Overview

IMGT® is a pioneering international information system in immunogenetics and immunoinformatics. It provides databases and tools based on the IMGT-ONTOLOGY to the scientific community for in-depth exploration of the adaptive immune response. IMGT® is dedicated to advancing scientific knowledge through its three main axes of research and development.

Axis I Axis II Axis III Understanding the adaptive immune response by deciphering the immunoglobulin (IG) and T cell receptor (TR) genes on the genomic loci of jawed vertebrates. Analysis and exploration of the expressed IG and TR repertoires based on comparison with IMGT reference directories in normal and pathological situations. 2D and 3D structure databases and tools for analysis of the adaptive immune proteins and engineered antibodies and TR. IMGT Scientific chart IMGT-ONTOLOGY IMGT-KG IMGT Repertoire IMGT/LIGM-DB IMGT/GENE-DB IMGT reference directory IMGT/V-QUEST IMGT/HighV-QUEST IMGT/JunctionAnalysis IMGT/StatClonotype IMGT/CLL-DB IMGT/2Dstructure-DB IMGT/3Dstructure-DB IMGT/mAb-DB IMGT/Collier-de-Perles IMGT/DomainSuperimpose IMGT/DomainGapAlign IMGT/RobustpMHC I m M uno G ene T ics Information system® https://www.imgt.org

Databases

  • IMGT/LIGM-DB (doc) LIGM, Montpellier, France
    Nucleotide sequences of IG and TR from 369 species (251 692 entries)
  • IPD-IMGT/HLA-DB ANRI, hosted at EBI
    Sequences of the human MH (HLA)
  • IMGT/PRIMER-DB (doc) LIGM, Montpellier, France
    Oligonucleotides (primers) of IG and TR from 11 species (1 864 entries)
  • IMGT/CLL-DB (bylaws) LIGM, Montpellier, France
    IG sequences from CLL, an initiative of the IMGT/CLL-DB group
  • IMGT/GENE-DB (doc) LIGM, Montpellier, France
    International nomenclature for IG and TR genes from 42 species (12 912 genes, 18 271 alleles)
  • IMGT/mAb-DB (doc) LIGM, Montpellier, France
    Monoclonal antibodies (IG, mAb), fusion proteins for immune applications (FPIA), composite proteins for clinical applications (CPCA), and related proteins (RPI) of therapeutic interest (2 010 entries)

Tools

IMGT Repertoire

Creations and Updates

2026

20 AUGUST 2026 - UPDATE 2026: Human (Homo sapiens) IGK in IMGT/GENE-DB, IMGT/LIGM-DB and IMGT Web resources

Update of the human (Homo sapiens) IGK reference directory (IMGT/GENE-DB data updates).
Addition in IMGT/GENE-DB of:
1 human (Homo sapiens) IGKV new alleles.

Addition of IGK locus annotation IMGT000371 in IMGT/LIGM-DB.

Update of 8 web pages in IMGT Repertoire (IG and TR):
Dynamic gene table: human (Homo sapiens) IGKV.
Dynamic gene table: human (Homo sapiens) IGKC.
Dynamic gene table: human (Homo sapiens) IGKJ.
Locus representation: human (Homo sapiens) IGK.
Alignment of alleles: human (Homo sapiens) IGKV.
Locus in genome assembly: human (Homo sapiens) IGK.
Locus gene order: human (Homo sapiens) IGK.
Assembly comparison: human (Homo sapiens) IGK.

31 JULLY 2026 - UPDATE 2026: Human (Homo sapiens) IGK in IMGT/GENE-DB, IMGT/LIGM-DB and IMGT Web resources

Update of the human (Homo sapiens) IGK reference directory (IMGT/GENE-DB data updates).
Addition in IMGT/GENE-DB of:
1 human (Homo sapiens) IGKV new alleles.

Addition of IGK locus annotation IMGT000361 in IMGT/LIGM-DB.

Update of 8 web pages in IMGT Repertoire (IG and TR):
Dynamic gene table: human (Homo sapiens) IGKV.
Dynamic gene table: human (Homo sapiens) IGKC.
Dynamic gene table: human (Homo sapiens) IGKJ.
Locus representation: human (Homo sapiens) IGK.
Alignment of alleles: human (Homo sapiens) IGKV.
Locus in genome assembly: human (Homo sapiens) IGK.
Locus gene order: human (Homo sapiens) IGK.
Assembly comparison: human (Homo sapiens) IGK.

21 JULLY 2026 - UPDATE 2026: Human (Homo sapiens) IGK in IMGT/GENE-DB, IMGT/LIGM-DB and IMGT Web resources

Update of the human (Homo sapiens) IGK reference directory (IMGT/GENE-DB data updates).
Addition in IMGT/GENE-DB of:
3 human (Homo sapiens) IGKV new alleles.

Addition of IGK locus annotation IMGT000357 in IMGT/LIGM-DB.

Update of 8 web pages in IMGT Repertoire (IG and TR):
Dynamic gene table: human (Homo sapiens) IGKV.
Dynamic gene table: human (Homo sapiens) IGKC.
Dynamic gene table: human (Homo sapiens) IGKJ.
Locus representation: human (Homo sapiens) IGK.
Alignment of alleles: human (Homo sapiens) IGKV.
Locus in genome assembly: human (Homo sapiens) IGK.
Locus gene order: human (Homo sapiens) IGK.
Assembly comparison: human (Homo sapiens) IGK.

02 July 2026 - CREATION 2026: Chimpanzee (Pan troglodytes) TRB reference directory in IMGT/GENE-DB, IMGT/LIGM-DB and IMGT Web resources

Addition of TRB annotation of IMGT locus reference sequence IMGT000261 in IMGT/LIGM-DB.
Addition of TRB annotation IMGT000348 in IMGT/LIGM-DB.
Creation of the chimpanzee (Pan troglodytes) TRB reference directory (IMGT/GENE-DB data updates).
Addition in IMGT/GENE-DB of:
65 chimpanzee (Pan troglodytes) TRBV genes corresponding to 84 allelic sequences.
14 chimpanzee (Pan troglodytes) TRBJ genes corresponding to 14 allelic sequences.
2 chimpanzee (Pan troglodytes) TRBD genes corresponding to 2 allelic sequences.
2 chimpanzee (Pan troglodytes) TRBC genes corresponding to 2 allelic sequences.

Creation and update of 20 web pages in IMGT Repertoire (IG and TR):
Locus representation: chimpanzee (Pan troglodytes) TRB.
Locus description: chimpanzee (Pan troglodytes) TRB.
Locus in genome assembly: chimpanzee (Pan troglodytes) TRB.
Locus gene order: chimpanzee (Pan troglodytes) TRB.
Potential germline repertoire: chimpanzee (Pan troglodytes) TRBV, TRBD and TRBJ genes.
Locus bornes: TRB locus 5' and 3' bornes.
Dynamic gene table: chimpanzee (Pan troglodytes) TRBV.
Dynamic gene table: chimpanzee (Pan troglodytes) TRBD.
Dynamic gene table: chimpanzee (Pan troglodytes) TRBJ.
Dynamic gene table: chimpanzee (Pan troglodytes) TRBC.
[CDR1-IMGT.CDR2-IMGT.CDR3-IMGT] lengths for V genes per species and locus: chimpanzee (Pan troglodytes) TRB locus.
Protein displays: chimpanzee (Pan troglodytes) TRBV.
Protein displays: chimpanzee (Pan troglodytes) TRBJ.
Protein displays: chimpanzee (Pan troglodytes) TRBC.
Alignment of alleles: chimpanzee (Pan troglodytes) TRBV.
Alignment of alleles: chimpanzee (Pan troglodytes) TRBD.
Alignment of alleles: chimpanzee (Pan troglodytes) TRBJ.
Alignment of alleles: chimpanzee (Pan troglodytes) TRBC.
Colliers de Perles: chimpanzee (Pan troglodytes) TRBV.
Colliers de Perles: chimpanzee (Pan troglodytes) TRBC.

16 JUNE 2026 - UPDATE 2026: Domestic cat (Felis catus) IGH in IMGT/GENE-DB, IMGT/LIGM-DB and IMGT Web resources

Update of the domestic cat (Felis catus) IGH reference directory (IMGT/GENE-DB data updates).
Addition in IMGT/GENE-DB of:
2 domestic cat (Felis catus) IGHV new alleles.
1 domestic cat (Felis catus) IGHC new alleles.

Addition of IGH locus annotation IMGT000358 in IMGT/LIGM-DB.

Update of 5 web pages in IMGT Repertoire (IG and TR):
Dynamic gene table: domestic cat (Felis catus) IGHV.
Dynamic gene table: domestic cat (Felis catus) IGHC.
Dynamic gene table: domestic cat (Felis catus) IGHJ.
Dynamic gene table: domestic cat (Felis catus) IGHD.
Alignment of alleles: domestic cat (Felis catus) IGHV.
Locus in genome assembly: domestic cat (Felis catus) IGH.
Locus gene order: domestic cat (Felis catus) IGH.

05 MAY 2026 - CREATION 2026: Domestic cat (Felis catus) IGH reference directory in IMGT/GENE-DB, IMGT/LIGM-DB and IMGT Web resources

Addition of IGH annotation of IMGT locus reference sequence IMGT000328 in IMGT/LIGM-DB.
Creation of the domestic cat (Felis catus) IGH reference directory (IMGT/GENE-DB data updates).
Addition in IMGT/GENE-DB of:
89 domestic cat (Felis catus) IGHV genes corresponding to 89 allelic sequences.
6 domestic cat (Felis catus) IGHD genes corresponding to 6 allelic sequences.
6 domestic cat (Felis catus) IGHJ gene corresponding to 6 allelic sequence.
7 domestic cat (Felis catus) IGHC genes corresponding to 7 allelic sequences.

Creation and update of 20 web pages in IMGT Repertoire (IG and TR):
Locus representation: domestic cat (Felis catus) IGH.
Locus description: domestic cat (Felis catus) IGH.
Potential germline repertoire: domestic cat (Felis catus) IGHV, IGHD and IGHJ genes.
Locus bornes: IGH locus 3' bornes.
Locus in genome assembly: domestic cat (Felis catus) IGH.
Locus gene order: domestic cat (Felis catus) IGH.
Dynamic gene table: domestic cat (Felis catus) IGHV.
Dynamic gene table: domestic cat (Felis catus) IGHD.
Dynamic gene table: domestic cat (Felis catus) IGHJ.
Dynamic gene table: domestic cat (Felis catus) IGHC.
[CDR1-IMGT.CDR2-IMGT.CDR3-IMGT] lengths for V genes per species and locus: domestic cat (Felis catus) IGH locus.
Protein displays: domestic cat (Felis catus) IGHV.
Protein displays: domestic cat (Felis catus) IGHJ.
Protein displays: domestic cat (Felis catus) IGHC.
Alignment of alleles: domestic cat (Felis catus) IGHV.
Alignment of alleles: domestic cat (Felis catus) IGHD.
Alignment of alleles: domestic cat (Felis catus) IGHJ.
Alignment of alleles: domestic cat (Felis catus) IGHC.
Colliers de Perles: domestic cat (Felis catus) IGHV.
Colliers de Perles: domestic cat (Felis catus) IGHJ.

20 April 2026 - CREATION 2026: Bornean orangutan (Pongo pygmaeus) TRA/TRD reference directory in IMGT/GENE-DB, IMGT/LIGM-DB and IMGT Web resources

Addition of TRA/TRD annotation of IMGT locus reference sequence IMGT000301 in IMGT/LIGM-DB.
Creation of the Bornean orangutan (Pongo pygmaeus) TRA/TRD reference directory (IMGT/GENE-DB data updates).
Addition in IMGT/GENE-DB of:
63 Bornean orangutan (Pongo pygmaeus) TRAV genes corresponding to 63 allelic sequences.
61 Bornean orangutan (Pongo pygmaeus) TRAJ genes corresponding to 61 allelic sequences.
1 Bornean orangutan (Pongo pygmaeus) TRAC gene corresponding to 1 allelic sequence.
3 Bornean orangutan (Pongo pygmaeus) TRDV genes corresponding to 3 allelic sequences.
4 Bornean orangutan (Pongo pygmaeus) TRDJ genes corresponding to 4 allelic sequences.
3 Bornean orangutan (Pongo pygmaeus) TRDD genes corresponding to 3 allelic sequences.
1 Bornean orangutan (Pongo pygmaeus) TRDC gene corresponding to 1 allelic sequence.

Creation and update of 34 web pages in IMGT Repertoire (IG and TR):
Locus representation: Bornean orangutan (Pongo pygmaeus) TRA/TRD.
Locus description: Bornean orangutan (Pongo pygmaeus) TRA.
Locus description: Bornean orangutan (Pongo pygmaeus) TRD.
Locus in genome assembly: Bornean orangutan (Pongo pygmaeus) TRA/TRD.
Locus gene order: Bornean orangutan (Pongo pygmaeus) TRA/TRD.
Potential germline repertoire: Bornean orangutan (Pongo pygmaeus) TRAV and TRAJ genes.
Potential germline repertoire: Bornean orangutan (Pongo pygmaeus) TRDV, TRDD and TRDJ genes.
Locus bornes: TRA/TRD locus 5' and 3' bornes.
Dynamic gene table: Bornean orangutan (Pongo pygmaeus) TRAV.
Dynamic gene table: Bornean orangutan (Pongo pygmaeus) TRAJ.
Dynamic gene table: Bornean orangutan (Pongo pygmaeus) TRAC.
Dynamic gene table: Bornean orangutan (Pongo pygmaeus) TRDV.
Dynamic gene table: Bornean orangutan (Pongo pygmaeus) TRDJ.
Dynamic gene table: Bornean orangutan (Pongo pygmaeus) TRDD.
Dynamic gene table: Bornean orangutan (Pongo pygmaeus) TRDC.
[CDR1-IMGT.CDR2-IMGT.CDR3-IMGT] lengths for V genes per species and locus: Bornean orangutan (Pongo pygmaeus) TRA locus.
[CDR1-IMGT.CDR2-IMGT.CDR3-IMGT] lengths for V genes per species and locus: Bornean orangutan (Pongo pygmaeus) TRD locus.
Protein displays: Bornean orangutan (Pongo pygmaeus) TRAV.
Protein displays: Bornean orangutan (Pongo pygmaeus) TRAJ.
Protein displays: Bornean orangutan (Pongo pygmaeus) TRAC.
Protein displays: Bornean orangutan (Pongo pygmaeus) TRDV.
Protein displays: Bornean orangutan (Pongo pygmaeus) TRDJ.
Protein displays: Bornean orangutan (Pongo pygmaeus) TRDC.
Alignment of alleles: Bornean orangutan (Pongo pygmaeus) TRAV.
Alignment of alleles: Bornean orangutan (Pongo pygmaeus) TRAJ.
Alignment of alleles: Bornean orangutan (Pongo pygmaeus) TRAC.
Alignment of alleles: Bornean orangutan (Pongo pygmaeus) TRDV.
Alignment of alleles: Bornean orangutan (Pongo pygmaeus) TRDJ.
Alignment of alleles: Bornean orangutan (Pongo pygmaeus) TRDD.
Alignment of alleles: Bornean orangutan (Pongo pygmaeus) TRDC.
Colliers de Perles: Bornean orangutan (Pongo pygmaeus) TRAV.
Colliers de Perles: Bornean orangutan (Pongo pygmaeus) TRAC.
Colliers de Perles: Bornean orangutan (Pongo pygmaeus) TRDV.
Colliers de Perles: Bornean orangutan (Pongo pygmaeus) TRDC.

07 April 2026 - UPDATE 2026: Human (Homo sapiens) TRA/TRD in IMGT/GENE-DB, IMGT/LIGM-DB and IMGT Web resources

Update of the human (Homo sapiens) TRA/TRD reference directory (IMGT/GENE-DB data updates).
Addition in IMGT/GENE-DB of:
6 human (Homo sapiens) TRAV new alleles.
1 human (Homo sapiens) TRAJ new allele.

Addition of TRA/D locus annotation IMGT000321 in IMGT/LIGM-DB.

Addition of TRA/D locus annotation IMGT000323 in IMGT/LIGM-DB.

Addition of TRA/D locus annotation IMGT000327 in IMGT/LIGM-DB.

Addition of TRA/D locus annotation IMGT000333 in IMGT/LIGM-DB.

