATTACTCACAGTCAGCCCAG...GGTAGATTTATC
ATCTCCAGAGATGACTCCAGCAGTAAGCTATACCTACAGATGAACAGCCTGAAGAGTGAGGACACAGCAGTGTATTACT
GCTGGGGGCAA
>AF269075|IGHV5S10*03_Salsal|(F)|V-REGION
..................................................................CTGTCCTGTAAAG
CTTCTGGGTTCACATTC............AGTAGCTATGAGATGAGCTGGATCAGACAGGCTCCTGGGAAAGGACTGGA
GTGGATTGCTTATAGTTATAGT............ACTAATACATATTACTCACAGTCAGTCCAG...GGTAGATTCACC
ATCTCCAGAGATGACTCCAGCAGTAAGCTATACCTACAGATGAACAGCCTGAAGAGTGAGGACACAGCAGTGTATTACT
GTGCTAGAGGG
>AF273419|IGHV6S1*01_Salsal|(F)|V-REGION
...TATGAACTCACTCAG......CCAGCCTCT...ATGACTGTCCAGCCAGGTCAACCACTGACCATCTCCTGTAAGG
TCTCATATTCAGTTACT...............AGCTTACATACAGCTTGGATTCGACAACCTGCAGGGAAAACACTGGA
GTGGATTGGATATATCCATAGTGGT.........GGAAGCATGTATTATAAAGATAGTCTGAAG...AACAAGTTCAGC
ATCACCAGAGAGACTTCCAGCAACACGTTGTTTTTAAAAGGACAGAGTCTGCAGACTGAAGACACAGCTGTGTATTATT
GTGCTCGC
>AF273420|IGHV6S1*02_Salsal|(F)|V-REGION
...TATGAACTCACTCAG......CCAGCCTCT...ATGACTGTCCAGCCAGGTCAACCACTGACCATCTCCTGTAAGG
TCTCATATTCAGTTACT...............AGCTTACATACAGCTTGGATTCGACAACCTGCAGGGAAAACACTGGA
GTGGATTGGATATATCCATAGTGGT.........GGAAGCATGTATTATAAAGATAGTCTGAAG...AACAAGTTCAGC
ATCACCAGAGAGACTTCCAGCAACACGTTGTTTTTAAAAGGACAGAGTCTGCAGACTGAAGACACAGCTGTGTATTACT
GTGCTCGT
>AF273421|IGHV6S1*03_Salsal|(F)|V-REGION
...TATGAACTCACTCAG......CCAGCCTCT...ATGACTGTCCAGCCAGGTCAACCACTGACCATCTCCTGTAAGG
TCTCATATTCAGTTACT...............AGCTTACATACAGCTTGGATTCGACAACCTGCAGGGAAAACACTGGA
GTGGTTTGGATATATCCATAGTGGT.........GGAAGCATGTATTATAAAGATAGTCTGAAG...AACAAGTTCAGC
ATCACCAGAGAGACTTCCAGCAACACGTTGTTTTTAAAAGGACAGAGTCTGCAGACTGAAGACACAGCTGTGTATTACT
GTGCTCGC
>AF273422|IGHV6S1*04_Salsal|(F)|V-REGION
...TATGAACTCACTCAG......CCAGCCTCT...ATGACTGTCCAGCCAGGTCAACCACTGACCATCTCCTGTAAGG
TCTCATATTCAGTTACT...............AGCTTACATACAGCTTGGATTCGACAACCTGCAGGAAAAACACTGGA
GTGGATTGGATATATCCATAGTGGT......GGAAGCATGTATTATAAAGATAGTCTGAAGAAC...AAGTTCAGCATC

>AF273426|IGHV6S2*01_Salsal|(F)|V-REGION
...TATGAACTCACTCAG......CCAGCCTCT...ATGACTGTCCAGCCAGGTCAACCACTGACCATCTCCTGTAAGG
TCTCGTATTCAGTTACT...............AGCTTGTATACAGCTTGGATTCGACAGCCTGCAGGGAAAACACTGGA
GTGGATTGGATATATTAGTAGTGGT.........GGAAGCACAGCTTATAAAGATTCACTGAAA...AACAAGTTCAGC
ATCACCAGAGACACTTCCAGCAACACAGTGTTTTTAAAAGGACAGAGTCTGCAGACTGAAGACACAGCTGTGTATTATT
GTGCTCGG
>AF273425|IGHV6S3*01_Salsal|(F)|V-REGION
...GAAGAACTCACTCAG......CCAGCCTTT...ATGACTGTCCAGTCAGGTCAACTACTGACCATCTCCTGTAAGG
TCTCATATTCTGTTACT...............AGTGTTGCTACATTCTGGATTCGACAGCCTGCAGGGAAAACATTGGA
GTGGATTGGATATATTAATAGTGGT.........GGAAGCACAGCTTATAAAGATTCACTGAAA...AACAAGTTCAGC
ATCACCAGAGACACTTCCAGCAACACATTGTTTTTAAAAGGACAGAGTCTGCAGACTGAAGACACAGCTGTGTATTATT
GTGCTCGC
>AF273429|IGHV6S4*01_Salsal|(F)|V-REGION
...GAAGAACTCACTCAA......CCAGCCTCT...ATGACTGTCCAGCCAGGTCAACCACTGACCATCTCCTGTAAGG
TCTCATATTCTGTAGGT...............AGCTATTACACAGCTTGGATTCGACAGCCTGCAGGGAAAGGACTGGA
GTGGATTGGAATGAAATATACT............GGAGGAACACACCACAAAGACTCCCTGAAA...AATAAGTTCAGC
