IMGT Web resources: IMGT repertoire

When several alleles are shown, the nucleotide mutations and amino acid changes for a given codon are indicated in red letters. These polymorphic mutations are reported in Tables of alleles.
Dashes indicate identical nucleotides. Dots indicate gaps according to the IMGT unique numbering. Blanks indicate partial sequences (blanks at the 5' and/or 3' end).

Only the *01 allele of each functional, ORF and in-frame pseudogenes D-REGION is shown.

                                     D-REGION                                                                D-REGION
                                      5'->3'                                                                  3'<-5'
                               (direct orientation)                                                    (inverted orientation)
                               1        10       20                                                     1        10       20
                               |........|........|                                                      |........|........|
                                V  Q  R  Y  S  F  Y                                                      V  K  G  V  S  L  N
                                 F  K  D  T  P  F                                                         *  K  E  Y  L  *
                                  S  K  I  L  L  L                                                         K  R  S  I  F  E
DQ400445, IGHD1-1*01, ORF      GTTCAAAGATACTCCTTTTAC                                                    GTAAAAGGAGTATCTTTGAAC

                                I  T  T                                                                  A  V  V
                                 *  L  R                                                                  P  *  L
                                  N  Y  G                                                                  R  S  Y
DQ400445, IGHD1-2*01,  F       ATAACTACGGC                                                              GCCGTAGTTAT

                                Q  Y  S  G                                                               T  R  Y  I
                                 N  I  A  G                                                               P  A  I  L
                                  I  *  R                                                                  P  L  Y
DQ400445, IGHD1-3*01,  F       CAATATAGCGGGT                                                            ACCCGCTATATTG

                                Y  W  G  G                                                               V  P  P  Q
                                 T  G  V  A                                                               C  H  P  S
                                  L  G  W  H                                                               A  T  P  V
DQ400445, IGHD1-4*01,  F       TACTGGGGTGGCAC                                                           GTGCCACCCCAGTA

                                V  D  G                                                                  L  H  P
                                 W  M  E                                                                  S  I  H
                                  G  W                                                                     P  S
DQ400445, IGHD1-5*01,  F       GTGGATGGAG                                                               CTCCATCCAC

                                V  I  A  A  G  V                                                         L  L  Q  L  L  *
                                 L  *  Q  L  E  *                                                         Y  S  S  C  Y  N
                                  Y  S  S  W  S                                                            T  P  A  A  I
DQ400445, IGHD1-6*01,  F       GTTATAGCAGCTGGAGTAG                                                      CTACTCCAGCTGCTATAAC

                                S  R  G  Q                                                               L  A  T  R
                                 R  V  A                                                                  W  P  R
                                  A  W  P                                                                  G  H  A
AF068137, IGHD2-1*01, (F) ~vdj TCGCGTGGCCAA                                                             TTGGCCACGCGA

IMGT notes:

~vdj: VDJ genomic DNA rearranged in the locus.