Update of 17 web pages in IMGT Repertoire (IG and TR):
Dynamic Gene table: human (Homo sapiens) TRAV.
Dynamic Gene table: human (Homo sapiens) TRAJ.
Dynamic Gene table: human (Homo sapiens) TRAC.
Dynamic Gene table: human (Homo sapiens) TRDV.
Dynamic Gene table: human (Homo sapiens) TRDD.
Dynamic Gene table: human (Homo sapiens) TRDJ.
Dynamic Gene table: human (Homo sapiens) TRDC.
Alignment of alleles: human (Homo sapiens) TRAV.
Alignment of alleles: human (Homo sapiens) TRAJ.
Alignment of alleles: human (Homo sapiens) TRAC.
Alignment of alleles: human (Homo sapiens) TRDV.
Alignment of alleles: human (Homo sapiens) TRDD.
Alignment of alleles: human (Homo sapiens) TRDJ.
Alignment of alleles: human (Homo sapiens) TRDC.
Locus representation: human ((Homo sapiens) TRA/TRD.
Locus in genome assembly: human (Homo sapiens) TRA/TRD.
Locus gene order: human (Homo sapiens) TRA/TRD.

26 March 2026 - CREATION 2026: Sumatran orangutan (Pongo abelii) TRA/TRD reference directory in IMGT/GENE-DB, IMGT/LIGM-DB and IMGT Web resources

Addition of TRA/TRD annotation of IMGT locus reference sequence IMGT000253 in IMGT/LIGM-DB.
Creation of the Sumatran orangutan (Pongo abelii) TRA/TRD reference directory (IMGT/GENE-DB data updates).
Addition in IMGT/GENE-DB of:
63 Sumatran orangutan (Pongo abelii) TRAV genes corresponding to 63 allelic sequences.
61 Sumatran orangutan (Pongo abelii) TRAJ genes corresponding to 61 allelic sequences.
1 Sumatran orangutan (Pongo abelii) TRAC gene corresponding to 1 allelic sequence.
3 Sumatran orangutan (Pongo abelii) TRDV genes corresponding to 3 allelic sequences.
4 Sumatran orangutan (Pongo abelii) TRDJ genes corresponding to 4 allelic sequences.
3 Sumatran orangutan (Pongo abelii) TRDD genes corresponding to 3 allelic sequences.
1 Sumatran orangutan (Pongo abelii) TRDC gene corresponding to 1 allelic sequence.

Creation and update of 34 web pages in IMGT Repertoire (IG and TR):
Locus representation: Sumatran orangutan (Pongo abelii) TRA/TRD.
Locus description: Sumatran orangutan (Pongo abelii) TRA.
Locus description: Sumatran orangutan (Pongo abelii) TRD.
Locus in genome assembly: Sumatran orangutan (Pongo abelii) TRA/TRD.
Locus gene order: Sumatran orangutan (Pongo abelii) TRA/TRD.
Potential germline repertoire: Sumatran orangutan (Pongo abelii) TRAV and TRAJ genes.
Potential germline repertoire: Sumatran orangutan (Pongo abelii) TRDV, TRDD and TRDJ genes.
Locus bornes: TRA/TRD locus 5' and 3' bornes.
Dynamic gene table: Sumatran orangutan (Pongo abelii) TRAV.
Dynamic gene table: Sumatran orangutan (Pongo abelii) TRAJ.
Dynamic gene table: Sumatran orangutan (Pongo abelii) TRAC.
Dynamic gene table: Sumatran orangutan (Pongo abelii) TRDV.
Dynamic gene table: Sumatran orangutan (Pongo abelii) TRDJ.
Dynamic gene table: Sumatran orangutan (Pongo abelii) TRDD.
Dynamic gene table: Sumatran orangutan (Pongo abelii) TRDC.
[CDR1-IMGT.CDR2-IMGT.CDR3-IMGT] lengths for V genes per species and locus: Sumatran orangutan (Pongo abelii) TRA locus.
[CDR1-IMGT.CDR2-IMGT.CDR3-IMGT] lengths for V genes per species and locus: Sumatran orangutan (Pongo abelii) TRD locus.
Protein displays: Sumatran orangutan (Pongo abelii) TRAV.
Protein displays: Sumatran orangutan (Pongo abelii) TRAJ.
Protein displays: Sumatran orangutan (Pongo abelii) TRAC.
Protein displays: Sumatran orangutan (Pongo abelii) TRDV.
Protein displays: Sumatran orangutan (Pongo abelii) TRDJ.
Protein displays: Sumatran orangutan (Pongo abelii) TRDC.
Alignment of alleles: Sumatran orangutan (Pongo abelii) TRAV.
Alignment of alleles: Sumatran orangutan (Pongo abelii) TRAJ.
Alignment of alleles: Sumatran orangutan (Pongo abelii) TRAC.
Alignment of alleles: Sumatran orangutan (Pongo abelii) TRDV.
Alignment of alleles: Sumatran orangutan (Pongo abelii) TRDJ.
Alignment of alleles: Sumatran orangutan (Pongo abelii) TRDD.
Alignment of alleles: Sumatran orangutan (Pongo abelii) TRDC.
Colliers de Perles: Sumatran orangutan (Pongo abelii) TRAV.
Colliers de Perles: Sumatran orangutan (Pongo abelii) TRAC.
Colliers de Perles: Sumatran orangutan (Pongo abelii) TRDV.
Colliers de Perles: Sumatran orangutan (Pongo abelii) TRDC.

17 March 2026 - UPDATE 2026: Human (Homo sapiens) IGH in IMGT/GENE-DB, IMGT/LIGM-DB and IMGT Web resources

Update of the human (Homo sapiens) IGH reference directory (IMGT/GENE-DB data updates).
Addition in IMGT/GENE-DB of:
12 human (Homo sapiens) IGHV new genes and 17 new alleles.
1 human (Homo sapiens) IGHD new allele.

Addition of IGH locus annotation IMGT000307 and IMGT000315 in IMGT/LIGM-DB.

Update of 11 web pages in IMGT Repertoire (IG and TR):
Dynamic Gene table: human (Homo sapiens) IGHV.
Dynamic Gene table: human (Homo sapiens) IGHD.
Dynamic Gene table: human (Homo sapiens) IGHJ.
Dynamic Gene table: human (Homo sapiens) IGHC.
Alignment of alleles: human (Homo sapiens) IGHV.
Alignment of alleles: human (Homo sapiens) IGHD.
Alignment of alleles: human (Homo sapiens) IGHJ.
Alignment of alleles: human (Homo sapiens) IGHC.
Locus representation: human ((Homo sapiens) IGH.
Locus in genome assembly: human (Homo sapiens) IGH.
Locus gene order: human (Homo sapiens) IGH.

03 March 2026 - CREATION and UPDATE 2025: Sumatran orangutan (Pongo abelii) TRG in IMGT/GENE-DB, IMGT/LIGM-DB and IMGT Web resources

Creation of the sumatran orangutan (Pongo abelii) TRG reference directory (IMGT/GENE-DB data updates).
Addition in IMGT/GENE-DB of:
IMGT000295 (IMGT000295): first locus annotation.
IMGT000296 (IMGT000296): second locus annotation.
17 sumatran orangutan (Pongo abelii) TRGV genes corresponding to 23 allelic sequences.
5 sumatran orangutan (Pongo abelii) TRGJ genes corresponding to 5 allelic sequence.
2 sumatran orangutan (Pongo abelii) TRGC genes corresponding to 4 allelic sequence.

Addition of sumatran orangutan (Pongo abelii) TRG locus annotation of IMGT locus reference sequence IMGT000295, IMGT000296

Creation of 13 web pages in IMGT Repertoire (IG and TR):
Locus representation: sumatran orangutan (Pongo abelii) TRG.
Locus description:sumatran orangutan (Pongo abelii) TRG.
Locus gene order:sumatran orangutan (Pongo abelii) TRG.
Locus in genome assembly:sumatran orangutan (Pongo abelii) TRG.
Potential germline repertoire:sumatran orangutan (Pongo abelii) TRGV and TRGJ genes.
Alignment of alleles:sumatran orangutan (Pongo abelii) TRGV.
Alignment of alleles:sumatran orangutan (Pongo abelii) TRGJ.
Alignment of alleles:sumatran orangutan (Pongo abelii) TRGC.
Protein displays:sumatran orangutan (Pongo abelii) TRGV.
Protein displays:sumatran orangutan (Pongo abelii) TRGJ.
Protein displays:sumatran orangutan (Pongo abelii) TRGC.
Colliers de Perles:sumatran orangutan (Pongo abelii) TRGV.
Colliers de Perles:sumatran orangutan (Pongo abelii) TRGC.

03 March 2026 - CREATION and UPDATE 2025: Bornean orangutan (Pongo pygmaeus) TRG in IMGT/GENE-DB, IMGT/LIGM-DB and IMGT Web resources

Creation of the bornean orangutan (Pongo pygmaeus) TRG reference directory (IMGT/GENE-DB data updates).
Addition in IMGT/GENE-DB of:
IMGT000299 (IMGT000299): first locus annotation.
IMGT000300 (IMGT000300): second locus annotation.
15 bornean orangutan (Pongo pygmaeus) TRGV genes corresponding to 19 allelic sequences.
5 bornean orangutan (Pongo pygmaeus) TRGJ genes corresponding to 5 allelic sequence.
2 bornean orangutan (Pongo pygmaeus) TRGC genes corresponding to 2 allelic sequence.

Addition of bornean orangutan (Pongo pygmaeus) TRG locus annotation of IMGT locus reference sequence IMGT000299, IMGT000300

Creation of 13 web pages in IMGT Repertoire (IG and TR):
Locus representation: bornean orangutan (Pongo pygmaeus) TRG.
Locus description:bornean orangutan (Pongo pygmaeus) TRG.
Locus gene order:bornean orangutan (Pongo pygmaeus) TRG.
Locus in genome assembly:bornean orangutan (Pongo pygmaeus) TRG.
Potential germline repertoire:bornean orangutan (Pongo pygmaeus) TRGV and TRGJ genes.
Alignment of alleles:bornean orangutan (Pongo pygmaeus) TRGV.
Alignment of alleles:bornean orangutan (Pongo pygmaeus) TRGJ.
Alignment of alleles:bornean orangutan (Pongo pygmaeus) TRGC.
Protein displays:bornean orangutan (Pongo pygmaeus) TRGV.
Protein displays:bornean orangutan (Pongo pygmaeus) TRGJ.
Protein displays:bornean orangutan (Pongo pygmaeus) TRGC.
Colliers de Perles:bornean orangutan (Pongo pygmaeus) TRGV.
Colliers de Perles:bornean orangutan (Pongo pygmaeus) TRGC.

11 February 2026 - UPDATE 2026: Human (Homo sapiens) IGL in IMGT/GENE-DB, IMGT/LIGM-DB and IMGT Web resources

Update of the human (Homo sapiens) IGL reference directory (IMGT/GENE-DB data updates).
Addition in IMGT/GENE-DB of:
9 human (Homo sapiens) IGLV new alleles.
2 human (Homo sapiens) IGLC new alleles.

Addition of IGL locus annotation IMGT000316 and IMGT000317 in IMGT/LIGM-DB.

Update of 6 web pages in IMGT Repertoire (IG and TR):
Dynamic Gene table: human (Homo sapiens) IGLV.
Dynamic Gene table: human (Homo sapiens) IGLC.
Alignment of alleles: human (Homo sapiens) IGLV.
Alignment of alleles: human (Homo sapiens) IGLC.
Locus representation: human ((Homo sapiens) IGL.
Locus in genome assembly: human (Homo sapiens) IGL.

26 January 2026 - CREATION 2026: Chimpanzee (Pan troglodytes) TRA/TRD reference directory in IMGT/GENE-DB, IMGT/LIGM-DB and IMGT Web resources

Addition of TRA/TRD annotation of IMGT locus reference sequence IMGT000279 in IMGT/LIGM-DB.
Addition of TRA/TRD annotation IMGT000283 in IMGT/LIGM-DB.
Addition of TRA/TRD annotation IMGT000286 in IMGT/LIGM-DB.
Creation of the chimpanzee (Pan troglodytes) TRA/TRD reference directory (IMGT/GENE-DB data updates).
Addition in IMGT/GENE-DB of:
65 chimpanzee (Pan troglodytes) TRAV genes corresponding to 88 allelic sequences.
61 chimpanzee (Pan troglodytes) TRAJ genes corresponding to 64 allelic sequences.
1 chimpanzee (Pan troglodytes) TRAC gene corresponding to 1 allelic sequence.
3 chimpanzee (Pan troglodytes) TRDV genes corresponding to 5 allelic sequences.
4 chimpanzee (Pan troglodytes) TRDJ genes corresponding to 4 allelic sequences.
3 chimpanzee (Pan troglodytes) TRDD genes corresponding to 3 allelic sequences.
1 chimpanzee (Pan troglodytes) TRDC gene corresponding to 1 allelic sequence.

Creation and update of 34 web pages in IMGT Repertoire (IG and TR):
Locus representation: chimpanzee (Pan troglodytes) TRA/TRD.
Locus description: chimpanzee (Pan troglodytes) TRA.
Locus description: chimpanzee (Pan troglodytes) TRD.
Locus in genome assembly: chimpanzee (Pan troglodytes) TRA/TRD.
Locus gene order: chimpanzee (Pan troglodytes) TRA/TRD.
Potential germline repertoire: chimpanzee (Pan troglodytes) TRAV and TRAJ genes.
Potential germline repertoire: chimpanzee (Pan troglodytes) TRDV, TRDD and TRDJ genes.
Locus bornes: TRA/TRD locus 5' and 3' bornes.
Dynamic gene table: chimpanzee (Pan troglodytes) TRAV.
Dynamic gene table: chimpanzee (Pan troglodytes) TRAJ.
Dynamic gene table: chimpanzee (Pan troglodytes) TRAC.
Dynamic gene table: chimpanzee (Pan troglodytes) TRDV.
Dynamic gene table: chimpanzee (Pan troglodytes) TRDJ.
Dynamic gene table: chimpanzee (Pan troglodytes) TRDD.
Dynamic gene table: chimpanzee (Pan troglodytes) TRDC.
[CDR1-IMGT.CDR2-IMGT.CDR3-IMGT] lengths for V genes per species and locus: chimpanzee (Pan troglodytes) TRA locus.
[CDR1-IMGT.CDR2-IMGT.CDR3-IMGT] lengths for V genes per species and locus: chimpanzee (Pan troglodytes) TRD locus.
Protein displays: chimpanzee (Pan troglodytes) TRAV.
Protein displays: chimpanzee (Pan troglodytes) TRAJ.
Protein displays: chimpanzee (Pan troglodytes) TRAC.
Protein displays: chimpanzee (Pan troglodytes) TRDV.
Protein displays: chimpanzee (Pan troglodytes) TRDJ.
Protein displays: chimpanzee (Pan troglodytes) TRDC.
Alignment of alleles: chimpanzee (Pan troglodytes) TRAV.
Alignment of alleles: chimpanzee (Pan troglodytes) TRAJ.
Alignment of alleles: chimpanzee (Pan troglodytes) TRAC.
Alignment of alleles: chimpanzee (Pan troglodytes) TRDV.
Alignment of alleles: chimpanzee (Pan troglodytes) TRDJ.
Alignment of alleles: chimpanzee (Pan troglodytes) TRDD.
Alignment of alleles: chimpanzee (Pan troglodytes) TRDC.
Colliers de Perles: chimpanzee (Pan troglodytes) TRAV.
Colliers de Perles: chimpanzee (Pan troglodytes) TRAC.
Colliers de Perles: chimpanzee (Pan troglodytes) TRDV.
Colliers de Perles: chimpanzee (Pan troglodytes) TRDC.

21 January 2026 - UPDATE 2026: Human (Homo sapiens) TRA/TRD in IMGT/GENE-DB, IMGT/LIGM-DB and IMGT Web resources

Update of the human (Homo sapiens) TRA/TRD reference directory (IMGT/GENE-DB data updates).
Addition in IMGT/GENE-DB of:
11 human (Homo sapiens) TRAV new alleles.
1 human (Homo sapiens) TRDV new allele.
1 human (Homo sapiens) TRDJ new allele.

Addition of TRA/D locus annotation IMGT000313 in IMGT/LIGM-DB.