CTCACTTTAGACTCCTCCAGCAATACTGTGACTTTAACAGGGCAGAACCTGCAGGCTGAAGACACAGCTGTGTATTATT
GTGCCAGA
>AF273432|IGHV6S5*01_Salsal|(F)|V-REGION
...TATGAACTCTCTCAG......CCAACATCT...ATGACTGTCCAGCCAGGTCAACCGCTGACCATCTCCTGTAAGG
TCTCATATTCAGTTACT...............GACACTTGGACATCTTGGATCCGACAGCCTGCAGGGAAAGCACTGGA
GTGGATTGGAAATGTATATTCT............GGAGACACAAAATACAAGGATTCTCTAAAG...AACAAGTTCAGC
CTGTCAGTAGACTCTAGCAGTAATACTGTGTTTTTAAAAGGGCAGAACCTTCAGACTGAAGACACAGCTGTGTATTATT
GTGCCTAC
>AF269085|IGHV6S5*02_Salsal|(F)|V-REGION
...TATGAACTCTCTCAG......CCAACATCT...ATGACTGTCCAGCCAGGTCAACCACTGACCATCTCCTGTAAGG
TCTCATATTCAGTTACT...............AACACTTGGACATCTTGGATCCGACAGCCTGCAGGGAAAGCACTGGA
GTGGATTGGAAATGTATATTCT............GGAGACACAAAATACAAGGATTCTCTAAAG...AACAAGTTCAGC
CTGTCAGTAGACTCAAGCAGTAATACTGTGTTTTTAAAAGGGCAGAACCTTCAGACTGAAGACACAGCTGTGTATTATT
GTGCCTTA
>AF273433|IGHV7S1*01_Salsal|(F)|V-REGION
GGACTTGAGTTCACCCAA......CCAAGCTCA...TTGGATGTAAAGCCTGGAGAGTCTTTGAGCATCACCTGTAAAG
TCTCTGGTTATTCTCTGACTGATAGCACCAACCTCCATGGAATAGGCTGGATCCGACATCCTACAGGAAAAGCACTTGA
ATGGATTTGGACCATCTATTATGAT.........GGAAGCTCAAACTCTCAAAGTTCCCTAAAA...GACAGGTTCAGT
TTCACAAGAGACACTTCCAGCAACACAGTGTTTTTAAAAGGACAGAGTCTGCAGACTGAAGACACAGCTGTGTATTACT
GTGCTCGG
>AF273435|IGHV8S1*01_Salsal|(F)|V-REGION
CAGGTCGTACTCACACAG......GCTGAACAGTCAGTCCAGGGGACCCCTGCAGGATCCCTCAAACTCACATGTGCCT
GTAGTGGATTCACTCTA............AGCAGCACTAATATGTACTGGATCCGCCAAGCAACTGGAAAAGGACTTGA
ATGGATCATTTACTATTATTCTGAA.........GGTAGCAAGAGCAATGCCCAAGTAGTACAG...GGCAGATTCACA
GCGTCGAAGGAT......AGCTCTAACTTCTATCTGCACATGAACCTGTTGAAGTCAGAGGACTCTGCAGTGTATTACT
GTGCTAGA
>AF273434|IGHV8S2*01_Salsal|(F)|V-REGION
CAGGTCGTACTCACACAG......GCTGAACAGTCAGTCCAGGGGACCCCTGGGGGATCCCTCAAACTCACATGTGCCT
GTAGTGGAATCACTCTA............AGCAGCAGTTATATGCACTGGTTCCGTCAGGCACCTGGAAAAGGACTTGA
ATGGATAATTTACTATTATTCTGAC.........AGTAACAAGAGCAATGCCCAGGTAGTACAG...GGCAGATTCACA
GCATCGAAGGAC......AGCTCTAATTTCTATCTGCACATGAGCCAGTTGAAGTCAGAGGACTCTGCAGTGTATTACT
GTGCTAGA
>AF273436|IGHV9S1*01_Salsal|(F)|V-REGION
GGACAGTCACTCACCTCC......TCTGAGCCA...GTGGTGAAGAAACCTGGAGAGTCAGTAACACTGTCATGTACTG
TGTCTGGATTCTCCATG............GGTAGCTACAACATGCACTGGATCCGTCAGAAACCAGGGAAAGGTCTAGA
GTGGATTGGGCGTATTGACACTGGC.........ACTGGCACTATATTTGCCCAGTCCCTCCAG...GGCCAGTTCACC
ATCACCAAAGACAACTCTAAAAACCAGCTGTACTTAGAGGTGAAAAGCCTGAAGACTGAAGACTCTGCTGTTTATTATT
GTGCCAGA
>AF269086|IGHV11S1*01_Salsal|(F)|V-REGION
..............................GCT...CAACTCAAACCTCCTGGAGATTCAGTGAAACTCTCTTGCCAAA
TCTCTGGCTATGCCCTG............ACAGACTATGGTACAGTTTGGATACGACATGAGCCAGGGAAAACACTGGA
GTGGATTGGGATCATCTGGGGTGGT.........GGATCCATCAACTCTGGAGCCTCTTTTAAG...AGCAGATTCACC
ATCTCCAGAGAC...AGTAGTAATGTACTGTACTTAGACATCACCAGTCTGCAGGCTGAGGACACAGCTGTGTATTATT
GTGCAAAA
>AF094531|IGHV1S1*01_Treber|(F)|V-REGION
GGTCAGACACTGACAGAA......TCTGAACCA...GTGACTAAAAGGCCTGGAGAATCTCACAGATTGACCTGTACAG
CCTCTGGATTCACATTC............AGTAGCTACTGGATGGCCTGGGTCAGACAGGCTCCTGGGAAAGGACTGGA
