Here you are: IMGT Web resources > IMGT Repertoire > Proteins and alleles

Alignment of alleles: Ring-tailed lemur (Lemur catta) IGHD5-5

When several alleles are shown, the nucleotide mutations and amino acid changes for a given codon are indicated in red letters. These polymorphic mutations are reported in Tables of alleles.

Dashes indicate identical nucleotides. Dots indicate gaps according to the IMGT unique numbering. Blanks indicate partial sequences (blanks at the 5' and/or 3' end).

Clicking on the allele name gives access to the IMGT/GENE-DB.
Clicking on the accession number gives access to the IMGT/LIGM-DB.


                                                     5'->3'                             3'<-5'
                                              (direct orientation)             (inverted orientation)
                                              1        10        20               1        10        20
                                              |........|.........|               |........|.........|

                                               V  H  I  A  T  G                    V  P  V  A  I  W    
                                                S  I  *  L  R  G                    S  P  *  L  Y  G   
                                                 P  Y  S  Y  G  D                    P  R  S  Y  M  D  
  IMGT000097 IGHD5-5*01 ORF D-REGION gDNA     gtccatatagctacggggac               gtccccgtagctatatggac

Legend:

*: STOP-CODON

This alignment of allele is generated by IMGT/OutilAllele (Mehdi Yousfi, Chantal Ginestoux, Perrine Pégorier and Patrice Duroux).

Created:
10/08/2022
Last updated:
11/08/2022
Authors:
Turkan Samadova