Update of 16 web pages in IMGT Repertoire (IG and TR):
Dynamic Gene table: human (Homo sapiens) TRAV.
Dynamic Gene table: human (Homo sapiens) TRAJ.
Dynamic Gene table: human (Homo sapiens) TRAC.
Dynamic Gene table: human (Homo sapiens) TRDV.
Dynamic Gene table: human (Homo sapiens) TRDD.
Dynamic Gene table: human (Homo sapiens) TRDJ.
Dynamic Gene table: human (Homo sapiens) TRDC.
Alignment of alleles: human (Homo sapiens) TRAV.
Alignment of alleles: human (Homo sapiens) TRAJ.
Alignment of alleles: human (Homo sapiens) TRAC.
Alignment of alleles: human (Homo sapiens) TRDV.
Alignment of alleles: human (Homo sapiens) TRDD.
Alignment of alleles: human (Homo sapiens) TRDJ.
Alignment of alleles: human (Homo sapiens) TRDC.
Locus representation: human ((Homo sapiens) TRA/TRD.
Locus in genome assembly: human (Homo sapiens) TRA/TRD.

20 January 2026 - UPDATE 2026: Human (Homo sapiens) IG loci in IMGT/GENE-DB, IMGT/LIGM-DB and IMGT Web resources

Update of the Human (Homo sapiens) IGH, IGL and IGK reference directory (IMGT/GENE-DB data updates).

Addition of IGH annotation BK063799 in IMGT/LIGM-DB.

Addition of IGH annotation BK063800 in IMGT/LIGM-DB.

Addition of IGH annotation BK063802 in IMGT/LIGM-DB.

Addition of IGH annotation BK063801 in IMGT/LIGM-DB.

Addition of IGH annotation BK068298 in IMGT/LIGM-DB.

Addition of IGH annotation BK068299 in IMGT/LIGM-DB.

Addition of IGH annotation IMGT000158 in IMGT/LIGM-DB.

Addition of IGH annotation IMGT000177 in IMGT/LIGM-DB.

Addition of IGH annotation IMGT000173 in IMGT/LIGM-DB.

Addition of IGH annotation IMGT000174 in IMGT/LIGM-DB.

Addition of IGH annotation IMGT000175 in IMGT/LIGM-DB.

Addition of IGH annotation IMGT000176 in IMGT/LIGM-DB.

Addition of IGH annotation IMGT000197 in IMGT/LIGM-DB.

Addition of IGH annotation IMGT000198 in IMGT/LIGM-DB.

Addition of IGH annotation IMGT000199 in IMGT/LIGM-DB.

Addition of IGH annotation IMGT000207 in IMGT/LIGM-DB.

Addition of IGH annotation IMGT000208 in IMGT/LIGM-DB.

Addition of IGH annotation BK070981 in IMGT/LIGM-DB.

Addition of IGH annotation BK070982 in IMGT/LIGM-DB.

Addition of IGH annotation IMGT000141 in IMGT/LIGM-DB.

Addition of IGH annotation IMGT000129 in IMGT/LIGM-DB.

Addition of IGH annotation IMGT000111 in IMGT/LIGM-DB.

Addition of IGL annotation IMGT000225 in IMGT/LIGM-DB.

Addition of IGL annotation IMGT000280 in IMGT/LIGM-DB.

Addition of IGL annotation IMGT000293 in IMGT/LIGM-DB.

Addition of IGL annotation IMGT000312 in IMGT/LIGM-DB.

Addition of IGK annotation IMGT000273 in IMGT/LIGM-DB.

Addition of IGK annotation IMGT000100 in IMGT/LIGM-DB.

Addition of IGK annotation IMGT000281 in IMGT/LIGM-DB.

Addition of IGK annotation IMGT000305 in IMGT/LIGM-DB.

Addition of IGK annotation IMGT000308 in IMGT/LIGM-DB.

Update of 48 web pages in IMGT Repertoire (IG and TR):
Dynamic Gene table: Human (Homo sapiens) IGHV.
Dynamic Gene table: Human (Homo sapiens) IGHV clans.
Dynamic Gene table: Human (Homo sapiens) IGHJ.
Dynamic Gene table: Human (Homo sapiens) IGHC.
Dynamic Gene table: Human (Homo sapiens) IGHD.
Dynamic Gene table: Human (Homo sapiens) IGKV.
Dynamic Gene table: Human (Homo sapiens) IGKV clans.
Dynamic Gene table: Human (Homo sapiens) IGKJ.
Dynamic Gene table: Human (Homo sapiens) IGKC.
Dynamic Gene table: Human (Homo sapiens) IGLV.
Dynamic Gene table: Human (Homo sapiens) IGLV clans.
Dynamic Gene table: Human (Homo sapiens) IGLJ.
Dynamic Gene table: Human (Homo sapiens) IGLC.
Alignment of alleles: Human (Homo sapiens) IGHV.
Alignment of alleles: Human (Homo sapiens) IGHJ.
Alignment of alleles: Human (Homo sapiens) IGHD.
Alignment of alleles: Human (Homo sapiens) IGHC.
Alignment of alleles: Human (Homo sapiens) IGLV.
Alignment of alleles: Human (Homo sapiens) IGLJ.
Alignment of alleles: Human (Homo sapiens) IGLC.
Alignment of alleles: Human (Homo sapiens) IGKV.
Alignment of alleles: Human (Homo sapiens) IGKJ.
Alignment of alleles: Human (Homo sapiens) IGKC.
Protein displays: Human (Homo sapiens) IGHV.
Protein displays: Human (Homo sapiens) IGHC.
Protein displays: Human (Homo sapiens) IGLV.
Protein displays: Human (Homo sapiens) IGLJ.
Protein displays: Human (Homo sapiens) IGLC.
Protein displays: Human (Homo sapiens) IGKV.
Colliers de Perles: Human (Homo sapiens) IGHV.
Colliers de Perles: Human (Homo sapiens) IGHC.
Colliers de Perles: Human (Homo sapiens) IGLV.
Colliers de Perles: Human (Homo sapiens) IGLC.
Colliers de Perles: Human (Homo sapiens) IGKV.
[CDR1-IMGT.CDR2-IMGT.CDR3-IMGT] lengths for V genes per species and locus: Human (Homo sapiens) IGH locus.
[CDR1-IMGT.CDR2-IMGT.CDR3-IMGT] lengths for V genes per species and locus: Human (Homo sapiens) IGL locus.
[CDR1-IMGT.CDR2-IMGT.CDR3-IMGT] lengths for V genes per species and locus: Human (Homo sapiens) IGK locus.
Locus representation: Human (Homo sapiens) IGH.
Locus representation: Human (Homo sapiens) IGL.
Locus representation: Human (Homo sapiens) IGK.
Locus gene order: Human (Homo sapiens) IGH.
Locus gene order: Human (Homo sapiens) IGL.
Locus gene order: Human (Homo sapiens) IGK.
Locus in genome assembly: Human (Homo sapiens) IGH.
Locus in genome assembly: Human (Homo sapiens) IGL.
Locus in genome assembly: Human (Homo sapiens) IGK.
Potential germline repertoire: Human (Homo sapiens) IGLV and IGLJ genes.
Potential germline repertoire: Human (Homo sapiens) IGKV and IGKJ genes.

09 January 2026 - UPDATE 2026: Human (Homo sapiens) TRA/TRD in IMGT/GENE-DB, IMGT/LIGM-DB and IMGT Web resources

Update of the human (Homo sapiens) TRA/TRD reference directory (IMGT/GENE-DB data updates).
Addition in IMGT/GENE-DB of:
2 human (Homo sapiens) TRAV new alleles.
1 human (Homo sapiens) TRAJ new allele.

Addition of TRA/D locus annotation IMGT000309 in IMGT/LIGM-DB.

Update of 16 web pages in IMGT Repertoire (IG and TR):
Dynamic Gene table: human (Homo sapiens) TRAV.
Dynamic Gene table: human (Homo sapiens) TRAJ.
Dynamic Gene table: human (Homo sapiens) TRAC.
Dynamic Gene table: human (Homo sapiens) TRDV.
Dynamic Gene table: human (Homo sapiens) TRDD.
Dynamic Gene table: human (Homo sapiens) TRDJ.
Dynamic Gene table: human (Homo sapiens) TRDC.
Alignment of alleles: human (Homo sapiens) TRAV.
Alignment of alleles: human (Homo sapiens) TRAJ.
Alignment of alleles: human (Homo sapiens) TRAC.
Alignment of alleles: human (Homo sapiens) TRDV.
Alignment of alleles: human (Homo sapiens) TRDD.
Alignment of alleles: human (Homo sapiens) TRDJ.
Alignment of alleles: human (Homo sapiens) TRDC.
Locus representation: human ((Homo sapiens) TRA/TRD.
Locus in genome assembly: human (Homo sapiens) TRA/TRD.

08 January 2026 - UPDATE 2026: Chimpanzee (Pan troglodytes) TRG in IMGT/GENE-DB, IMGT/LIGM-DB and IMGT Web resources

Update of the chimpanzee (Pan troglodytes) TRG reference directory (IMGT/GENE-DB data updates).
Addition in IMGT/GENE-DB of:
7 chimpanzee (Pan troglodytes) TRGV new alleles.
1 chimpanzee (Pan troglodytes) TRGJ new allele.
2 chimpanzee (Pan troglodytes) TRGC new alleles.

Addition of TRG annotation IMGT000311 in IMGT/LIGM-DB.

Update of 8 web pages in IMGT Repertoire (IG and TR):
Dynamic Gene table: chimpanzee (Pan troglodytes) TRGV.
Dynamic Gene table: chimpanzee (Pan troglodytes) TRGJ.
Dynamic Gene table: chimpanzee (Pan troglodytes) TRGC.
Alignment of alleles: chimpanzee (Pan troglodytes) TRGV.
Alignment of alleles: chimpanzee (Pan troglodytes) TRGJ.
Alignment of alleles: chimpanzee (Pan troglodytes) TRGC.
Locus gene order: chimpanzee (Pan troglodytes) TRG.
Locus in genome assembly: chimpanzee (Pan troglodytes) TRG.

2025

30 December 2025 - UPDATE 2025: Human (Homo sapiens) TRB in IMGT/GENE-DB, IMGT/LIGM-DB and IMGT Web resources

Update of the human (Homo sapiens) TRB reference directory (IMGT/GENE-DB data updates).
Addition in IMGT/GENE-DB of:
4 human (Homo sapiens) TRBV new alleles.

Addition of TRB annotations IMGT000303 and IMGT000306 in IMGT/LIGM-DB.

Update of 10 web pages in IMGT Repertoire (IG and TR):
Dynamic Gene table: Human (Homo sapiens) TRBV.
Dynamic Gene table: Human (Homo sapiens) TRBD.
Dynamic Gene table: Human (Homo sapiens) TRBJ.
Dynamic Gene table: Human (Homo sapiens) TRBC.
Alignment of alleles: human (Homo sapiens) TRBV.
Alignment of alleles: human (Homo sapiens) TRBD.
Alignment of alleles: human (Homo sapiens) TRBJ.
Alignment of alleles: human (Homo sapiens) TRBC.
Locus representation: Human (Homo sapiens) TRB.
Locus in genome assembly: human (Homo sapiens) TRB.

12 December 2025 - UPDATE 2025: Human (Homo sapiens) TRA/TRD in IMGT/GENE-DB, IMGT/LIGM-DB and IMGT Web resources

Update of the human (Homo sapiens) TRA/TRD reference directory (IMGT/GENE-DB data updates).
Addition in IMGT/GENE-DB of:
8 human (Homo sapiens) TRAV new alleles.

Addition of TRA/D locus annotation IMGT000292 in IMGT/LIGM-DB.

Update of 16 web pages in IMGT Repertoire (IG and TR):
Dynamic Gene table: human (Homo sapiens) TRAV.
Dynamic Gene table: human (Homo sapiens) TRAJ.
Dynamic Gene table: human (Homo sapiens) TRAC.
Dynamic Gene table: human (Homo sapiens) TRDV.
Dynamic Gene table: human (Homo sapiens) TRDD.
Dynamic Gene table: human (Homo sapiens) TRDJ.
Dynamic Gene table: human (Homo sapiens) TRDC.
Alignment of alleles: human (Homo sapiens) TRAV.
Alignment of alleles: human (Homo sapiens) TRAJ.
Alignment of alleles: human (Homo sapiens) TRAC.
Alignment of alleles: human (Homo sapiens) TRDV.
Alignment of alleles: human (Homo sapiens) TRDD.
Alignment of alleles: human (Homo sapiens) TRDJ.
Alignment of alleles: human (Homo sapiens) TRDC.
Locus representation: human ((Homo sapiens) TRA/TRD.
Locus in genome assembly: human (Homo sapiens) TRA/TRD.

13 November 2025 - UPDATE 2025: Human (Homo sapiens) TRB in IMGT/GENE-DB, IMGT/LIGM-DB and IMGT Web resources

Update of the human (Homo sapiens) TRB reference directory (IMGT/GENE-DB data updates).
Addition in IMGT/GENE-DB of:
10 human (Homo sapiens) TRBV new alleles.
1 human (Homo sapiens) TRBC new alleles.

Addition of TRB annotation IMGT000287 in IMGT/LIGM-DB.

Creation of 1 web page in IMGT Repertoire (IG and TR):
Locus description: Human (Homo sapiens) TRB

Update of 11 web pages in IMGT Repertoire (IG and TR):
Dynamic Gene table: Human (Homo sapiens) TRBV.
Dynamic Gene table: Human (Homo sapiens) TRBD.
Dynamic Gene table: Human (Homo sapiens) TRBJ.
Dynamic Gene table: Human (Homo sapiens) TRBC.
Alignment of alleles: human (Homo sapiens) TRBV.
Alignment of alleles: human (Homo sapiens) TRBD.
Alignment of alleles: human (Homo sapiens) TRBJ.
Alignment of alleles: human (Homo sapiens) TRBC.
Locus representation: Human (Homo sapiens) TRB.
Locus gene order: human (Homo sapiens) TRB.
Locus in genome assembly: human (Homo sapiens) TRB.

12 November 2025 - UPDATE 2025: Human (Homo sapiens) TRA/TRD in IMGT/GENE-DB, IMGT/LIGM-DB and IMGT Web resources

Update of the human (Homo sapiens) TRA/TRD reference directory (IMGT/GENE-DB data updates).
Addition in IMGT/GENE-DB of:
3 human (Homo sapiens) TRAV new alleles.

Addition of TRA/D locus annotation IMGT000290 in IMGT/LIGM-DB.

Creation of 2 web pages in IMGT Repertoire (IG and TR):
Locus description: human (Homo sapiens) TRA.
Locus description: human (Homo sapiens) TRD.

Update of 17 web pages in IMGT Repertoire (IG and TR):
Dynamic Gene table: human (Homo sapiens) TRAV.
Dynamic Gene table: human (Homo sapiens) TRAJ.
Dynamic Gene table: human (Homo sapiens) TRAC.
Dynamic Gene table: human (Homo sapiens) TRDV.
Dynamic Gene table: human (Homo sapiens) TRDD.
Dynamic Gene table: human (Homo sapiens) TRDJ.
Dynamic Gene table: human (Homo sapiens) TRDC.
Alignment of alleles: human (Homo sapiens) TRAV.
Alignment of alleles: human (Homo sapiens) TRAJ.
Alignment of alleles: human (Homo sapiens) TRAC.
Alignment of alleles: human (Homo sapiens) TRDV.
Alignment of alleles: human (Homo sapiens) TRDD.
Alignment of alleles: human (Homo sapiens) TRDJ.
Alignment of alleles: human (Homo sapiens) TRDC.
Locus representation: human ((Homo sapiens) TRA/TRD.
Locus in genome assembly: human (Homo sapiens) TRA/TRD.
Locus gene order: human (Homo sapiens) TRA/TRD.