GTGGGTTGCGAGTATGTATAACAGT.........GACAACATCTTCTACTCTGAGTCAGTGAAA...GGCCGGTTCTCC
ATCTCCAGAGACGACAACAGACAGCAGGTGTCTCTGCAGATGAGCAGTTTGACGGCTGTAGACTCTGCTGTTTATTACT
GTGCTCGG
>AF303538|IGHV1S2*01_Treber|(F)|V-REGION
GGTCAGACTCTGACAGAA......TCTGATTCA...GTGACTAAAAGGCCTGGAGAATCTCACAGATTGACCTGTACAG
CCTCTGGATTCACATTC............AGTAGCTCTACATTGGCCTGGGTCAGACAGGCTCCTGGGAAAGGACTGGA
GTGGGTGCTTGATCACCTGATGGCA......GTAGCAGCATCTACTACCTTGAAGTCAAGTGAA...GGCCGGTTCACC
ATCTCCAGAGACAACAACAGACAGCAGGTGTCTCTGCAGATGAACAGTCTGACGGCTGTAGACTCTGCTGTTTATTACT
GTGCTCGA
>AF303558|IGHV1S3*01_Treber|(F)|V-REGION
...........................................AAAGGCCTGGAGAATCTCACAGATTGACCTGTACGG
CCTCTGGATTCACATTC............AGTAGCTACTACATGGCCTGGGTCAGACAGGCTCCTGGGAAAGGACTGGA
GTGGGTCGCTTTGATCCACCTGATGGCA...GTAGCAGCATCTACTACTCTGAGGTCAGTGGAA...GGGCGGTTCACC
ATCTCCAGAGACAACAACAGACAGCAGGTGTCTCTGCAGATGAACAGTCTGACGGCTGTAGACTCTGCTGTTTATTACT
GTGCACGA
>AF303540|IGHV1S4*01_Treber|(F)|V-REGION
GGTCAGACTCTGACAGAA......TCTGAACCA...GTGACTAAAAGGCCTGGAGAATCTCACAGATTGACCTGTACAG
CCTCTGGATTCACATTC............AGTAGCCACTGGATGGCCTGGGTCAGACAGGCTCCTGGAAAAGGACTGGA
GTGGATCCGTTTGATCCACCCTACTAGCAGCAGTAGCAGCATCTACTACTCTGAGTCAGTGAAA...GGCCGGTTCACC
ATCTCCAGAGACAACAACATACAGCAGCTGTATCTGCAGATGAGCAGTCTGACGGCTGTAGACTCTGCTGTTTATTACT
GTGCTCGA
>AF303555|IGHV1S5*01_Treber|(F)|V-REGION
GGTCAGACTCTGACAGAA......TCTGATTCA...GTGACTAAAAGGCCTGGAGAATCTCACAGATTGACCTGTACAG
CCTCTGGATTCACATTC............AGTAGCTACTACATGCACTGGATCAGACAGGCTCCTGGGAAAGGACTGGA
GTGGATCGCTTATATCAGCAATGGCGGT...GGTGGCACCCAGTACTACTCTGAGTCAGTGAAA...GGCCGGTTCACA
ATCTCCAGAGACAACAGCAGACAGCAGGTGTATCTGCAGATGAACAGTCTGAAGGCCGAGGACACAGCAGTGTATTACT
GTGCCAGA
>AF303565|IGHV1S6*01_Treber|(F)|V-REGION
GGTCAGACTCTGACAGAA......TCTGATTCA...GTGACTAAAAGGCCTGGAGAATCTCACAGATTGACCTGTACAG
CCTCTGGATTCACATTC............AGTACCTACTGGATGGCCTGGGTCAGACAGGCTCCTGGGAAAGGACTGGA
GTGGATCGCTTTTATCCACCCTTCTAGCAGCAGTGCCCACATCTATTACTCTGAGTCAGTGAAA...GGCCGGTTCACC
ATCTCCAGAGACAACAGCAGACAGCAGCTGTATCTACAGATGAGCAGTGTGACGGCTGTAGACTCTGCTGTTTATTACT
GTGCTCGA
>AF303563|IGHV1S7*01_Treber|(F)|V-REGION
GGTCAGACTCTGACAGAA......TCTGATTCA...GTGACTAAAAGGCCTGGAGAACCTCACAGATTGACCTGTACAG
CCTCTGGATTCACATTC............AGTGACTACAGGATGAACTGGGTCAGACAGGCTCCTGGGAAAGGACTGGA
GTGGATCGCTTTTATCCACCCTACTAGC...AGTAGCAGCATCTACTACTCTGAGTCAGTGAAA...GGCCGGTTCACC
ATCTCCAGAGACAACAACAGACAGCAGGTGTATCTGCAGATGAACAGTCTGACGGCTGTAGACTCTGCTGTTTATTACT
GTGCTCGA
>AF303550|IGHV1S8*01_Treber|(F)|V-REGION
GGTCAGACTCTGACAGAA......TCTGAACCA...GTGACTAAAAGGCCTGGAGAATCTCACATGTTGACCTGTACAG
CCTCTGGATTCACATTC............AGTAGCTACGAGATTAACTGGGTCAGACAGGCTCCTGGGAAAGGACTGGA
GTGGATCGCTATTATCAGCAGTGGCAGT...GGTAGCACCAAGTACTACTCTGATTCAGTGAAA...GGCCGGTTCTCC
ATCTCCAGAGACAACAACAGACAGCAGCTGTATCTGCAGATGAGCAGTCTGACGGCTGTAGACTCTGCTGTTTATTACT
GTGCTCGA
>AF303566|IGHV1S8*02_Treber|(F)|V-REGION
GGTCAGACTCTGACAGAA......TCTGAACCA...GTGACTAAAAGGCCTGGAGAATCTCACATGTTGACCTGTACAG
CCTCTGGATTCACATTC............AGTAGCTACGAGATTAACTGGGTCAGACAGGCTCCTGGGAAAGGACTGGA
