IMGT Repertoire (IG and TR)

Alignment of alleles: Ring-tailed lemur (Lemur catta) IGHD overview

When several alleles are shown, the nucleotide mutations and amino acid changes for a given codon are indicated in red letters. These polymorphic mutations are reported in Tables of alleles.

Dashes indicate identical nucleotides. Dots indicate gaps according to the IMGT unique numbering. Blanks indicate partial sequences (blanks at the 5' and/or 3' end).

Dots indicate gaps according to the IMGT unique numbering.
Blanks at the 5' and/or 3' end indicate partial sequences.
Asterisk (*) in the sequence indicate a STOP-CODON.
Letters in red correspond to amino acids which are polymorphic in the other alleles.
Colours are according to Color menu for mutations, Color menu for sequence alignments and Color menu for splicing types.
The nucleotide (s) in bold and colored in purple (splicing frame 1) or green (splicing frame 2) from the DONOR splice site are added at the beginning of the following exon in order to obtain and to complete the first CODON of the DOMAIN or REGION resulting from the splicing site. These first CODONs are in bold and colored in purple (splicing frame 1) or green (splicing frame 2)
N (Asn, asparagine) of potential N-glycosylation sites (NXS/T, where X is different from P), (N-linked glycosylation) is shown in green

Clicking on the allele name gives access to the IMGT/GENE-DB.
Clicking on the accession number gives access to the IMGT/LIGM-DB.

                                                                  5'->3'                                                     3'<-5'
                                                            (direct orientation)                                       (inverted orientation)
                                               1        10        20        30        40                   1        10        20        30        40    
                                               |........|.........|.........|.........|.....               |........|.........|.........|.........|.....

                                                G  T  G  G  T                                                V  V  P  P  V    
                                                 E  L  G  E  Q                                                L  F  P  Q  F   
                                                  N  W  G  N  N                                                C  S  P  S  S  
  IMGT000097 IGHD1-3*01  F   D-REGION gDNA     ggaactgggggaacaac                                           gttgttcccccagttcc

                                                G  T  G  G  T                                                V  V  P  P  V    
                                                 E  L  G  E  Q                                                L  F  P  Q  F   
                                                  N  W  G  N  N                                                C  S  P  S  S  
  IMGT000097 IGHD1-7*01  F   D-REGION gDNA     ggaactgggggaacaac                                           gttgttcccccagttcc

                                                *  V  L  *  *  W  C  L  L  W                                 A  I  V  N  T  I  T  I  V  L   
                                                 E  Y  Y  S  D  G  V  Y  Y  G                                 P  *  *  T  P  S  L  *  Y  S  
                                                  S  T  I  V  M  V  F  T  M                                    H  S  K  H  H  H  Y  S  T    
  IMGT000097 IGHD2-1*01  F   D-REGION gDNA     tgagtactatagtgatggtgtttactatggc                             gccatagtaaacaccatcactatagtactca

                                                V  Y  S  G  V  Y  G  Y                                       V  *  P  Y  T  P  L  Y    
                                                 Y  I  V  G  Y  T  V  I                                       Y  N  R  I  P  H  Y  I   
                                                  I  *  W  G  I  R  L  Y                                       I  T  V  Y  P  T  I  Y  
  IMGT000097 IGHD3-2*01  ORF D-REGION gDNA     gtatatagtggggtatacggttatac                                  gtataaccgtataccccactatatac

                                                V  Y  S  G  V  Y  G  Y                                       V  *  P  Y  T  P  L  Y    
                                                 Y  I  V  G  Y  M  V  I                                       Y  N  H  I  P  H  Y  I   
                                                  I  *  W  G  I  W  L  Y                                       I  T  I  Y  P  T  I  Y  
  IMGT000097 IGHD3-4*01  ORF D-REGION gDNA     gtatatagtggggtatatggttatac                                  gtataaccatataccccactatatac

                                                V  E  T  E  Y  D  Y  D  L  G  S  I  V  S  T                  G  A  D  N  A  P  *  V  V  V  V  F  S  L  N  
                                                 L  R  L  N  T  T  T  T  *  G  A  L  S  A                     V  L  T  M  L  P  R  S  *  S  Y  S  V  S    
                                                  *  D  *  I  R  L  R  P  R  E  H  C  Q  H                     C  *  Q  C  S  L  G  R  S  R  I  Q  S  Q   
  IMGT000097 IGHD3-8*01  F   D-REGION gDNA     gttgagactgaatacgactacgacctagggagcattgtcagcacc               ggtgctgacaatgctccctaggtcgtagtcgtattcagtctcaac

                                                S  T  G  L  A  A                                             V  A  A  S  P  V    
                                                 L  L  D  *  Q  L                                             *  L  L  V  Q  *   
                                                  Y  W  T  S  S  Y                                             S  C  *  S  S  R  
  IMGT000097 IGHD4-10*01 ORF D-REGION gDNA     tctactggactagcagctac                                        gtagctgctagtccagtaga

                                                V  H  I  A  T  G                                             V  P  V  A  I  W    
                                                 S  I  *  L  R  G                                             S  P  *  L  Y  G   
                                                  P  Y  S  Y  G  D                                             P  R  S  Y  M  D  
  IMGT000097 IGHD5-5*01  ORF D-REGION gDNA     gtccatatagctacggggac                                        gtccccgtagctatatggac

                                                Y  S  S  G  W  A                                             G  P  S  A  T  V  
                                                 T  V  A  D  G                                                A  H  P  L  L    
                                                  Q  *  R  M  G                                                P  I  R  Y  C   
  IMGT000097 IGHD6-6*01  ORF D-REGION gDNA     tacagtagcggatgggcc                                          ggcccatccgctactgta

                                                G  I  I  T  A  G  G  T                                       S  P  T  S  C  Y  N  T  
                                                 V  L  *  Q  L  V  G                                          V  P  P  A  V  I  I    
                                                  Y  Y  N  S  W  W  D                                          S  H  Q  L  L  *  Y   
  IMGT000097 IGHD6-9*01  ORF D-REGION gDNA     ggtattataacagctggtgggact                                    agtcccaccagctgttataatacc

                                                G  I  T  V  A  G  T                                          S  T  S  Y  R  N  T  
                                                 V  L  R  *  L  V                                             V  P  A  T  V  I    
                                                  Y  Y  G  S  W  Y                                             Y  Q  L  P  *  Y   
  IMGT000097 IGHD6-11*01 ORF D-REGION gDNA     ggtattacggtagctggtact                                       agtaccagctaccgtaatacc

Legend:

*: STOP-CODON

This alignment of allele is generated by IMGT/OutilAllele (Mehdi Yousfi, Chantal Ginestoux, Perrine Pégorier and Patrice Duroux).

Created:: 12/08/2022
Authors:: Turkan Samadova