25 October 2025 - CREATION and UPDATE 2025: Bornean orangutan (Pongo pygmaeus) TRB in IMGT/GENE-DB, IMGT/LIGM-DB and IMGT Web resources

Creation of the bornean orangutan (Pongo pygmaeus) TRB reference directory (IMGT/GENE-DB data updates).
Addition in IMGT/GENE-DB of:
IMGT000284 (IMGT000284): first locus annotation.
80 bornean orangutan (Pongo pygmaeus) TRBV genes corresponding to 80 allelic sequences.
2 bornean orangutan (Pongo pygmaeus) TRBD genes corresponding to 2 allelic sequences.
14 bornean orangutan (Pongo pygmaeus) TRBJ genes corresponding to 14 allelic sequence.
2 bornean orangutan (Pongo pygmaeus) TRBC genes corresponding to 2 allelic sequence.

Addition of bornean orangutan (Pongo pygmaeus) TRB locus annotation of IMGT locus reference sequence IMGT000284

Creation of 14 web pages in IMGT Repertoire (IG and TR):
Locus representation: bornean orangutan (Pongo pygmaeus) TRB.
Locus description:bornean orangutan (Pongo pygmaeus) TRB.
Locus gene order:bornean orangutan (Pongo pygmaeus) TRB.
Locus in genome assembly:bornean orangutan (Pongo pygmaeus) TRB.
Potential germline repertoire:bornean orangutan (Pongo pygmaeus) TRBV, TRBD and TRBJ genes.
Alignment of alleles:bornean orangutan (Pongo pygmaeus) TRBV.
Alignment of alleles:bornean orangutan (Pongo pygmaeus) TRBD.
Alignment of alleles:bornean orangutan (Pongo pygmaeus) TRBJ.
Alignment of alleles:bornean orangutan (Pongo pygmaeus) TRBC.
Protein displays:bornean orangutan (Pongo pygmaeus) TRBV.
Protein displays:bornean orangutan (Pongo pygmaeus) TRBJ.
Protein displays:bornean orangutan (Pongo pygmaeus) TRBC.
Colliers de Perles:bornean orangutan (Pongo pygmaeus) TRBV.
Colliers de Perles:bornean orangutan (Pongo pygmaeus) TRBC.

14 October 2025 - CREATION and UPDATE 2025: Sumatran orangutan (Pongo abelii) IGK in IMGT/GENE-DB, IMGT/LIGM-DB and IMGT Web resources

Update of the sumatran orangutan (Pongo abelii) IGK reference directory (IMGT/GENE-DB data updates).
Addition in IMGT/GENE-DB of:
IMGT000244 (IMGT000244)IMGT000245 (IMGT000245):
3 sumatran orangutan (Pongo abelii) IGKV genes corresponding to 3 allelic sequences.
72 sumatran orangutan (Pongo abelii) IGKV allelic sequences.

Addition of sumatran orangutan (Pongo abelii) IGK locus annotation of IMGT locus reference sequence IMGT000244 IMGT000245 IMGT000201 IMGT000202

Update of 14 web pages in IMGT Repertoire (IG and TR):
Locus representation: sumatran orangutan (Pongo abelii) IGK.
Locus description:sumatran orangutan (Pongo abelii) IGK.
Locus gene order:sumatran orangutan (Pongo abelii) IGK.
Locus in genome assembly:sumatran orangutan (Pongo abelii) IGK.
Potential germline repertoire:sumatran orangutan (Pongo abelii) IGKV, IGKD and IGKJ genes.
Alignment of alleles:sumatran orangutan (Pongo abelii) IGKV.
Alignment of alleles:sumatran orangutan (Pongo abelii) IGKD.
Alignment of alleles:sumatran orangutan (Pongo abelii) IGKJ.
Alignment of alleles:sumatran orangutan (Pongo abelii) IGKC.
Protein displays:sumatran orangutan (Pongo abelii) IGKV.
Protein displays:sumatran orangutan (Pongo abelii) IGKJ.
Protein displays:sumatran orangutan (Pongo abelii) IGKC.
Colliers de Perles:sumatran orangutan (Pongo abelii) IGKV.
Colliers de Perles:sumatran orangutan (Pongo abelii) IGKC.

29 September 2025 - CREATION and UPDATE 2025: Bornean orangutan (Pongo pygmaeus) IGK in IMGT/GENE-DB, IMGT/LIGM-DB and IMGT Web resources

Update of the bornean orangutan (Pongo pygmaeus) IGK reference directory (IMGT/GENE-DB data updates).
Addition in IMGT/GENE-DB of:
IMGT000276 (IMGT000276): second locus annotation.
4 bornean orangutan (Pongo pygmaeus) IGKV genes corresponding to 4 allelic sequences.
47 bornean orangutan (Pongo pygmaeus) IGKV allelic sequences.
1 bornean orangutan (Pongo pygmaeus) IGKJ allelic sequence.
1 bornean orangutan (Pongo pygmaeus) IGKC allelic sequence.

Addition of bornean orangutan (Pongo pygmaeus) IGK locus annotation of IMGT locus reference sequence IMGT000276

Update of 14 web pages in IMGT Repertoire (IG and TR):
Locus representation: bornean orangutan (Pongo pygmaeus) IGK.
Locus description:bornean orangutan (Pongo pygmaeus) IGK.
Locus gene order:bornean orangutan (Pongo pygmaeus) IGK.
Locus in genome assembly:bornean orangutan (Pongo pygmaeus) IGK.
Potential germline repertoire:bornean orangutan (Pongo pygmaeus) IGKV, IGKD and IGKJ genes.
Alignment of alleles:bornean orangutan (Pongo pygmaeus) IGKV.
Alignment of alleles:bornean orangutan (Pongo pygmaeus) IGKD.
Alignment of alleles:bornean orangutan (Pongo pygmaeus) IGKJ.
Alignment of alleles:bornean orangutan (Pongo pygmaeus) IGKC.
Protein displays:bornean orangutan (Pongo pygmaeus) IGKV.
Protein displays:bornean orangutan (Pongo pygmaeus) IGKJ.
Protein displays:bornean orangutan (Pongo pygmaeus) IGKC.
Colliers de Perles:bornean orangutan (Pongo pygmaeus) IGKV.
Colliers de Perles:bornean orangutan (Pongo pygmaeus) IGKC.

27 September 2025 - CREATION and UPDATE 2025: Bornean orangutan (Pongo pygmaeus) IGH in IMGT/GENE-DB, IMGT/LIGM-DB and IMGT Web resources

Update of the bornean orangutan (Pongo pygmaeus) IGH reference directory (IMGT/GENE-DB data updates).
Addition in IMGT/GENE-DB of:
IMGT000230 (IMGT000230): second locus annotation.
10 bornean orangutan (Pongo pygmaeus) IGHV genes corresponding to 10 allelic sequence.
86 bornean orangutan (Pongo pygmaeus) IGHV allelic sequences.
3 bornean orangutan (Pongo pygmaeus) IGHJ allelic sequence.
3 bornean orangutan (Pongo pygmaeus) IGHD allelic sequence.
5 bornean orangutan (Pongo pygmaeus) IGHC allelic sequence.

Addition of bornean orangutan (Pongo pygmaeus) IGH locus annotation of IMGT locus reference sequence IMGT000230

Update of 14 web pages in IMGT Repertoire (IG and TR):
Locus representation: bornean orangutan (Pongo pygmaeus) IGH.
Locus description:bornean orangutan (Pongo pygmaeus) IGH.
Locus gene order:bornean orangutan (Pongo pygmaeus) IGH.
Locus in genome assembly:bornean orangutan (Pongo pygmaeus) IGH.
Potential germline repertoire:bornean orangutan (Pongo pygmaeus) IGHV, IGHD and IGHJ genes.
Alignment of alleles:bornean orangutan (Pongo pygmaeus) IGHV.
Alignment of alleles:bornean orangutan (Pongo pygmaeus) IGHD.
Alignment of alleles:bornean orangutan (Pongo pygmaeus) IGHJ.
Alignment of alleles:bornean orangutan (Pongo pygmaeus) IGHC.
Protein displays:bornean orangutan (Pongo pygmaeus) IGHV.
Protein displays:bornean orangutan (Pongo pygmaeus) IGHJ.
Protein displays:bornean orangutan (Pongo pygmaeus) IGHC.
Colliers de Perles:bornean orangutan (Pongo pygmaeus) IGHV.
Colliers de Perles:bornean orangutan (Pongo pygmaeus) IGHC.

27 September 2025 - CREATION and UPDATE 2025: Sumatran orangutan (Pongo abelii) IGH in IMGT/GENE-DB, IMGT/LIGM-DB and IMGT Web resources

Update of the sumatran orangutan (Pongo abelii) IGH reference directory (IMGT/GENE-DB data updates).
Addition in IMGT/GENE-DB of:
IMGT000206 (IMGT000206): second locus annotation.
IMGT000121 (IMGT000121): third locus annotation.
23 sumatran orangutan (Pongo abelii) IGHV genes corresponding to 23 allelic sequence.
136 sumatran orangutan (Pongo abelii) IGHV allelic sequences.
3 sumatran orangutan (Pongo abelii) IGHD allelic sequence.
4 sumatran orangutan (Pongo abelii) IGHJ allelic sequence.
2 sumatran orangutan (Pongo abelii) IGHC genes corresponding to 2 allelic sequence.
14 sumatran orangutan (Pongo abelii) IGHC allelic sequence.

Addition of sumatran orangutan (Pongo abelii) IGH locus annotation of IMGT locus reference sequence IMGT000206 IMGT000121 IMGT000157 IMGT000167

Update of 14 web pages in IMGT Repertoire (IG and TR):
Locus representation: sumatran orangutan (Pongo abelii) IGH.
Locus description:sumatran orangutan (Pongo abelii) IGH.
Locus gene order:sumatran orangutan (Pongo abelii) IGH.
Locus in genome assembly:sumatran orangutan (Pongo abelii) IGH.
Potential germline repertoire:sumatran orangutan (Pongo abelii) IGHV, IGHD and IGHJ genes.
Alignment of alleles:sumatran orangutan (Pongo abelii) IGHV.
Alignment of alleles:sumatran orangutan (Pongo abelii) IGHD.
Alignment of alleles:sumatran orangutan (Pongo abelii) IGHJ.
Alignment of alleles:sumatran orangutan (Pongo abelii) IGHC.
Protein displays:sumatran orangutan (Pongo abelii) IGHV.
Protein displays:sumatran orangutan (Pongo abelii) IGHJ.
Protein displays:sumatran orangutan (Pongo abelii) IGHC.
Colliers de Perles:sumatran orangutan (Pongo abelii) IGHV.
Colliers de Perles:sumatran orangutan (Pongo abelii) IGHC.

24 September 2025 - CREATION and UPDATE 2025: Sumatran orangutan (Pongo abelii) IGL in IMGT/GENE-DB, IMGT/LIGM-DB and IMGT Web resources

Update of the sumatran orangutan (Pongo abelii) IGL reference directory (IMGT/GENE-DB data updates).
Addition in IMGT/GENE-DB of:
IMGT000246 (IMGT000246)IMGT000247 (IMGT000247):
94 sumatran orangutan (Pongo abelii) IGLV allelic sequences.
2 sumatran orangutan (Pongo abelii) IGLJ allelic sequences.
6 sumatran orangutan (Pongo abelii) IGLC allelic sequences.
2 sumatran orangutan (Pongo abelii) VPREB1 allelic sequences.

Addition of sumatran orangutan (Pongo abelii) IGL locus annotation of IMGT locus reference sequence IMGT000246 IMGT000247 IMGT000248 IMGT000278

Update of 14 web pages in IMGT Repertoire (IG and TR):
Locus representation: sumatran orangutan (Pongo abelii) IGL.
Locus description:sumatran orangutan (Pongo abelii) IGL.
Locus gene order:sumatran orangutan (Pongo abelii) IGL.
Locus in genome assembly:sumatran orangutan (Pongo abelii) IGL.
Potential germline repertoire:sumatran orangutan (Pongo abelii) IGLV, IGLD and IGLJ genes.
Alignment of alleles:sumatran orangutan (Pongo abelii) IGLV.
Alignment of alleles:sumatran orangutan (Pongo abelii) IGLD.
Alignment of alleles:sumatran orangutan (Pongo abelii) IGLJ.
Alignment of alleles:sumatran orangutan (Pongo abelii) IGLC.
Protein displays:sumatran orangutan (Pongo abelii) IGLV.
Protein displays:sumatran orangutan (Pongo abelii) IGLJ.
Protein displays:sumatran orangutan (Pongo abelii) IGLC.
Colliers de Perles:sumatran orangutan (Pongo abelii) IGLV.
Colliers de Perles:sumatran orangutan (Pongo abelii) IGLC.

24 September 2025 - CREATION and UPDATE 2025: Bornean orangutan (Pongo pygmaeus) IGL in IMGT/GENE-DB, IMGT/LIGM-DB and IMGT Web resources

Update of the bornean orangutan (Pongo pygmaeus) IGL reference directory (IMGT/GENE-DB data updates).
Addition in IMGT/GENE-DB of:
IMGT000276 (IMGT000276): second locus annotation.
1 bornean orangutan (Pongo pygmaeus) IGLV genes corresponding to 1 allelic sequence.
58 bornean orangutan (Pongo pygmaeus) IGLV allelic sequences.
2 bornean orangutan (Pongo pygmaeus) IGLJ allelic sequence.
1 bornean orangutan (Pongo pygmaeus) VPREB1 allelic sequence.

Addition of bornean orangutan (Pongo pygmaeus) IGL locus annotation of IMGT locus reference sequence IMGT000276

Update of 14 web pages in IMGT Repertoire (IG and TR):
Locus representation: bornean orangutan (Pongo pygmaeus) IGL.
Locus description:bornean orangutan (Pongo pygmaeus) IGL.
Locus gene order:bornean orangutan (Pongo pygmaeus) IGL.
Locus in genome assembly:bornean orangutan (Pongo pygmaeus) IGL.
Potential germline repertoire:bornean orangutan (Pongo pygmaeus) IGLV, IGLD and IGLJ genes.
Alignment of alleles:bornean orangutan (Pongo pygmaeus) IGLV.
Alignment of alleles:bornean orangutan (Pongo pygmaeus) IGLD.
Alignment of alleles:bornean orangutan (Pongo pygmaeus) IGLJ.
Alignment of alleles:bornean orangutan (Pongo pygmaeus) IGLC.
Protein displays:bornean orangutan (Pongo pygmaeus) IGLV.
Protein displays:bornean orangutan (Pongo pygmaeus) IGLJ.
Protein displays:bornean orangutan (Pongo pygmaeus) IGLC.
Colliers de Perles:bornean orangutan (Pongo pygmaeus) IGLV.
Colliers de Perles:bornean orangutan (Pongo pygmaeus) IGLC.

21 July 2025 - CREATION 2025: Chimpanzee (Pan troglodytes) TRG reference directory in IMGT/GENE-DB, IMGT/LIGM-DB and IMGT Web resources

Addition of TRG annotation of IMGT locus reference sequence IMGT000268 in IMGT/LIGM-DB.
Creation of the chimpanzee (Pan troglodytes) TRG reference directory (IMGT/GENE-DB data updates).
Addition in IMGT/GENE-DB of:
13 chimpanzee (Pan troglodytes) TRGV genes corresponding to 13 allelic sequences.
5 chimpanzee (Pan troglodytes) TRGJ genes corresponding to 5 allelic sequences.
2 chimpanzee (Pan troglodytes) TRGC genes corresponding to 2 allelic sequences.

Creation and update of 18 web pages in IMGT Repertoire (IG and TR):
Locus representation: chimpanzee (Pan troglodytes) TRG.
Locus description: chimpanzee (Pan troglodytes) TRG.
Locus in genome assembly: chimpanzee (Pan troglodytes) TRG.
Locus gene order: chimpanzee (Pan troglodytes) TRG.
Potential germline repertoire: chimpanzee (Pan troglodytes) TRGV and TRGJ genes.
Locus bornes: TRG locus 5' and 3' bornes.
Dynamic gene table: chimpanzee (Pan troglodytes) TRGV.
Dynamic gene table: chimpanzee (Pan troglodytes) TRGJ.
Dynamic gene table: chimpanzee (Pan troglodytes) TRGC.
[CDR1-IMGT.CDR2-IMGT.CDR3-IMGT] lengths for V genes per species and locus: chimpanzee (Pan troglodytes) TRG locus.
Protein displays: chimpanzee (Pan troglodytes) TRGV.
Protein displays: chimpanzee (Pan troglodytes) TRGJ.
Protein displays: chimpanzee (Pan troglodytes) TRGC.
Alignment of alleles: chimpanzee (Pan troglodytes) TRGV.
Alignment of alleles: chimpanzee (Pan troglodytes) TRGJ.
Alignment of alleles: chimpanzee (Pan troglodytes) TRGC.
Colliers de Perles: chimpanzee (Pan troglodytes) TRGV.
Colliers de Perles: chimpanzee (Pan troglodytes) TRGC.