GTGGATCGCTATTATCAGCAGTGGCAGT...GGTAGCACCAAGTACTACTCTGATTCAGTGAAA...GGCCGGTTCTCC
ATCTCCAGAGACAACAACAGACAGCAGCTGTATCTGCAGATGAGCAGTCTGACGGCTGGAGACTCTGCTGTGTATTACT
GTGCTCGA
>AF303561|IGHV1S9*01_Treber|(F)|V-REGION
GGTCAGACTCTGACAGAA......TCTGAACCA...GTGACTAAAAGGCCTGGAGAATCTCACAGATTGACCTGTACAG
CCTCTGGATTCACATTC............AGTAGCCACTGGATGGCCTGGGTCAGACAGGCTCCTGGAAAAGGACTGGA
GTGGATCGCTTTGATCCACCCTACTAGCAGCAATAGCAGCATCTACTACTCTGAGTCAGTGAAA...GGCCGGTTCACC
ATCTCCAGAGACAACAACATACAGCAGCTGTATCTGCAGATGAGCAGTCTGACGGCTGTAGACTCTGCTGTTTATTACT
GTGCTCGA
>AF303564|IGHV1S10*01_Treber|(F)|V-REGION
GGTCAGACTCTGACAGAA......TCTGAACCA...GTGACTAAAAGGCCTGGAGAATCTCACAGATTGACCTGTACAG
CCTCTGGATTCACATTC............AGTAGCCACTGGATGGCCTGGGTCAGACAGGCTCCTGGAAAAGGACTGGA
GTGGGTTGCTACTATCAGTGATAGC......AGTAGCAGCATCTACTACTCTGAGTCAGTGAAA...GGCCGGTTCACC
ATCTCCAGAGACAACAACATACAGCAGCTGTATCTGCAGATGAGCAGTCTGACGGCTGTAGACTCTGCTGTTTATTACT
GTGCTCGA
>AF303562|IGHV1S11*01_Treber|(F)|V-REGION
GGTCAGACTCTGACAGAA......TCTGAACCA...GTGACTAAAAGGCCTGGAGAATCTCACAGATTGACCTGTACAG
GCTCTGGATTCACATTC............AGTAGCCACTGGATGGCCTGGGTCAGACAGGCTCCTGGGAAAGGACTGGA
GTGGATCGCTTTGATCCACCCTACTAGC...AGTAGCTACATCTACTACTCTGAGTCAGTGAAA...GGCCGGTTCACC
ATCTCCAGAGACAACAGCAGACAGCAGGTGTCTCTGCAGATGAGCAGTCTGACGGCTGTAGACTCTGCTGTTTATTACT
GTGCTCGA
>AF303569|IGHV1S12*01_Treber|(F)|V-REGION
GGTCAGACTCTGACAGAA......TCTGAACCA...GTGACTAAAAGGCCTGGAGAATCTCACAGATTGACCTGTACAG
CCTCTGGATTCACATTA............AGTAGCTACTGGATGGCCTGGGTCAGACAGGCTCCTGGGAAAGGACTGGA
GTGGATCGCTTTGATCCACCCTACTAGC...AGTAGCAGCAGCTACTACTCTGAGTCAGTGAAA...GGCCGGTTCACC
ATCTCCAGAGACAACAACAGACAGCAGGTGTATCTGCAGATGAACAGTCTGACGGCTGTAGACTCTGCTGTTTATTACT
GTGCTCGA
>AF303557|IGHV1S12*02_Treber|(F)|V-REGION
GGTCAGACTCTGACAGAA......TCTGAACCA...GTGACTAAAAGGCCTGGAGAATCTCACAGATTGACCTGTACTG
CCTCTGGATTCACATTA............AGTAGCTACTGGATGGCCTGGGTCAGACAGGCTCCTGGGAAAGGACTGGA
GTGGAATCGCTTGATCCACCCTACTAGC...AGTAGCAGCAGCTACTACTCTGAGTCAGTGAAA...GGCCGGTTCACC
ATCTCCAGAGACAACAACAGACAGCAGCTGTATCTGCAGATGAACAGTCTGACGGCTGTAGACTCTGCTGTTTATTACT
GTGCTCGA
>AF303573|IGHV1S12*03_Treber|(F)|V-REGION
GGTCAGACTCTGACAGAA......TCTGAACCA...GTGACTAAAAGGCCTGGAGAATCTCACAGATTGACCTGTACAG
CCTCTGGATTCACATTA............AGTAGCTACTGGATGGCCTGGGTCAGACAGGCTCCTGGGAAAGGACTGGA
GTGGATCGCTTTGATCCACCCTACTAGC...AGTAGCAGCAGCTACTACTCTGAGTCAGTGAAA...GGCCGGTTCACC
ATCTCCAGAGACAACAACAGACAGCAGCTGTATCTGCAGATGAACAGTCTGACGGCTGTAGACTCTGCTGTTTATTACT
GTGCTCGA
>AF303567|IGHV1S12*04_Treber|(F)|V-REGION
...............................................................................
...........................................................GCTCCCGGGAAAGGACTGGA
GTGGATCGCTTTGATCCACCCTACTAGC...AGTAGCAGCAGCTACTACTCTGAGTCAGTGAAA...GGCCGGTTCACC
ATCTCCAGAGACAACAGCAGACAGCAGCTGTATCTGCAGATGAACAGTCTGACGGCTGTAGACTCTGCTGTTTATTACT
GTGCTCGA
>AF303568|IGHV1S12*05_Treber|(F)|V-REGION
...............................................................................