11 June 2025 - UPDATE 2025: house mouse (Mus musculus) IGH reference directory in IMGT/GENE-DB (IMGT/GENE-DB data updates), IMGT/LIGM-DB and IMGT Web resources

Update of the house mouse (Mus musculus) IGH reference directory.
Addition of IMGT000188 (IMGT000188): fourth locus annotation.

Update of 14 web pages in IMGT Repertoire (IG and TR):
Dynamic Gene table: house mouse (Mus musculus) IGHV.
Dynamic Gene table: house mouse (Mus musculus) pseudogenes assigned to clans.
Dynamic Gene table: house mouse (Mus musculus) IGHJ.
Dynamic Gene table: house mouse (Mus musculus) IGHD.
Dynamic Gene table: house mouse (Mus musculus) IGHC.
Alignment of alleles: house mouse (Mus musculus) IGHV.
Alignment of alleles: house mouse (Mus musculus) IGHD.
Alignment of alleles: house mouse (Mus musculus) IGHJ.
Alignment of alleles: house mouse (Mus musculus) IGHC.
Locus representation: house mouse (Mus musculus) IGH.
Locus description: house mouse (Mus musculus) IGH.
Locus gene order: house mouse (Mus musculus) IGH.
Locus in genome assembly: house mouse (Mus musculus) IGH.
Potential germline repertoire per assembly: house mouse (Mus musculus) IGHV, IGHD and IGHJ genes.

14 May 2025 - CREATION 2025: Pig (Sus scrofa) TRG reference directory in IMGT/GENE-DB (IMGT/GENE-DB data updates), IMGT/LIGM-DB and IMGT Web resources

Creation of the pig (Sus scrofa) TRG reference directory (IMGT/GENE-DB data updates).
Addition in IMGT/GENE-DB of:
BK074883 (BK074883): TRG locus annotation.
BK074882 (BK074882): TRG locus annotation.
8 pig (Sus scrofa) TRGV genes corresponding to 14 allelic sequences.
6 pig (Sus scrofa) TRGJ genes corresponding to 6 allelic sequences.
4 pig (Sus scrofa) TRGC genes corresponding to 5 allelic sequences.

Creation of 15 web pages in IMGT Repertoire (IG and TR):
Locus representation: Pig (Sus scrofa) TRG.
Locus description: Pig (Sus scrofa) TRG.
Locus in genome assembly: Pig (Sus scrofa) TRG.
Locus gene order: Pig (Sus scrofa) TRG.
Potential germline repertoire: Pig (Sus scrofa) TRGV and TRGJ genes.
Locus bornes: TRG locus 5' and 3' bornes.
Dynamic gene table: Pig (Sus scrofa) TRGV.
Dynamic gene table: Pig (Sus scrofa) TRGJ.
Dynamic gene table: Pig (Sus scrofa) TRGC.
[CDR1-IMGT.CDR2-IMGT.CDR3-IMGT] lengths for V genes per species and locus: Pig (Sus scrofa) TRG locus.
Alignment of alleles: Pig (Sus scrofa) TRGV.
Alignment of alleles: Pig (Sus scrofa) TRGJ.
Alignment of alleles: Pig (Sus scrofa) TRGC.
Protein displays: Pig (Sus scrofa) TRGV.
Protein displays: Pig (Sus scrofa) TRGJ.
Protein displays: Pig (Sus scrofa) TRGC.
Colliers de Perles: Pig (Sus scrofa) TRGV.
Colliers de Perles: Pig (Sus scrofa) TRGC.

28 March 2025 - CREATION and UPDATE 2025: Sumatran orangutan (Pongo abelii) TRB in IMGT/GENE-DB, IMGT/LIGM-DB and IMGT Web resources

Creation of the sumatran orangutan (Pongo abelii) TRB reference directory (IMGT/GENE-DB data updates).
Addition in IMGT/GENE-DB of:
IMGT000250 (IMGT000250): first locus annotation.
78 sumatran orangutan (Pongo abelii) TRBV genes corresponding to 78 allelic sequences.
2 sumatran orangutan (Pongo abelii) TRBD genes corresponding to 2 allelic sequences.
14 sumatran orangutan (Pongo abelii) TRBJ genes corresponding to 14 allelic sequence.
2 sumatran orangutan (Pongo abelii) TRBC genes corresponding to 2 allelic sequence.

Addition of sumatran orangutan (Pongo abelii) TRB locus annotation of IMGT locus reference sequence IMGT000250

Creation of 14 web pages in IMGT Repertoire (IG and TR):
Locus representation: Sumatran orangutan (Pongo abelii) TRB.
Locus description:Sumatran orangutan (Pongo abelii) TRB.
Locus gene order:Sumatran orangutan (Pongo abelii) TRB.
Locus in genome assembly:Sumatran orangutan (Pongo abelii) TRB.
Potential germline repertoire:Sumatran orangutan (Pongo abelii) TRBV, TRBD and TRBJ genes.
Alignment of alleles:Sumatran orangutan (Pongo abelii) TRBV.
Alignment of alleles:Sumatran orangutan (Pongo abelii) TRBD.
Alignment of alleles:Sumatran orangutan (Pongo abelii) TRBJ.
Alignment of alleles:Sumatran orangutan (Pongo abelii) TRBC.
Protein displays:Sumatran orangutan (Pongo abelii) TRBV.
Protein displays:Sumatran orangutan (Pongo abelii) TRBJ.
Protein displays:Sumatran orangutan (Pongo abelii) TRBC.
Colliers de Perles:Sumatran orangutan (Pongo abelii) TRBV.
Colliers de Perles:Sumatran orangutan (Pongo abelii) TRBC.

2024

27 November 2024 - UPDATE 2024: house mouse (Mus musculus) IGL reference directory in IMGT/GENE-DB (IMGT/GENE-DB data updates), IMGT/LIGM-DB and IMGT Web resources

Update of the house mouse (Mus musculus) IGL reference directory.
Addition of IMGT000211 (IMGT000211): fourth locus annotation.

Update of 9 web pages in IMGT Repertoire (IG and TR):
Dynamic Gene table: house mouse (Mus musculus) IGLV.
Dynamic Gene table: house mouse (Mus musculus) IGLJ.
Dynamic Gene table: house mouse (Mus musculus) IGLC.
Alignment of alleles: house mouse (Mus musculus) IGLV.
Alignment of alleles: house mouse (Mus musculus) IGLC.
Alignment of alleles: house mouse (Mus musculus) IGLJ.
Locus description: house mouse (Mus musculus) IGL.
Locus gene order: house mouse (Mus musculus) IGL.
Locus in genome assembly: house mouse (Mus musculus) IGL.

3 October 2024 - CREATION 2024: American mink (Neogale vison) IGH reference directory in IMGT/GENE-DB (IMGT/GENE-DB data updates), IMGT/LIGM-DB and IMGT Web resources

Creation of the american mink (Neogale vison) IGH reference directory (IMGT/GENE-DB data updates).
Addition in IMGT/GENE-DB of:
IMGT000109 (IMGT000109): IGH locus annotation.
46 American mink (Neogale vison) IGHV genes corresponding to 46 allelic sequences.
10 American mink (Neogale vison) IGHD genes corresponding to 10 allelic sequences.
6 American mink (Neogale vison) IGHJ gene corresponding to 6 allelic sequences.
6 American mink (Neogale vison) IGHC gene corresponding to 6 allelic sequences.

Creation of 23 web pages in IMGT Repertoire (IG and TR):
Locus representation: American mink (Neogale vison) IGH.
Locus description: American mink (Neogale vison) IGH.
Locus in genome assembly: American mink (Neogale vison) IGH.
Locus gene order: American mink (Neogale vison) IGH.
Potential germline repertoire: American mink (Neogale vison) IGHV, IGHD and IGHJ genes.
Locus bornes: IGH locus 5' and 3' bornes.
Dynamic gene table: American mink (Neogale vison) IGHV.
Dynamic gene table: American mink (Neogale vison) IGHD.
Dynamic gene table: American mink (Neogale vison) IGHJ.
Dynamic gene table: American mink (Neogale vison) IGHC.
[CDR1-IMGT.CDR2-IMGT.CDR3-IMGT] lengths for V genes per species and locus: American mink (Neogale vison) IGH locus.
Alignment of alleles: American mink (Neogale vison) IGHV.
Alignment of alleles: American mink (Neogale vison) IGHD.
Alignment of alleles: American mink (Neogale vison) IGHJ.
Alignment of alleles: American mink (Neogale vison) IGHC.
Protein displays: American mink (Neogale vison) IGHV.
Protein displays: American mink (Neogale vison) IGHC.
Colliers de Perles: American mink (Neogale vison) IGHV.
Colliers de Perles: American mink (Neogale vison) IGHC.

12 August 2024 - CREATION 2024: Ferret (Mustela putorius furo) TRA/TRD reference directory in IMGT/GENE-DB (IMGT/GENE-DB data updates), IMGT/LIGM-DB and IMGT Web resources

Creation of the ferret (Mustela putorius furo) TRA/TRD reference directory (IMGT/GENE-DB data updates).
Addition in IMGT/GENE-DB of:
IMGT000196 (IMGT000196): TRA/TRD locus annotation.
96 ferret (Mustela putorius furo) TRAV genes corresponding to 96 allelic sequences.
60 ferret (Mustela putorius furo) TRAJ gene corresponding to 60 allelic sequences.
1 ferret (Mustela putorius furo) TRAC gene corresponding to 1 allelic sequences.
5 ferret (Mustela putorius furo) TRDV genes corresponding to 5 allelic sequences.
2 ferret (Mustela putorius furo) TRDD genes corresponding to 2 allelic sequences.
5 ferret (Mustela putorius furo) TRDJ genes corresponding to 5 allelic sequences.
1 ferret (Mustela putorius furo) TRDC gene corresponding to 1 allelic sequence.

Update and/or creation of 33 web pages in IMGT Repertoire (IG and TR):
Locus representation: Ferret (Mustela putorius furo) TRA/TRD.
Locus description: Ferret (Mustela putorius furo) TRA.
Locus description: Ferret (Mustela putorius furo) TRD.
Locus in genome assembly: Ferret (Mustela putorius furo) TRA/TRD.
Locus gene order: Ferret (Mustela putorius furo) TRA/TRD.
Potential germline repertoire: Ferret (Mustela putorius furo) TRAV and TRAJ genes.
Potential germline repertoire: Ferret (Mustela putorius furo) TRDV, TRDD and TRDJ genes.
Locus bornes: TRA/TRD locus 5' and 3' bornes.
Dynamic gene table: Ferret (Mustela putorius furo) TRAV.
Dynamic gene table: Ferret (Mustela putorius furo) TRAJ.
Dynamic gene table: Ferret (Mustela putorius furo) TRAC.
Dynamic gene table: Ferret (Mustela putorius furo) TRDV.
Dynamic gene table: Ferret (Mustela putorius furo) TRDJ.
Dynamic gene table: Ferret (Mustela putorius furo) TRDD.
Dynamic gene table: Ferret (Mustela putorius furo) TRDC.
[CDR1-IMGT.CDR2-IMGT.CDR3-IMGT] lengths for V genes per species and locus: Ferret (Mustela putorius furo) TRA/TRD locus.
Alignment of alleles: Ferret (Mustela putorius furo) TRAV.
Alignment of alleles: Ferret (Mustela putorius furo) TRAJ.
Alignment of alleles: Ferret (Mustela putorius furo) TRAC.
Alignment of alleles: Ferret (Mustela putorius furo) TRDV.
Alignment of alleles: Ferret (Mustela putorius furo) TRDD.
Alignment of alleles: Ferret (Mustela putorius furo) TRDJ.
Alignment of alleles: Ferret (Mustela putorius furo) TRDC.
Protein displays: Ferret (Mustela putorius furo) TRAV.
Protein displays: Ferret (Mustela putorius furo) TRAJ.
Protein displays: Ferret (Mustela putorius furo) TRAC.
Protein displays: Ferret (Mustela putorius furo) TRDV.
Protein displays: Ferret (Mustela putorius furo) TRDJ.
Protein displays: Ferret (Mustela putorius furo) TRDC.
Colliers de Perles: Ferret (Mustela putorius furo) TRAV.
Colliers de Perles: Ferret (Mustela putorius furo) TRAC.
Colliers de Perles: Ferret (Mustela putorius furo) TRDV.
Colliers de Perles: Ferret (Mustela putorius furo) TRDC.

19 April 2024 - UPDATE 2024: domestic ferret (Mustela putorius furo) TRB reference directory in IMGT/GENE-DB (IMGT/GENE-DB data updates), IMGT/LIGM-DB and IMGT Web resources

Update of the domestic ferret (Mustela putorius furo) TRB reference directory (IMGT/GENE-DB data updates).
Addition in IMGT/GENE-DB of:
IMGT000203 (IMGT000203): second locus annotation.
11 new TRBV alleles of domestic ferret (Mustela putorius furo): TRBV2*02 P, TRBV4-1*02 F, TRBV4-2*02 F, TRBVA*02 P, TRBV6*02 ORF, TRBV7-1*02 P, TRBV7-2*02 F, TRBV8*02 F, TRBV12-1*02 F, TRBV18*02 F, TRBV27*02 F (IMGT000203).
1 new TRBC allele of domestic ferret (Mustela putorius furo):TRBC1*02 F(IMGT000203).

Addition of domestic ferret (Mustela putorius furo) TRB locus annotation of IMGT locus reference sequence IMGT000203

Update of 12 web pages in IMGT Repertoire (IG and TR):
Dynamic Gene table: domestic ferret (Mustela putorius furo) TRBV.
Dynamic Gene table: domestic ferret (Mustela putorius furo) TRBD.
Dynamic Gene table: domestic ferret (Mustela putorius furo) TRBJ.
Dynamic Gene table: domestic ferret (Mustela putorius furo) TRBC.
Alignment of alleles: domestic ferret (Mustela putorius furo) TRBV.
Alignment of alleles: domestic ferret (Mustela putorius furo) TRBC.
Alignment of alleles: domestic ferret (Mustela putorius furo) TRBJ.
Alignment of alleles: domestic ferret (Mustela putorius furo) TRBD.
Locus representation: domestic ferret (Mustela putorius furo) TRB.
Locus description: domestic ferret (Mustela putorius furo) TRB.
Locus in genome assembly: domestic ferret (Mustela putorius furo) TRB.
Potential germline repertoire: domestic ferret (Mustela putorius furo) TRBV, TRBD and TRBJ genes.

19 April 2024 - CREATION 2024: Ferret (Mustela putorius furo) IGL/TRG reference directory in IMGT/GENE-DB (IMGT/GENE-DB data updates), IMGT/LIGM-DB and IMGT Web resources

Creation of the ferret (Mustela putorius furo) IGL/TRG reference directory (IMGT/GENE-DB data updates).
Addition in IMGT/GENE-DB of:
IMGT000131 (IMGT000131)/IMGT000168 (IMGT000168): IGL locus annotation.
136 ferret (Mustela putorius furo) IGLV genes corresponding to 136 allelic sequences.
8 ferret (Mustela putorius furo) IGLJ gene corresponding to 8 allelic sequences.
7 ferret (Mustela putorius furo) IGLC gene corresponding to 7 allelic sequences.

IMGT000195 (IMGT000195): TRG locus annotation.
16 ferret (Mustela putorius furo) TRGV genes corresponding to 16 allelic sequences.
21 ferret (Mustela putorius furo) TRGJ genes corresponding to 21 allelic sequences.
10 ferret (Mustela putorius furo) TRGC gene corresponding to 10 allelic sequence.