...........................................................GCTCCTGGGAAAGGACTGGA
GTGGATCGCTTTGATCCACCCTACTAGC...AGTAGCAGCAGCTACTACTCTGAGTCAGTGAAA...GGCCGGTTCACC
ATCTCCAGAGACAACAGCAGACAGCAGCTGTATCTGCAGATGAACAGTCTGACGGCTGTAGACTCTGCTGTTTATTACT
GTGCTCGA
>AF303541|IGHV1S13*01_Treber|(F)|V-REGION
GGTCAGACTCTGACAGAA......TCTGAACCA...GTGACTAAAAGGCCTGGAGAATCTCACAGATTGACCTGTACTA
CTTCTGGATTCACATTC............AGTAGCTACTGGATGGCCTGGGTCAGACAGGCTCCTGGGAAAGGACTGGA
GTGGATCCGTTTGATCCACCCTACTACC...AGTAGCAGCATCTACTACTCTGAGTCAGTGAAA...GGCCGGTTCACC
GGCTCCAAC...AACAACATACAGCAGGTGTATCTGCAGATGAACAGTCTGACGGCTGTAGACTCTGCTGTTTATTACT
GTGCTCGA
>AF303574|IGHV1S13*02_Treber|(F)|V-REGION
............ACAGAA......TCTGAACCA...GTGACTAAAAGGCCTGGAGAATCTCACAGATTGACCTGTACTA
CTTCTGGATTCACATTC............AGTAGCTACTGGATGGCCTGGGTCAGACAGGCTCCTGGGAAAGGACTGGA
GTGGATCGCTTTGATCCACCCTACTACC...AGTAGCAGCATCTACTACTCTGAGTCAGTGAAA...GGCCGGTTCACC
GGCTCCAGC...AACAACATACAGCAGGTGTATCTGCAGATGAACAGTCTGACGGCTGTAGACTCTGCTGTTTATTACT
GTGCTCGA
>AF303542|IGHV1S13*03_Treber|(F)|V-REGION
GGTCAGACTCTGACAGAA......TCTGAACCA...GTGACTAAAAGGCCTGGAGAATCTCACAGATTGACCTGTACTA
CTTCTGGATACACATTC............AGTAGCTACTGGATGGCCTGGGTCAGACAGGCTCCTGGGAAAGGACTGGA
GTGGATCGCTTTGATCCACCCTACTGGC...AGTAGCAGCAGCTACTACTCTGAGTCAGTGAAA...GGCCGGTTCACC
GGCTCCAGC...AACAACATACAGCAGGTGTATCTGCAGATGAACAGTCTGACGGCTGTAGACTCTGCTGTTTATTACT
GTGCTCGA
>AF303552|IGHV1S14*01_Treber|(F)|V-REGION
...........................GAACCA...GTGACTAAAAGGCCGGGAGAATCTCACAGATTGACCTGTACTA
CTTCTGGATTCACATTC...............AACCACTACATTGCCTGGATCAGACAGGCTCCTGGGAAAGGACTGGA
GTGGATCGCTTTGATCCACCCTACT......AGCAGGGCCAACATCTTCTACTCTGAGTCAGTG...AAAGGCCGGTTC
ATCGGCTCCAGCAACAACATACAGCAGGTGTATCTGCAGATGAACAGTCTGACGGCTGTAGACTCTGCTGTTTATTACT
GTGCTCGA
>AF303544|IGHV1S15*01_Treber|(F)|V-REGION
GGTCAGACTCTGACAGAA......TCTGAACCA...GTGACTAAAAGGCCTGGAGAATCTCACAGATTGACCTGTACAG
GGTCTGGATTCACATTC............AGTAGCCACTGGATGAACTGGGTCAGACAGGCTCCTGGGAAAGGACTGGA
GTGGATCCGTTTGATCCACTATAGCAGT...AGCTACATCTACTACTCTGAGTCAGTGAAAGGC...CGGTTCACCATC
TCCAGAGACAACAACAACAGACAGCAGGTGTCTCTGCAGATGAACAGTCTGACGGCTGTAGACTCTGCTGTTTATTACT
GTGCTCGA
>AF303556|IGHV1S16*01_Treber|(F)|V-REGION
GGTCAGACTCTGACAGAA......TCTGATCCA...GTGACTAAAAGGCCTGGAGAATCTCACAGATTGACCTGTACAG
CCTCTGGATTCACATTC............ACTAGCTACTACATGGCCTGGGTCAGACAGGCTCCTGGGAAAGGACTGGA
GTGGGTGGCTACTATCACCAATGGT......GGTAGCACCCCGTACTACTCTGAGTCATTTAAA...GGCCGGTTCACC
ATCTCCAGAGACAACAACAGACAGCAGGTGTCTCTGCAGATGAACAGTCTGACGGCTGTAGACTCTGCTGTTTATTACT
GTGCTCGA
>AF303560|IGHV1S16*02_Treber|(F)|V-REGION
...........................................................................ACAG
CCTCTGGATTCACATTC............ACTAGCTACTACATGGCCTGGGTCAGACAGGCTCCTGGGAAAGGACTGGA
GTGGGTTGCTACTATCACCAATGGT......GGTAGCACCCCGTACTACTCTGAGTCATTTAAA...GGCCGGTTCACC
ATCTCCAGGGACAACAACAGACAGCAGGTGTCTCTGCAGATGAACAGTCTGACGGCTGTAGACTCTGCTGTTTATTACT
GTGCTCGA
>AF303553|IGHV1S17*01_Treber|(F)|V-REGION
..........................................AAAAGGCCTGGAGAATCTCACAGATTGACCTGTACAG
CCTCTGGATTCACATTC............ACTAGCTACAACATGGCCTGGGTCAGACAGGCTCCTGGAAAAGGACTGGA
GTGGGTTACTTATATCAACACTGGT.........AGCACCCCGTACTACTTTGAGTCATTTAAA...GGCCGGTTCACC
ATTTCCAGAGACAACAACAGACAGCAGGTGTCTCTGCAGATGAACAGTCTGACGGCTGTAGACTCTGCTGTTTATTACT
GTGCTCGG
>AF303548|IGHV1S18*01_Treber|(F)|V-REGION
............ACAGAA......TCTGAACCA...GTGACTAAAAGGCCTGGAGAATCTCACAGATTGACCTGTACAG
CCTCTGGATTCACATTC............AGTGACTACTACATGGCCTGGGTCAGACAGGCTCCTGGGAAAGGACTGGA
GTGGATCGCTTTGATCCACCCTACTACG...AGTACGTACATCTCATCATCTGAGTCGAGTGAA...GGCCGGTTCACC
ATCTCCAGAGACAACACGAGACAGCAGGTGTCTCTGCAGATGAACAGTCTGACGGCTGTAGACTCTGCTGTTTATTACT
GTGCTCGA
>AF303559|IGHV1S19*01_Treber|(F)|V-REGION
...............................................................................
.....ATTAAGTAG....................CTACTGGATGGCCTGGGTCAGACAGGCTCCTGGAAAAGGACTGGA
GTGGATCGCTTATAACGACAATGGC......GGTACCACCAAGTACTACTCTGAGTCAGTGAAA...GGCCGGTTCACC
ATCTCCAGAGACAACAGCAGACAGCAGCTGTATCTGCAGATGAGCAGTCTGACGGCTGTAGACTCTGCTGTTTATTACT
GTGCTCGA
>AF303547|IGHV1S20*01_Treber|(F)|V-REGION
...............................................................................
...............................................................................
.............ATGGTA................GCAAACAGTTCTACTCTGAGTCAGTGAAA...GGCCGGTTCACC
ATCTCCAGAGACAACAGCAGACAGCAGCTGTATCTGCAGATGAGCAGTCTGACGGCTGTAGACTCTGCTGTTTATTACT
GTGCTCGA
>AF303551|IGHV2S1*01_Treber|(F)|V-REGION
GGTCAGACTCTGACAGAA......TCTGATCCA...GTGACTAAAAGGCCCGGAGAATCTCACAGATTGACCTGTACAG
CCTCTGGATTCACATTC............AGTAGCTACGGCATGAACTGGATCAGACAGGCTCCTGGGAAAGGACTGGA
GTGGATCGCTTATATACATAGT............ACTTCTATCTATTACTCCCAGTCGGTCCAG...GGTAGATTCACT
ATCTCCAGAGATGACTCCAGCAGTAAAGTGTATCTGCAGATGAACAGTCTGGAGGCCGAGGACACAGCAGTGTATTACT
GTGCCAGA
>AF303572|IGHV2S2*01_Treber|(F)|V-REGION
GGTCAGACTCTGACAGAA......TCTGATCCA...GTGACTAAAAGGCCCGGAGAATCTCACAGATTGACCTGTACAG
CTAGTGGATTTACATTCAGT.........CCCTACAGAGATGAAGCATGGGTCAGACAGGCTCCTGGGAAAGGACTGGA
GTGGATCGCTTATATCAGCACAGCT......AGTAGTCCGATCTATTACTCCCAGTCGGTCCAG...GGTAGATTCACT
ATCTCCAGAGATGACTCCAGCAGTAAAGTGTATCTGCAGATGAACAGTCTGAAGGCCGAGGACACAGCAGTGTATTACT
GTGCCAGA
>AF303534|IGHV2S3*01_Treber|(F)|V-REGION
...................................................GGAGAATCTCACAGATTGACCTGTACAG
CCTCTGGATTCACATTC............AGTGACTACTACATGCACTGGATCAGACAGGCTCCTGGAAAAGGATTGGA
GTGGATCGCTATTATCGGCACAAGC......AGTTCTCCGATCCGTTACTCCCAGTCGGTCCAG...GGTAGATTCACT
ATCTCCAGAGATGACTCAGCAGTAAAAAAGTATCTGCAGATGAACAGTCTGAAGGCCGAGGACACAGCAGTGTATTACT
GTGCCAGA
>AF303539|IGHV2S4*01_Treber|(F)|V-REGION
...............................................................................
.........................................ATGAACTGGGTCAGACAGGCTCCTGGGAAAGGACTGGA
GTGGATCGCTTTTATACACACAGGC......AGTACTTCTACCTCTTACTCCCAGTCGGTCCAG...GGTAGATTCACT
ATCTCCAGAGATGACTCCAGCAGTAAAGTGTATCTGCAGATGAACAGTCTGAAGGCCGAGGACACAGCAGTGTATTACT
GTGCCAGA
>AF303554|IGHV2S4*02_Treber|(F)|V-REGION
...............................................................................
.........................................ATGAACTGGGTCAGACAGGCTCCTGGGAAAGGACTGGA
GTGGATCGCTTTTATACACACAGGC......AGTACTTCTACCTCTTACTCCCAGTCGGTCCAG...GGTAGATTCACT
ATCTCCAGAGATGACTCCAGCAGTAAAGTGTATCTGCAGATGAACAGTCTGAAGGCTGAGGACACAGCAGTGTATTACT
GTGCCAGA
>AF303571|IGHV3S1*01_Treber|(F)|V-REGION
TGTGAGCAGTTGATACAG......CCAGCCTCT...GTGACTGTGCAGCCAGGTCAACGTCTGCCCATCACCTGTCAGG
TCTCTTATTCTGTTAGC...............AGCTACAACACAGCCTGGATCAGACAGCCTGCAGGGAAAGGACTGGA
GTGGATAGGAATGGCAGCTGCTGGA.........TCCACCACACACTTTAAAGATTCACTGAAG...AGCAAGTTCAGT
ATCGACTTAGACTCTTCCAGCAAAACAGTGACTCTGAACGGACAGAGCATGCAGCCTGGAGACTCTGCTGTGTATTACT
GTGCCAGA
>AF303570|IGHV3S2*01_Treber|(F)|V-REGION
............ATACAG......CCAGCCTCT...GTGACTGTGCAGCCAGGTCAACGTCTGACCATCACCTGTCAGG
TCTCTTATTCTGTTAGC...............AGCTACTACACAGCCTGGATCAGACAGCCTGCAGGGAAAGGACTGGA
GTGGATAGGAATGAGACAAGGT............TCAACTACATACTACAAAGATTCACTGAAG...AGCAAGTTCAGT
ATCGACTTAGACTCTTCCAGCAAAACAGTGACTCTGAACGGACAGAGCGTGCAGCCTGGAGACTCTGCTGTGTATTACT
GTGCCAGA
>AF303537|IGHV3S3*01_Treber|(F)|V-REGION
TGTGAGCAGTTGATACAG......CCAGCCTCT...GTGACTGTGCAGCCAGGTCAACGTCTGACCATCACCTGTCAGG
TCTCTTATTCTGTTAGC...............AGCGCCTACACAGCCTGGATCAGACAGCCTGCAGGGAAAGGACTGGA
GTGGATAGGAATGAAATACACA............AGTGGTACACACTACAAAGATTCACTGAAG...AGCAAGTTCAGC
ATCGACTTAGACTCTTCCAGCAACACAGTGACTCTGAACGGACAGAGCGTGCAGCCTGGAGACTCTGCTGTGTATTACT
GTGCCAGA
>AF303543|IGHV3S4*01_Treber|(F)|V-REGION
TGTGAGCAGTTGACACAG......CCAGCCTCT...GTGACTGTGCAGCCAGGTCAACGTCTGACCATCACCTGTCAGG
TCTCTTATCTGTGG..................CAGTCATCATACCATTGGATCAGACAGCCTGCAGGAAAAGGACTGGA
GTGGATATCGCGCACGTGGTTGGAT.........ACTCCACAGTCCGAAAAAGATTCACTGAAG...AGCAAGTTCAGT