Creation of 18 web pages in IMGT Repertoire (IG and TR) for IGK:
Locus representation: Ferret (Mustela putorius furo) TRG.
Locus description:Ferret (Mustela putorius furo) TRG.
Locus gene order:Ferret (Mustela putorius furo) TRG.
Locus in genome assembly:Ferret (Mustela putorius furo) TRG.
Potential germline repertoire:Ferret (Mustela putorius furo) TRGV and TRGJ genes.
Locus bornes: TRG locus 5' and 3' bornes.
Alignment of alleles:Ferret (Mustela putorius furo) TRGV.
Alignment of alleles:Ferret (Mustela putorius furo) TRGJ.
Alignment of alleles:Ferret (Mustela putorius furo) TRGC.
Protein displays:Ferret (Mustela putorius furo) TRGV.
Protein displays:Ferret (Mustela putorius furo) TRGJ.
Protein displays:Ferret (Mustela putorius furo) TRGC.
Gene table: Ferret (Mustela putorius furo) TRGV
Gene table: Ferret (Mustela putorius furo) TRGJ
Gene table: Ferret (Mustela putorius furo) TRGC
Colliers de Perles:Ferret (Mustela putorius furo) TRGV.
Colliers de Perles:Ferret (Mustela putorius furo) TRGC.

Creation of 21 web pages in IMGT Repertoire (IG and TR) for IGL:
Locus representation: Ferret (Mustela putorius furo) IGL.
Locus description:Ferret (Mustela putorius furo) IGL.
Locus gene order:Ferret (Mustela putorius furo) IGL.
Locus in genome assembly:Ferret (Mustela putorius furo) IGL.
Potential germline repertoire:Ferret (Mustela putorius furo) IGLV and IGLJ genes.
Locus bornes: IGL locus 5' and 3' bornes.
Alignment of alleles:Ferret (Mustela putorius furo) IGLV.
Alignment of alleles:Ferret (Mustela putorius furo) IGLJ.
Alignment of alleles:Ferret (Mustela putorius furo) IGLC.
Protein displays:Ferret (Mustela putorius furo) IGLV.
Protein displays:Ferret (Mustela putorius furo) IGLJ.
Protein displays:Ferret (Mustela putorius furo) IGLC.
Gene table: Ferret (Mustela putorius furo) IGLV
Gene table: Ferret (Mustela putorius furo) IGLV (clans)
Gene table: Ferret (Mustela putorius furo) IGLJ
Gene table: Ferret (Mustela putorius furo) IGLC
Colliers de Perles:Ferret (Mustela putorius furo) IGLV.
Colliers de Perles:Ferret (Mustela putorius furo) IGLC.

29 February 2024 - CREATION and UPDATE 2024: Naked mole-rat (Heterocephalus glaber) TRB in IMGT/GENE-DB, IMGT/LIGM-DB and IMGT Web resources

Update of the Naked mole-rat (Heterocephalus glaber) TRB reference directory (IMGT/GENE-DB data updates).
Addition in IMGT/GENE-DB of:
BK064759 (BK064759): third locus annotation.
BK064758 (BK064758): fourth locus annotation.
29 Naked mole-rat (Heterocephalus glaber) TRBV genes corresponding to 33 allelic sequences.
2 Naked mole-rat (Heterocephalus glaber) TRBD gene corresponding to 2 allelic sequence.
13 Naked mole-rat (Heterocephalus glaber) TRBJ gene corresponding to 14 allelic sequence.
2 Naked mole-rat (Heterocephalus glaber) TRBC gene corresponding to 4 allelic sequence.

Addition of naked mole-rat (Heterocephalus glaber) TRB locus annotation of IMGT locus reference sequence BK064759 and BK064758

Update of 20 web pages in IMGT Repertoire (IG and TR):
Locus representation: Naked mole-rat (Heterocephalus glaber) TRB.
Locus description: Naked mole-rat (Heterocephalus glaber) TRB.
Locus gene order: Naked mole-rat (Heterocephalus glaber) TRB.
Locus in genome assembly: Naked mole-rat (Heterocephalus glaber) TRB.
Potential germline repertoire: Naked mole-rat (Heterocephalus glaber) TRBV, TRBJ, TRBD and TRBC genes.
Dynamic gene table: Naked mole-rat (Heterocephalus glaber) TRBV.
Dynamic gene table: Naked mole-rat (Heterocephalus glaber) TRBD.
Locus bornes: TRB locus 5' and 3' bornes.
Dynamic gene table: Naked mole-rat (Heterocephalus glaber) TRBJ.
Dynamic gene table: Naked mole-rat (Heterocephalus glaber) TRBC.
[CDR1-IMGT.CDR2-IMGT.CDR3-IMGT] lengths for V genes per species and locus: Naked mole-rat (Heterocephalus glaber) TRB locus.
Alignment of alleles: Naked mole-rat (Heterocephalus glaber) TRBV.
Alignment of alleles: Naked mole-rat (Heterocephalus glaber) TRBD.
Alignment of alleles: Naked mole-rat (Heterocephalus glaber) TRBJ.
Alignment of alleles: Naked mole-rat (Heterocephalus glaber) TRBC.
Protein displays: Naked mole-rat (Heterocephalus glaber) TRBV .
Protein displays: Naked mole-rat (Heterocephalus glaber) TRBJ.
Protein displays: Naked mole-rat (Heterocephalus glaber) TRBC.
Colliers de Perles: Naked mole-rat (Heterocephalus glaber) TRBV.
Colliers de Perles: Naked mole-rat (Heterocephalus glaber) TRBC.

29 February 2024 - CREATION and UPDATE 2024: Naked mole-rat (Heterocephalus glaber) TRG in IMGT/GENE-DB, IMGT/LIGM-DB and IMGT Web resources

Update of the Naked mole-rat (Heterocephalus glaber) TRG reference directory (IMGT/GENE-DB data updates).
Addition in IMGT/GENE-DB of:
BK064756 (BK064756): third locus annotation.
BK064755 (BK064755): fourth locus annotation.
15 Naked mole-rat (Heterocephalus glaber) TRGV genes corresponding to 17 allelic sequences.
11 Naked mole-rat (Heterocephalus glaber) TRGJ genes corresponding to 13 allelic sequences.
5 Naked mole-rat (Heterocephalus glaber) TRGC genes corresponding to 7 allelic sequences.

Addition of Naked mole-rat (Heterocephalus glaber) TRB locus annotation of IMGT locus reference sequence BK064756 and BK064755

Update of 20 web pages in IMGT Repertoire (IG and TR):
Locus representation: Naked mole-rat (Heterocephalus glaber) TRG.
Locus description: Naked mole-rat (Heterocephalus glaber) TRG.
Locus gene order: Naked mole-rat (Heterocephalus glaber) TRG.
Locus in genome assembly: Naked mole-rat (Heterocephalus glaber) TRG.
Potential germline repertoire: Naked mole-rat (Heterocephalus glaber) TRGV, TRGJ and TRGC genes.
Dynamic gene table: Naked mole-rat (Heterocephalus glaber) TRGV.
Locus bornes: TRG locus 5' and 3' bornes.
Dynamic gene table: Naked mole-rat (Heterocephalus glaber) TRGJ.
Dynamic gene table: Naked mole-rat (Heterocephalus glaber) TRGC.
[CDR1-IMGT.CDR2-IMGT.CDR3-IMGT] lengths for V genes per species and locus: Naked mole-rat (Heterocephalus glaber) TRG locus.
Alignment of alleles: Naked mole-rat (Heterocephalus glaber) TRGV.
Alignment of alleles: Naked mole-rat (Heterocephalus glaber) TRGJ.
Alignment of alleles: Naked mole-rat (Heterocephalus glaber) TRGC.
Protein displays: Naked mole-rat (Heterocephalus glaber) TRGV .
Protein displays: Naked mole-rat (Heterocephalus glaber) TRGJ.
Protein displays: Naked mole-rat (Heterocephalus glaber) TRGC.
Colliers de Perles: Naked mole-rat (Heterocephalus glaber) TRGV.
Colliers de Perles: Naked mole-rat (Heterocephalus glaber) TRGC.

29 February 2024 - CREATION and UPDATE 2024: Naked mole-rat (Heterocephalus glaber) TRA/TRD in IMGT/GENE-DB, IMGT/LIGM-DB and IMGT Web resources

Update of the Naked mole-rat (Heterocephalus glaber) TRA/TRD reference directory (IMGT/GENE-DB data updates).
Addition in IMGT/GENE-DB of:
BK064754 (BK064754): third locus annotation.
79 Naked mole-rat (Heterocephalus glaber) TRAV genes corresponding to 79 allelic sequences.
59 Naked mole-rat (Heterocephalus glaber) TRAJ genes corresponding to 59 allelic sequences.
1 Naked mole-rat (Heterocephalus glaber) TRAC genes corresponding to 1 allelic sequences.
11 Naked mole-rat (Heterocephalus glaber) TRDV genes corresponding to 11 allelic sequences.
4 Naked mole-rat (Heterocephalus glaber) TRDJ genes corresponding to 4 allelic sequences.
3 Naked mole-rat (Heterocephalus glaber) TRDD genes corresponding to 3 allelic sequences.
1 Naked mole-rat (Heterocephalus glaber) TRDC genes corresponding to 1 allelic sequences.

Addition of Naked mole-rat (Heterocephalus glaber) TRA/TRD locus annotation of IMGT locus reference sequence BK064754

Update of 33 web pages in IMGT Repertoire (IG and TR):
Locus representation: Naked mole-rat (Heterocephalus glaber) TRA/TRD.
Locus description: Naked mole-rat (Heterocephalus glaber) TRA.
Locus description: Naked mole-rat (Heterocephalus glaber) TRD.
Locus in genome assembly: Naked mole-rat (Heterocephalus glaber) TRA/TRD.
Locus gene order: Naked mole-rat (Heterocephalus glaber) TRA/TRD.
Potential germline repertoire: Naked mole-rat (Heterocephalus glaber) TRAV and TRAJ genes.
Potential germline repertoire: Naked mole-rat (Heterocephalus glaber) TRDV, TRDD and TRDJ genes.
Locus bornes: TRA/TRD locus 5' and 3' bornes.
Dynamic gene table: Naked mole-rat (Heterocephalus glaber) TRAV.
Dynamic gene table: Naked mole-rat (Heterocephalus glaber) TRAJ.
Dynamic gene table: Naked mole-rat (Heterocephalus glaber) TRAC.
Dynamic gene table: Naked mole-rat (Heterocephalus glaber) TRDV.
Dynamic gene table: Naked mole-rat (Heterocephalus glaber) TRDJ.
Dynamic gene table: Naked mole-rat (Heterocephalus glaber) TRDD.
Dynamic gene table: Naked mole-rat (Heterocephalus glaber) TRDC.
[CDR1-IMGT.CDR2-IMGT.CDR3-IMGT] lengths for V genes per species and locus: Naked mole-rat (Heterocephalus glaber) TRA/TRD locus.
Alignment of alleles: Naked mole-rat (Heterocephalus glaber) TRAV.
Alignment of alleles: Naked mole-rat (Heterocephalus glaber) TRAJ.
Alignment of alleles: Naked mole-rat (Heterocephalus glaber) TRAC.
Alignment of alleles: Naked mole-rat (Heterocephalus glaber) TRDV.
Alignment of alleles: Naked mole-rat (Heterocephalus glaber) TRDJ.
Alignment of alleles: Naked mole-rat (Heterocephalus glaber) TRDD.
Alignment of alleles: Naked mole-rat (Heterocephalus glaber) TRDC.
Protein displays: Naked mole-rat (Heterocephalus glaber) TRAV .
Protein displays: Naked mole-rat (Heterocephalus glaber) TRAJ.
Protein displays: Naked mole-rat (Heterocephalus glaber) TRAC.
Protein displays: Naked mole-rat (Heterocephalus glaber) TRDV .
Protein displays: Naked mole-rat (Heterocephalus glaber) TRDJ.
Protein displays: Naked mole-rat (Heterocephalus glaber) TRDC.
Colliers de Perles: Naked mole-rat (Heterocephalus glaber) TRAV.
Colliers de Perles: Naked mole-rat (Heterocephalus glaber) TRAC.
Colliers de Perles: Naked mole-rat (Heterocephalus glaber) TRDV.
Colliers de Perles: Naked mole-rat (Heterocephalus glaber) TRDC.

2023

18 December 2023 - CREATION and UPDATE 2023: Bornean orangutan (Pongo pygmaeus) IGH in IMGT/GENE-DB, IMGT/LIGM-DB and IMGT Web resources

Creation of the bornean orangutan (Pongo pygmaeus) IGH reference directory (IMGT/GENE-DB data updates).
Addition in IMGT/GENE-DB of:
IMGT000144 (IMGT000144): first locus annotation.
167 bornean orangutan (Pongo pygmaeus) IGHV genes corresponding to 167 allelic sequences.
31 bornean orangutan (Pongo pygmaeus) IGHD genes corresponding to 31 allelic sequences.
9 bornean orangutan (Pongo pygmaeus) IGHJ gene corresponding to 9 allelic sequence.
12 bornean orangutan (Pongo pygmaeus) IGHC gene corresponding to 12 allelic sequence.

Addition of bornean orangutan (Pongo pygmaeus) IGH locus annotation of IMGT locus reference sequence IMGT000144

Creation of 14 web pages in IMGT Repertoire (IG and TR):
Locus representation: Bornean orangutan (Pongo pygmaeus) IGH.
Locus description:Bornean orangutan (Pongo pygmaeus) IGH.
Locus gene order:Bornean orangutan (Pongo pygmaeus) IGH.
Locus in genome assembly:Bornean orangutan (Pongo pygmaeus) IGH.
Potential germline repertoire:Bornean orangutan (Pongo pygmaeus) IGHV, IGHD and IGHJ genes.
Alignment of alleles:Bornean orangutan (Pongo pygmaeus) IGHV.
Alignment of alleles:Bornean orangutan (Pongo pygmaeus) IGHD.
Alignment of alleles:Bornean orangutan (Pongo pygmaeus) IGHJ.
Alignment of alleles:Bornean orangutan (Pongo pygmaeus) IGHC.
Protein displays:Bornean orangutan (Pongo pygmaeus) IGHV.
Protein displays:Bornean orangutan (Pongo pygmaeus) IGHJ.
Protein displays:Bornean orangutan (Pongo pygmaeus) IGHC.
Colliers de Perles:Bornean orangutan (Pongo pygmaeus) IGHV.
Colliers de Perles:Bornean orangutan (Pongo pygmaeus) IGHC.

01 December 2023 - CREATION and UPDATE 2023: Bornean orangutan (Pongo pygmaeus) IGL in IMGT/GENE-DB, IMGT/LIGM-DB and IMGT Web resources

Creation of the bornean orangutan (Pongo pygmaeus) IGL reference directory (IMGT/GENE-DB data updates).
Addition in IMGT/GENE-DB of:
IMGT000145 (IMGT000145): first locus annotation.
113 bornean orangutan (Pongo pygmaeus) IGLV genes corresponding to 113 allelic sequences.
7 bornean orangutan (Pongo pygmaeus) IGLJ genes corresponding to 7 allelic sequences.
7 bornean orangutan (Pongo pygmaeus) IGLC gene corresponding to 7 allelic sequence.

Addition of bornean orangutan (Pongo pygmaeus) IGL locus annotation of IMGT locus reference sequence IMGT000145

Creation of 14 web pages in IMGT Repertoire (IG and TR):
Locus representation: Bornean orangutan (Pongo pygmaeus) IGL.
Locus description:Bornean orangutan (Pongo pygmaeus) IGL.
Locus gene order:Bornean orangutan (Pongo pygmaeus) IGL.
Locus in genome assembly:Bornean orangutan (Pongo pygmaeus) IGL.
Potential germline repertoire:Bornean orangutan (Pongo pygmaeus) IGLV and IGLJ genes.
Locus bornes: IGL locus 5' and 3' bornes.
Alignment of alleles:Bornean orangutan (Pongo pygmaeus) IGLV.
Alignment of alleles:Bornean orangutan (Pongo pygmaeus) IGLJ.
Alignment of alleles:Bornean orangutan (Pongo pygmaeus) IGLC.
Protein displays:Bornean orangutan (Pongo pygmaeus) IGLV.
Protein displays:Bornean orangutan (Pongo pygmaeus) IGLJ.
Protein displays:Bornean orangutan (Pongo pygmaeus) IGLC.
Colliers de Perles:Bornean orangutan (Pongo pygmaeus) IGLV.
Colliers de Perles:Bornean orangutan (Pongo pygmaeus) IGLC.

30 November 2023 - CREATION and UPDATE 2023: Sumatran orangutan (Pongo abelii) IGH in IMGT/GENE-DB, IMGT/LIGM-DB and IMGT Web resources

Creation of the sumatran orangutan (Pongo abelii) IGH reference directory (IMGT/GENE-DB data updates).
Addition in IMGT/GENE-DB of:
IMGT000122 (IMGT000122): first locus annotation.
139 sumatran orangutan (Pongo abelii) IGHV genes corresponding to 139 allelic sequences.
31 sumatran orangutan (Pongo abelii) IGHD genes corresponding to 31 allelic sequences.
9 sumatran orangutan (Pongo abelii) IGHJ gene corresponding to 9 allelic sequence.
13 sumatran orangutan (Pongo abelii) IGHC gene corresponding to 13 allelic sequence.

Addition of sumatran orangutan (Pongo abelii) IGH locus annotation of IMGT locus reference sequence IMGT000122

Creation of 14 web pages in IMGT Repertoire (IG and TR):
Locus representation: Sumatran orangutan (Pongo abelii) IGH.
Locus description:Sumatran orangutan (Pongo abelii) IGH.
Locus gene order:Sumatran orangutan (Pongo abelii) IGH.
Locus in genome assembly:Sumatran orangutan (Pongo abelii) IGH.
Potential germline repertoire:Sumatran orangutan (Pongo abelii) IGHV, IGHD and IGHJ genes.
Alignment of alleles:Sumatran orangutan (Pongo abelii) IGHV.
Alignment of alleles:Sumatran orangutan (Pongo abelii) IGHD.
Alignment of alleles:Sumatran orangutan (Pongo abelii) IGHJ.
Alignment of alleles:Sumatran orangutan (Pongo abelii) IGHC.
Protein displays:Sumatran orangutan (Pongo abelii) IGHV.
Protein displays:Sumatran orangutan (Pongo abelii) IGHJ.
Protein displays:Sumatran orangutan (Pongo abelii) IGHC.
Colliers de Perles:Sumatran orangutan (Pongo abelii) IGHV.
Colliers de Perles:Sumatran orangutan (Pongo abelii) IGHC.

23 August 2023 - CREATION and UPDATE 2023: Western lowland gorilla (Gorilla gorilla gorilla) TRB in IMGT/GENE-DB, IMGT/LIGM-DB and IMGT Web resources

Creation of the western lowland gorilla (Gorilla gorilla gorilla) TRB reference directory (IMGT/GENE-DB data updates).
Addition in IMGT/GENE-DB of:
IMGT000085 (IMGT000085): first locus annotation.
IMGT000095 (IMGT000095): second locus annotation.
IMGT000163 (IMGT000163): third locus annotation.
IMGT000164 (IMGT000164): fourth locus annotation.
67 western lowland gorilla (Gorilla gorilla gorilla) TRBV genes corresponding to 102 allelic sequences.
2 western lowland gorilla (Gorilla gorilla gorilla) TRBD genes corresponding to 2 allelic sequences.
14 western lowland gorilla (Gorilla gorilla gorilla) TRBJ genes corresponding to 17 allelic sequences.
2 western lowland gorilla (Gorilla gorilla gorilla) TRBC genes corresponding to 3 allelic sequences.

Addition of western lowland gorilla (Gorilla gorilla gorilla) TRB locus annotation of IMGT locus reference sequence IMGT000085, IMGT000095, IMGT000163 and IMGT000164

Creation of 16 web pages in IMGT Repertoire (IG and TR):
Locus representation: Western lowland gorilla (Gorilla gorilla gorilla) TRB.
Locus description:Western lowland gorilla (Gorilla gorilla gorilla) TRB.
Locus gene order:Western lowland gorilla (Gorilla gorilla gorilla) TRB.
Locus in genome assembly:Western lowland gorilla (Gorilla gorilla gorilla) TRB.
Potential germline repertoire:Western lowland gorilla (Gorilla gorilla gorilla) TRBV, TRBD and TRBJ genes.
Locus bornes: TRB locus 5' and 3' bornes.
Alignment of alleles:Western lowland gorilla (Gorilla gorilla gorilla) TRBV.
Alignment of alleles:Western lowland gorilla (Gorilla gorilla gorilla) TRBD.
Alignment of alleles:Western lowland gorilla (Gorilla gorilla gorilla) TRBJ.
Alignment of alleles:Western lowland gorilla (Gorilla gorilla gorilla) TRBC.
Protein displays:Western lowland gorilla (Gorilla gorilla gorilla) TRBV.
Protein displays:Western lowland gorilla (Gorilla gorilla gorilla) TRBD.
Protein displays:Western lowland gorilla (Gorilla gorilla gorilla) TRBJ.
Protein displays:Western lowland gorilla (Gorilla gorilla gorilla) TRBC.
Colliers de Perles:Western lowland gorilla (Gorilla gorilla gorilla) TRBV.
Colliers de Perles:Western lowland gorilla (Gorilla gorilla gorilla) TRBC.

23 September 2023 - CREATION 2023: Ferret (Mustela putorius furo) IGK/IGH reference directory in IMGT/GENE-DB (IMGT/GENE-DB data updates), IMGT/LIGM-DB and IMGT Web resources

Creation of the ferret (Mustela putorius furo) IGK reference directory (IMGT/GENE-DB data updates).
Addition in IMGT/GENE-DB of:
BK063796.1 (BK063796.1): IGH locus annotation.
63 ferret (Mustela putorius furo) IGHV genes corresponding to 63 allelic sequences.
10 ferret (Mustela putorius furo) IGHD genes corresponding to 10 allelic sequences.
8 ferret (Mustela putorius furo) IGHJ gene corresponding to 8 allelic sequences.
6 ferret (Mustela putorius furo) IGHC gene corresponding to 6 allelic sequences.

BK063797.1 (BK063797.1): IGK locus annotation.
87 ferret (Mustela putorius furo) IGKV genes corresponding to 87 allelic sequences.
5 ferret (Mustela putorius furo) IGKJ genes corresponding to 5 allelic sequences.
1 ferret (Mustela putorius furo) IGKC gene corresponding to 1 allelic sequence.

Creation of 18 web pages in IMGT Repertoire (IG and TR) for IGK:
Locus representation: Ferret (Mustela putorius furo) IGK.
Locus description:Ferret (Mustela putorius furo) IGK.
Locus gene order:Ferret (Mustela putorius furo) IGK.
Locus in genome assembly:Ferret (Mustela putorius furo) IGK.
Potential germline repertoire:Ferret (Mustela putorius furo) IGKV and IGKJ genes.
Locus bornes: IGK locus 5' and 3' bornes.
Alignment of alleles:Ferret (Mustela putorius furo) IGKV.
Alignment of alleles:Ferret (Mustela putorius furo) IGKJ.
Alignment of alleles:Ferret (Mustela putorius furo) IGKC.
Protein displays:Ferret (Mustela putorius furo) IGKV.
Protein displays:Ferret (Mustela putorius furo) IGKJ.
Protein displays:Ferret (Mustela putorius furo) IGKC.
Gene table: Ferret (Mustela putorius furo) IGKV
Gene table: Ferret (Mustela putorius furo) IGKV (clans)
Gene table: Ferret (Mustela putorius furo) IGKJ
Gene table: Ferret (Mustela putorius furo) IGKC
Colliers de Perles:Ferret (Mustela putorius furo) IGKV.
Colliers de Perles:Ferret (Mustela putorius furo) IGKC.

Creation of 21 web pages in IMGT Repertoire (IG and TR) for IGH:
Locus representation: Ferret (Mustela putorius furo) IGH.
Locus description:Ferret (Mustela putorius furo) IGH.
Locus gene order:Ferret (Mustela putorius furo) IGH.
Locus in genome assembly:Ferret (Mustela putorius furo) IGH.
Potential germline repertoire:Ferret (Mustela putorius furo) IGHV and IGHJ genes.
Locus bornes: IGH locus 5' and 3' bornes.
Alignment of alleles:Ferret (Mustela putorius furo) IGHV.
Alignment of alleles:Ferret (Mustela putorius furo) IGHD.
Alignment of alleles:Ferret (Mustela putorius furo) IGHJ.
Alignment of alleles:Ferret (Mustela putorius furo) IGHC.
Protein displays:Ferret (Mustela putorius furo) IGHV.
Protein displays:Ferret (Mustela putorius furo) IGHD.
Protein displays:Ferret (Mustela putorius furo) IGHJ.
Protein displays:Ferret (Mustela putorius furo) IGHC.
Gene table: Ferret (Mustela putorius furo) IGHV
Gene table: Ferret (Mustela putorius furo) IGHV (clans)
Gene table: Ferret (Mustela putorius furo) IGHD
Gene table: Ferret (Mustela putorius furo) IGHJ
Gene table: Ferret (Mustela putorius furo) IGHC
Colliers de Perles:Ferret (Mustela putorius furo) IGHV.
Colliers de Perles:Ferret (Mustela putorius furo) IGHC.

25 August 2023 - CREATION and UPDATE 2023: Sumatran orangutan (Pongo abelii) IGL in IMGT/GENE-DB, IMGT/LIGM-DB and IMGT Web resources

Creation of the sumatran orangutan (Pongo abelii) IGL reference directory (IMGT/GENE-DB data updates).
Addition in IMGT/GENE-DB of:
IMGT000108 (IMGT000108): first locus annotation.
105 sumatran orangutan (Pongo abelii) IGLV genes corresponding to 105 allelic sequences.
7 sumatran orangutan (Pongo abelii) IGLJ genes corresponding to 7 allelic sequences.
7 sumatran orangutan (Pongo abelii) IGLC gene corresponding to 7 allelic sequence.

Addition of sumatran orangutan (Pongo abelii) IGL locus annotation of IMGT locus reference sequence IMGT000108

Creation of 14 web pages in IMGT Repertoire (IG and TR):
Locus representation: Sumatran orangutan (Pongo abelii) IGL.
Locus description:Sumatran orangutan (Pongo abelii) IGL.
Locus gene order:Sumatran orangutan (Pongo abelii) IGL.
Locus in genome assembly:Sumatran orangutan (Pongo abelii) IGL.
Potential germline repertoire:Sumatran orangutan (Pongo abelii) IGLV and IGLJ genes.
Locus bornes: IGL locus 5' and 3' bornes.
Alignment of alleles:Sumatran orangutan (Pongo abelii) IGLV.
Alignment of alleles:Sumatran orangutan (Pongo abelii) IGLJ.
Alignment of alleles:Sumatran orangutan (Pongo abelii) IGLC.
Protein displays:Sumatran orangutan (Pongo abelii) IGLV.
Protein displays:Sumatran orangutan (Pongo abelii) IGLJ.
Protein displays:Sumatran orangutan (Pongo abelii) IGLC.
Colliers de Perles:Sumatran orangutan (Pongo abelii) IGLV.
Colliers de Perles:Sumatran orangutan (Pongo abelii) IGLC.

23 August 2023 - CREATION and UPDATE 2023: Ring-tailed lemur (Lemur catta) IGL in IMGT/GENE-DB, IMGT/LIGM-DB and IMGT Web resources

Creation of the ring-tailed lemur (Lemur catta) IGL reference directory (IMGT/GENE-DB data updates).
Addition in IMGT/GENE-DB of:
IMGT000104 (IMGT000104): locus annotation.
166 ring-tailed lemur (Lemur catta) IGLV genes corresponding to 166 allelic sequences.
10 ring-tailed lemur (Lemur catta) IGLJ genes corresponding to 10 allelic sequences.
10 ring-tailed lemur (Lemur catta) IGLC genes corresponding to 10 allelic sequences.

Addition of ring-tailed lemur (Lemur catta) IGL locus annotation of IMGT locus reference sequence IMGT000104

Creation of 14 web pages in IMGT Repertoire (IG and TR):
Locus representation: Ring-tailed lemur (Lemur catta) IGL.
Locus description: Ring-tailed lemur (Lemur catta) IGL.
Locus gene order: Ring-tailed lemur (Lemur catta) IGL.
Locus in genome assembly: Ring-tailed lemur (Lemur catta) IGL.
Potential germline repertoire: Ring-tailed lemur (Lemur catta) IGLV and IGLJ genes.
Locus bornes: IGL locus 5' and 3' bornes.
Alignment of alleles: Ring-tailed lemur (Lemur catta) IGLV.
Alignment of alleles: Ring-tailed lemur (Lemur catta) IGLJ.
Alignment of alleles: Ring-tailed lemur (Lemur catta) IGLC.
Protein displays:Ring-tailed lemur (Lemur catta) IGLV.
Protein displays:Ring-tailed lemur (Lemur catta) IGLJ.
Protein displays:Ring-tailed lemur (Lemur catta) IGLC.
Colliers de Perles:Ring-tailed lemur (Lemur catta) IGLV.
Colliers de Perles:Ring-tailed lemur (Lemur catta) IGLC.

09 August 2023 - CREATION and UPDATE 2023: Bornean orangutan (Pongo pygmaeus) IGK in IMGT/GENE-DB, IMGT/LIGM-DB and IMGT Web resources

Creation of the bornean orangutan (Pongo pygmaeus) IGK reference directory (IMGT/GENE-DB data updates).
Addition in IMGT/GENE-DB of:
IMGT000146 (IMGT000146): first locus annotation.
73 bornean orangutan (Pongo pygmaeus) IGKV genes corresponding to 73 allelic sequences.
5 bornean orangutan (Pongo pygmaeus) IGKJ genes corresponding to 5 allelic sequences.
1 bornean orangutan (Pongo pygmaeus) IGKC gene corresponding to 1 allelic sequence.

Addition of bornean orangutan (Pongo pygmaeus) IGK locus annotation of IMGT locus reference sequence IMGT000146

Creation of 17 web pages in IMGT Repertoire (IG and TR):
Locus representation: Bornean orangutan (Pongo pygmaeus) IGK.
Locus description:Bornean orangutan (Pongo pygmaeus) IGK.
Locus gene order:Bornean orangutan (Pongo pygmaeus) IGK.
Locus in genome assembly:Bornean orangutan (Pongo pygmaeus) IGK.
Potential germline repertoire:Bornean orangutan (Pongo pygmaeus) IGKV and IGKJ genes.
Locus bornes: IGK locus 5' and 3' bornes.
Gene table:Bornean orangutan (Pongo pygmaeus) IGKV.
Gene table:Bornean orangutan (Pongo pygmaeus) IGKJ.
Gene table:Bornean orangutan (Pongo pygmaeus) IGKC.
Alignment of alleles:Bornean orangutan (Pongo pygmaeus) IGKV.
Alignment of alleles:Bornean orangutan (Pongo pygmaeus) IGKJ.
Alignment of alleles:Bornean orangutan (Pongo pygmaeus) IGKC.
Protein displays:Bornean orangutan (Pongo pygmaeus) IGKV.
Protein displays:Bornean orangutan (Pongo pygmaeus) IGKJ.
Protein displays:Bornean orangutan (Pongo pygmaeus) IGKC.
Colliers de Perles:Bornean orangutan (Pongo pygmaeus) IGKV.
Colliers de Perles:Bornean orangutan (Pongo pygmaeus) IGKC.

08 August 2023 - CREATION and UPDATE 2023: Western lowland gorilla (Gorilla gorilla gorilla) TRG in IMGT/GENE-DB, IMGT/LIGM-DB and IMGT Web resources

Creation of the western lowland gorilla (Gorilla gorilla gorilla) TRG reference directory (IMGT/GENE-DB data updates).
Addition in IMGT/GENE-DB of:
IMGT000169 (IMGT000169): third locus annotation.
IMGT000170 (IMGT000170): fourth locus annotation.
15 western lowland gorilla (Gorilla gorilla gorilla) TRGV genes corresponding to 28 allelic sequences.
5 western lowland gorilla (Gorilla gorilla gorilla) TRGJ genes corresponding to 6 allelic sequences.
2 western lowland gorilla (Gorilla gorilla gorilla) TRGC genes corresponding to 6 allelic sequences.