ATCGACTTAGACTCTTCCAGCAACACAGTGACTCTGAACGGACAGAGCATGCAGCCTGGAGACTCTGCTGTGTATTACT
GTGCCAGA
>AF303535|IGHV3S5*01_Treber|(F)|V-REGION
TGTGAGCAGTTGATACAG......CCAGCCTCT...GTGACTGTGCAGCCAGGTCAACGTCTGACCATCACCTGTCAGG
TCTCTTATTCTCTT..................GGCTCCTTCACAGCCTGGATCAGACAGCCTGCAGGGAAAGGACTGGA
GTGGATAGGCGTGAAACACTGG...............AGTTCATCATACAAAGATTCACTGAAG...ACGAAGTTCAGT
ATCGACTTAGACTCTTCCAGCAACACAGTGACTCTGAACGGACAGAGCGTGCAGCCTGGAGACTCTGCTGTGTATTACT
GTGCCAGA
>AF108421|IGHV1S1*01_Takrub|F|V-REGION
GCTCAGACTCTGACCCAG......TCTGAACCA...GTGGTTAAAAGACCTGGAGAATCTCACACACTGACCTGTTCAG
CCTCTGGATTCACATTC............AGCAGCTACTGGATGGCCTGGATCAGACAGGTTCCTGGAAAAGGACTGGA
GTGGATCGCTTATATTGGCACCAGT......AGCAGCCCTAAGTACTACTCTGAGTCAGTCAAA...GGCCGGTTTATC
ATCTCCAGAGACGACAACAGAGCACAGCTGAATCTGCAGATGAACAGCCTGAAGACGGAAGATTCTGCTGTTTATTATT
GTGCTCGATGGT
>AF108421|IGHV1S2*01_Takrub|F|V-REGION
GCTCAGACTCTGACCCAG......TCTGAACCA...GTGGTTAAAAGACCTGGAGAATCTCACACACTGACCTGTTCAG
CCTCTGGATTCACATTC............AGCAGCTATGAGATGAACTGGGTCAGACAGGCTCCTGGAAAAGGACTGGA
GTGGATCGCATATATCTACAGGAGT......GGCAGCAGCCAGTACTACTCTGAGTCAGTCAAA...GGCCGGTTTATC
ATCTCCAGAGACAACAACAGAGCACAGCTGAATCTGCAGATGAACAGCCTGAAGACTGAAGATTCTGCTGTTTATTATT
GTGCTCGAGAGT
>AF108421|IGHV1S3*01_Takrub|F|V-REGION
GCTCAGACTCTGACCCAG......TCTGAACCA...GTGGTTAAAAGACCTGGAGAATCTCACACACTGACCTGTTCAG
CCTCTGGATTCACATTC............AGCAGCTATGAGATGAACTGGGTCAGACAGGCTCCTGGAAAAGGACTGGA
GTGGATCGCTTATATCAGCAGCAGT......AGCAGCTACAAGTACTACTCTGAGTCAGTCAAA...GGCCGGTTTCTC
ATCTCCAGAGACGACAACAGAGCACAGCTGAATCTGCAGATGAACAGCCTGAAGACTGAAGATTCTGCTGTTTATTATT
GTGCTCGAGAGT
>AF108422|IGHV1S4*01_Takrub|F|V-REGION
GCTCAGACTCTGACCCAG......TCTGAACCA...GTGGTTAAAAGACCTGGAGAATCTCACACACTGACCTGTTCAG
CCTCTGGATTCACATTC............AGCAGCTACTGGATGCACTGGGTCAGACAGGCTCCTGGAAAAGGACTGGA
GTGGATCAGTGCTATCAGCACTGGC.........AGCAGCCAGTACTACTCTGAGTCAGTCAAA...GGCCGGTTTATC
ATCTCCAGAGACAACAACAGAGCACAGCTGAATCTGCAGATGAACAGCCTGAAGACTGAAGATTCTGCTGTTTATTATT
GTGCTCGATGGT
>AF108423|IGHV1S5*01_Takrub|F|V-REGION
GCTCAGACTCTGACCCAG......TCTGAACCA...GTGGTTAAAAGACCTGGAGAATCTCACACACTGACCTGTTCAG
CCTCTGGATTCACATTC............AGCAGCTATGGGATGCACTGGGTCAGACAGGCTCCTGGAAAAGGACTGGA
GTGGATCAGTCTCATTTACTATGAT......GGCAGCAACAAGTACTACTCTGAGTCAGTCAAA...GGCCGGTTTCTC
ATCTCCAGAGACAACAACAGAGCACAGCTGAATCTGCAGATGAACAGCCTGAAGACTGAAGATTCTGCTGTTTATTATT
GTGCTCGAGAGT
>AF108421|IGHV2S1*01_Takrub|ORF|V-REGION
GGTGAACAGTTGACACAG......CCAGCCTCT...GTGACTGTGCAGCCAGGTCAGAGTCTGACCATCACCTGTCAGG
TCTCTTATTCTCTCAGC...............AGCTACTGGACACACTGGATCAGACAGCCTCCAAGGAAAGGACTGGA
GTGGATTGGATGGAAATATACT............GGAGGCTCCTACTACAAAGATTCCCTGAAG...AACAAGTTCAGC
ATCAGTTTAGACTCTTCCAGCAACACAGTGACTCTAAATGGAGTGAATGTGCAGCCTGAAGACACTGCTGTGTATTACT
GTGCCGGA
>AF108421|IGHV2S2*01_Takrub|ORF|V-REGION
TGTGAACAGTTGACACAG......CCAGCCTCT...GTGACTGTGCAGCCAGGTCAGCGTCTGACCATCACCTGTCAGG
TCTCTTATTCTGTTAGC...............AGCTATTACACAAGCTGGATCAGACAGCCAGCAGGGAAAGGACTGGA
GTGGATTGGGTGGAATAGTGTTGGA.........TCCACCCCACGCTACAAAGCTTCCCTGAAG...AACAAGTTCAGC
ATCAGTTTGGACTCTTCCAGCAACACAGTGACTCTAAATGGAGTGAATGTGCAGCCTGAAGACACTGCTGTGTATTACT
GTGCCAGA
>AF108423|IGHV2S3*01_Takrub|ORF|V-REGION
TGTGAACAGTTGACACAG......CCAGCCTCT...GTGACTGTGCAGCCAGGTCAGAGTCTGACAATCACCTGTCAGG
TCTCTTATTCTGTTAGC...............AGCTACTGGACAGGCTGGATCAGACAGCCTGCAGGGAAAGGACTGGA
GTGGATTGGAAATGGTGTTGGA............TCTAGCACATATTATAAAGCTTCCCTGAAG...AACAAGTTCAGC
ATCAGTTTGGACTCTTCCAGCAACACAGTGACTCTAAATGGAGTGAATGTGCAGCCTGAAGACACTGCTGTGTATTACT
GTGCCAGATA
>AF108422|IGHV2S4*01_Takrub|ORF|V-REGION
...............................................................................
...............................................................................
.............TAA.......................ATGGAGTGAATGTGCAGCCTGAAGA...CACTGCTGTGTA
TTACTGTGCCAGATA
>AF437736|IGHV1S1*01_Chaace|(F)|V-REGION
GGTCAGACTCTGACAGAA......TCTGAACCA...GTGACTAAAAGGCCTGGAGAATCTCACACATTGACCTGTACAG
CCTCTGGATTCACATTC............AGTGGCTCCTGGATGGCCTGGGTCAGACAGGCTCCTGGAAAAGGACTGGA
GTGGATTGCCACTATCAGCACAAGC......AGTAGCAGCATCTTCTACTCTGAGTCATTTAAA...GGCCGCTTCACC
ATCTCCAGAGACGACAACCACCAGCAGCTGTATCTGCAGATGAGCAGTCTGACGGCTGTAGACTCTGCTGTTTATTACT
GTGCTCGAGAC
>AF437737|IGHV1S2*01_Chaace|(F)|V-REGION
...............................................................................
..TCTGGATTCACATTC............AGTAGCTACGGCATGCACTGGGTCAGACAGGCTCCTGGGAAAGGACTGGA
GTGGATCGCTTATTTCGACACTGGG.........AGCACCGCATACTACTCTGAGTCATTTAAA...GGCCGCTTCACC
ATCTCCAGAGACAACAACAGACAGCAGCTGTATCTGCAGATGAACAGTCTGACGGCTGTAGACTCTGCTGTTTATTACT
GTGCTCGTATA
>AF437738|IGHV1S1*01_Notcor|(F)|V-REGION
GGTCAGACTCTGACAGAA......TCTGAACCA...GTGACTAAAAGGCCTGGAGAATCTCACAGATTGACCTGTACAG
CCTCTGGATTCACATTC............AGTAGCTCCTACATGAACTGGGTCAGACAGGCTGCTGGGAAAGGACTGGA
GTGGATCGCTTATATCTACCCTAGC......AGTAGCACCGTGTACTACTCTGAGTCAGTGAAA...GGCCGGTTCACC
ATCTCCAGAGACAACAACAGACAGCAGGTGTATCTGCAGATGAACAGTCTGACGGCTGTAGACTCTGCTGTTTATTACT
GTGCTCGAGTC
>AF437739|IGHV1S2*01_Notcor|(F)|V-REGION
GGTCAGACTCTGACAGAA......TCTGATTCA...GTGACTAAAAGGCCTGGAGAATCTCACAGATTGACCTGTACAG
CCTCTGGAGTTGACTTT............GGTAGCTCTTGGATGGCTTGGATCAGACAGGCTCCTGGGAAAGGACTGGA
GTGGGTTGCGATTATTGAACATGAT......AGTGATCGTATCTACTACTCTGAGTCAGTGAAA...GGCCGGTTCACC
ATCTCCAGAGAGAACAACAGACAGCAGCTGTATCTGCAGATGAACAGTCTGACGGCTGTAGACTCTGCTGTTTATTACT
GTGCTCGGGCG
>AF437740|IGHV1S3*01_Notcor|(F)|V-REGION
GGTCAGACTCTGACAGAA......TCTGATTCA...GTGACTAAAAGGCCTGGAGAATCTCACAGATTGACCTGTACAG
CCTCTGGATTCACATTC............AGTAGCCACTGGATGGCCTGGGTCAGACAGGCTCCTGGAAAAGGACTGGA
GTGGGTTGCTATTATGCACCCTACTAGC...AGTGCCCACATCTACTACTCTGAGTCAGTGAAA...GGCCGGTTCACC
ATCTCCAGAGACAACAGCAGACAGCAGGTGTATCTGCAGATGAGCAGTCTGACGGCTGTAGACTCTGCTGTTTATTACT
GTGCTCGAGAA
>AF437741|IGHV1S4*01_Notcor|(F)|V-REGION
GGTCAGACTCTGACAGAA......TCTGATTCA...GTGACTAAAAGACCTGGAGAATCTCACAGATTGACCTGTACAG
CCTCTGGATTCACATTC............AGTAGCATCTACATGGCCTGGATCAGACAGGCTCCTGGAAAAGGACTGGA
GTGGATCGCTTATATCGGCACAAGC......AGTTCTCCTATATCTTACTCCCAGTCGGTTCAG...GGTAGATTCACT
ATCTCCAGAGATGACTCCAGCAGTAAAATGTATCTGCAGATGAACAGTCTGAAGGCCGAGGACACAGCAGTGTATTACT
GTGCCAGATGG





Created: 29/06/1999
Last modified: 22/07/2008


-> IMGT/V-QUEST Search page
-> IMGT Repertoire
-> IMGT Scientific chart
-> IMGT Home page

© Copyright 1995-2017 IMGT, the international ImMunoGeneTics database