Addition of western lowland gorilla (Gorilla gorilla gorilla) TRG locus annotation of IMGT locus reference sequence IMGT000169 and IMGT000170

Creation of 17 web pages in IMGT Repertoire (IG and TR):
Locus representation: Western lowland gorilla (Gorilla gorilla gorilla) TRG.
Locus description:Western lowland gorilla (Gorilla gorilla gorilla) TRG.
Locus gene order:Western lowland gorilla (Gorilla gorilla gorilla) TRG.
Locus in genome assembly:Western lowland gorilla (Gorilla gorilla gorilla) TRG.
Potential germline repertoire:Western lowland gorilla (Gorilla gorilla gorilla) TRGV and TRGJ genes.
Locus bornes: TRG locus 5' and 3' bornes.
Gene table:Western lowland gorilla (Gorilla gorilla gorilla) TRGV.
Gene table:Western lowland gorilla (Gorilla gorilla gorilla) TRGJ.
Gene table:Western lowland gorilla (Gorilla gorilla gorilla) TRGC.
Alignment of alleles:Western lowland gorilla (Gorilla gorilla gorilla) TRGV.
Alignment of alleles:Western lowland gorilla (Gorilla gorilla gorilla) TRGJ.
Alignment of alleles:Western lowland gorilla (Gorilla gorilla gorilla) TRGC.
Protein displays:Western lowland gorilla (Gorilla gorilla gorilla) TRGV.
Protein displays:Western lowland gorilla (Gorilla gorilla gorilla) TRGJ.
Protein displays:Western lowland gorilla (Gorilla gorilla gorilla) TRGC.
Colliers de Perles:Western lowland gorilla (Gorilla gorilla gorilla) TRGV.
Colliers de Perles:Western lowland gorilla (Gorilla gorilla gorilla) TRGC.

03 August 2023 - CREATION and UPDATE 2023: Western lowland gorilla (Gorilla gorilla gorilla) TRA/TRD in IMGT/GENE-DB, IMGT/LIGM-DB and IMGT Web resources

Creation of the western lowland gorilla (Gorilla gorilla gorilla) TRA/TRD reference directory (IMGT/GENE-DB data updates).
Addition in IMGT/GENE-DB of:
IMGT000106 (IMGT000106): first locus annotation.
IMGT000107 (IMGT000107): second locus annotation.
IMGT000161 (IMGT000161): third locus annotation.
IMGT000162 (IMGT000162): fourth locus annotation.
65 western lowland gorilla (Gorilla gorilla gorilla) TRAV genes corresponding to 116 allelic sequences.
61 western lowland gorilla (Gorilla gorilla gorilla) TRAJ genes corresponding to 81 allelic sequences.
1 western lowland gorilla (Gorilla gorilla gorilla) TRAC gene corresponding to 1 allelic sequence.
3 western lowland gorilla (Gorilla gorilla gorilla) TRDV genes corresponding to 5 allelic sequences.
3 western lowland gorilla (Gorilla gorilla gorilla) TRDD genes corresponding to 3 allelic sequences.
4 western lowland gorilla (Gorilla gorilla gorilla) TRDJ genes corresponding to 4 allelic sequences.
1 western lowland gorilla (Gorilla gorilla gorilla) TRDC gene corresponding to 1 allelic sequence.

Addition of western lowland gorilla (Gorilla gorilla gorilla) TRA/TRD locus annotation of IMGT locus reference sequence IMGT000106, IMGT000107, IMGT000161 and IMGT000162

Creation of 33 web pages in IMGT Repertoire (IG and TR):
Locus representation: Western lowland gorilla (Gorilla gorilla gorilla) TRA/TRD.
Locus description:Western lowland gorilla (Gorilla gorilla gorilla) TRA.
Locus description:Western lowland gorilla (Gorilla gorilla gorilla) TRD.
Locus gene order:Western lowland gorilla (Gorilla gorilla gorilla) TRA/TRD.
Locus in genome assembly:Western lowland gorilla (Gorilla gorilla gorilla) TRA/TRD.
Potential germline repertoire:Western lowland gorilla (Gorilla gorilla gorilla) TRAV and TRAJ genes.
Potential germline repertoire:Western lowland gorilla (Gorilla gorilla gorilla) TRDV, TRDD and TRDJ genes.
Locus bornes: TRA/TRD locus 5' and 3' bornes.
Gene table:Western lowland gorilla (Gorilla gorilla gorilla) TRAV.
Gene table:Western lowland gorilla (Gorilla gorilla gorilla) TRAJ.
Gene table:Western lowland gorilla (Gorilla gorilla gorilla) TRAC.
Gene table:Western lowland gorilla (Gorilla gorilla gorilla) TRDV.
Gene table:Western lowland gorilla (Gorilla gorilla gorilla) TRDD.
Gene table:Western lowland gorilla (Gorilla gorilla gorilla) TRDJ.
Gene table:Western lowland gorilla (Gorilla gorilla gorilla) TRDC.
Alignment of alleles:Western lowland gorilla (Gorilla gorilla gorilla) TRAV.
Alignment of alleles:Western lowland gorilla (Gorilla gorilla gorilla) TRAJ.
Alignment of alleles:Western lowland gorilla (Gorilla gorilla gorilla) TRAC.
Alignment of alleles:Western lowland gorilla (Gorilla gorilla gorilla) TRDV.
Alignment of alleles:Western lowland gorilla (Gorilla gorilla gorilla) TRDD.
Alignment of alleles:Western lowland gorilla (Gorilla gorilla gorilla) TRDJ.
Alignment of alleles:Western lowland gorilla (Gorilla gorilla gorilla) TRDC.
Protein displays:Western lowland gorilla (Gorilla gorilla gorilla) TRAV.
Protein displays:Western lowland gorilla (Gorilla gorilla gorilla) TRAJ.
Protein displays:Western lowland gorilla (Gorilla gorilla gorilla) TRAC.
Protein displays:Western lowland gorilla (Gorilla gorilla gorilla) TRDV.
Protein displays:Western lowland gorilla (Gorilla gorilla gorilla) TRDD.
Protein displays:Western lowland gorilla (Gorilla gorilla gorilla) TRDJ.
Protein displays:Western lowland gorilla (Gorilla gorilla gorilla) TRDC.
Colliers de Perles:Western lowland gorilla (Gorilla gorilla gorilla) TRAV.
Colliers de Perles:Western lowland gorilla (Gorilla gorilla gorilla) TRAC.
Colliers de Perles:Western lowland gorilla (Gorilla gorilla gorilla) TRDV.
Colliers de Perles:Western lowland gorilla (Gorilla gorilla gorilla) TRDC.

24 July 2023 - CREATION and UPDATE 2023: Western lowland gorilla (Gorilla gorilla gorilla) IGL in IMGT/GENE-DB, IMGT/LIGM-DB and IMGT Web resources

Creation of the western lowland gorilla (Gorilla gorilla gorilla) IGL reference directory (IMGT/GENE-DB data updates).
Addition in IMGT/GENE-DB of:
IMGT000086 (IMGT000086): first locus annotation.
IMGT000094 (IMGT000094): second locus annotation.
IMGT000152 (IMGT000152): third locus annotation.
IMGT000153 (IMGT000153): fourth locus annotation.
86 western lowland gorilla (Gorilla gorilla gorilla) IGLV genes corresponding to 163 allelic sequences.
8 western lowland gorilla (Gorilla gorilla gorilla) IGLJ genes corresponding to 9 allelic sequences.
8 western lowland gorilla (Gorilla gorilla gorilla) IGLC genes corresponding to 14 allelic sequences.

Addition of western lowland gorilla (Gorilla gorilla gorilla) IGL locus annotation of IMGT locus reference sequence IMGT000086, IMGT000094, IMGT000152 and IMGT000153

Creation of 17 web pages in IMGT Repertoire (IG and TR):
Locus representation: Western lowland gorilla (Gorilla gorilla gorilla) IGL.
Locus description:Western lowland gorilla (Gorilla gorilla gorilla) IGL.
Locus gene order:Western lowland gorilla (Gorilla gorilla gorilla) IGL.
Locus in genome assembly:Western lowland gorilla (Gorilla gorilla gorilla) IGL.
Potential germline repertoire:Western lowland gorilla (Gorilla gorilla gorilla) IGLV and IGLJ genes.
Locus bornes: IGL locus 5' and 3' bornes.
Gene table:Western lowland gorilla (Gorilla gorilla gorilla) IGLV.
Gene table:Western lowland gorilla (Gorilla gorilla gorilla) IGLJ.
Gene table:Western lowland gorilla (Gorilla gorilla gorilla) IGLC.
Alignment of alleles:Western lowland gorilla (Gorilla gorilla gorilla) IGLV.
Alignment of alleles:Western lowland gorilla (Gorilla gorilla gorilla) IGLJ.
Alignment of alleles:Western lowland gorilla (Gorilla gorilla gorilla) IGLC.
Protein displays:Western lowland gorilla (Gorilla gorilla gorilla) IGLV.
Protein displays:Western lowland gorilla (Gorilla gorilla gorilla) IGLJ.
Protein displays:Western lowland gorilla (Gorilla gorilla gorilla) IGLC.
Colliers de Perles:Western lowland gorilla (Gorilla gorilla gorilla) IGLV.
Colliers de Perles:Western lowland gorilla (Gorilla gorilla gorilla) IGLC.

19 July 2023 - CREATION and UPDATE 2023: Western lowland gorilla (Gorilla gorilla gorilla) IGH in IMGT/GENE-DB, IMGT/LIGM-DB and IMGT Web resources

Creation of the western lowland gorilla (Gorilla gorilla gorilla) IGH reference directory (IMGT/GENE-DB data updates).
Addition in IMGT/GENE-DB of:
IMGT000139 (IMGT000139): third locus annotation.
IMGT000140 (IMGT000140): fourth locus annotation.
157 western lowland gorilla (Gorilla gorilla gorilla) IGHV genes corresponding to 316 allelic sequences.
9 western lowland gorilla (Gorilla gorilla gorilla) IGHJ genes corresponding to 16 allelic sequences.
32 western lowland gorilla (Gorilla gorilla gorilla) IGHD genes corresponding to 43 allelic sequences.
13 western lowland gorilla (Gorilla gorilla gorilla) IGHC genes corresponding to 29 allelic sequences.

Addition of western lowland gorilla (Gorilla gorilla gorilla) IGH locus annotation of IMGT locus reference sequence IMGT000139 and IMGT000140

Creation of 19 web pages in IMGT Repertoire (IG and TR):
Locus representation: Western lowland gorilla (Gorilla gorilla gorilla) IGH.
Locus description:Western lowland gorilla (Gorilla gorilla gorilla) IGH.
Locus gene order:Western lowland gorilla (Gorilla gorilla gorilla) IGH.
Locus in genome assembly:Western lowland gorilla (Gorilla gorilla gorilla) IGH.
Potential germline repertoire:Western lowland gorilla (Gorilla gorilla gorilla) IGHV, IGHD and IGHJ genes.
Locus bornes: IGH locus 5' and 3' bornes.
Gene table:Western lowland gorilla (Gorilla gorilla gorilla) IGHV.
Gene table:Western lowland gorilla (Gorilla gorilla gorilla) IGHD.
Gene table:Western lowland gorilla (Gorilla gorilla gorilla) IGHJ.
Gene table:Western lowland gorilla (Gorilla gorilla gorilla) IGHC.
Alignment of alleles:Western lowland gorilla (Gorilla gorilla gorilla) IGHV.
Alignment of alleles:Western lowland gorilla (Gorilla gorilla gorilla) IGHD.
Alignment of alleles:Western lowland gorilla (Gorilla gorilla gorilla) IGHJ.
Alignment of alleles:Western lowland gorilla (Gorilla gorilla gorilla) IGHC.
Protein displays:Western lowland gorilla (Gorilla gorilla gorilla) IGHV.
Protein displays:Western lowland gorilla (Gorilla gorilla gorilla) IGHJ.
Protein displays:Western lowland gorilla (Gorilla gorilla gorilla) IGHC.
Colliers de Perles:Western lowland gorilla (Gorilla gorilla gorilla) IGHV.
Colliers de Perles:Western lowland gorilla (Gorilla gorilla gorilla) IGHC.

15 May 2023 - CREATION and UPDATE 2023: Sumatran orangutan (Pongo abelii) IGK in IMGT/GENE-DB, IMGT/LIGM-DB and IMGT Web resources

Creation of the sumatran orangutan (Pongo abelii) IGK reference directory (IMGT/GENE-DB data updates).
Addition in IMGT/GENE-DB of:
IMGT000096 (IMGT000096): first locus annotation.
77 sumatran orangutan (Pongo abelii) IGKV genes corresponding to 77 allelic sequences.
5 sumatran orangutan (Pongo abelii) IGKJ genes corresponding to 5 allelic sequences.
1 sumatran orangutan (Pongo abelii) IGKC gene corresponding to 1 allelic sequence.

Addition of sumatran orangutan (Pongo abelii) IGK locus annotation of IMGT locus reference sequence IMGT000096

Creation of 17 web pages in IMGT Repertoire (IG and TR):
Locus representation: Sumatran orangutan (Pongo abelii) IGK.
Locus description:Sumatran orangutan (Pongo abelii) IGK.
Locus gene order:Sumatran orangutan (Pongo abelii) IGK.
Locus in genome assembly:Sumatran orangutan (Pongo abelii) IGK.
Potential germline repertoire:Sumatran orangutan (Pongo abelii) IGKV and IGKJ genes.
Locus bornes: IGK locus 5' and 3' bornes.
Gene table:Sumatran orangutan (Pongo abelii) IGKV.
Gene table:Sumatran orangutan (Pongo abelii) IGKJ.
Gene table:Sumatran orangutan (Pongo abelii) IGKC.
Alignment of alleles:Sumatran orangutan (Pongo abelii) IGKV.
Alignment of alleles:Sumatran orangutan (Pongo abelii) IGKJ.
Alignment of alleles:Sumatran orangutan (Pongo abelii) IGKC.
Protein displays:Sumatran orangutan (Pongo abelii) IGKV.
Protein displays:Sumatran orangutan (Pongo abelii) IGKJ.
Protein displays:Sumatran orangutan (Pongo abelii) IGKC.
Colliers de Perles:Sumatran orangutan (Pongo abelii) IGKV.
Colliers de Perles:Sumatran orangutan (Pongo abelii) IGKC.

28 March 2023 - CREATION and UPDATE 2023: Western lowland gorilla (Gorilla gorilla gorilla) IGK in IMGT/GENE-DB, IMGT/LIGM-DB and IMGT Web resources

Creation of the western lowland gorilla (Gorilla gorilla gorilla) IGK reference directory (IMGT/GENE-DB data updates).
Addition in IMGT/GENE-DB of:
IMGT000137 (IMGT000137): third locus annotation.
IMGT000138 (IMGT000138): fourth locus annotation.
44 western lowland gorilla (Gorilla gorilla gorilla) IGKV genes corresponding to 92 allelic sequences.
5 western lowland gorilla (Gorilla gorilla gorilla) IGKJ genes corresponding to 6 allelic sequences.
1 western lowland gorilla (Gorilla gorilla gorilla) IGKC gene corresponding to 1 allelic sequence.

Addition of western lowland gorilla (Gorilla gorilla gorilla) IGK locus annotation of IMGT locus reference sequence IMGT000137 and IMGT000138

Creation of 19 web pages in IMGT Repertoire (IG and TR):
Locus representation: Western lowland gorilla (Gorilla gorilla gorilla) IGK.
Locus description:Western lowland gorilla (Gorilla gorilla gorilla) IGK.
Locus gene order:Western lowland gorilla (Gorilla gorilla gorilla) IGK.
Locus in genome assembly:Western lowland gorilla (Gorilla gorilla gorilla) IGK.
Potential germline repertoire:Western lowland gorilla (Gorilla gorilla gorilla) IGKV and IGKJ genes.
Locus bornes: IGK locus 5' and 3' bornes.
Gene table:Western lowland gorilla (Gorilla gorilla gorilla) IGKV.
Gene table:Western lowland gorilla (Gorilla gorilla gorilla) IGKJ.
Gene table:Western lowland gorilla (Gorilla gorilla gorilla) IGKC.
Alignment of alleles:Western lowland gorilla (Gorilla gorilla gorilla) IGKV.
Alignment of alleles:Western lowland gorilla (Gorilla gorilla gorilla) IGKJ.
Alignment of alleles:Western lowland gorilla (Gorilla gorilla gorilla) IGKC.
Protein displays:Western lowland gorilla (Gorilla gorilla gorilla) IGKV.
Protein displays:Western lowland gorilla (Gorilla gorilla gorilla) IGKJ.
Protein displays:Western lowland gorilla (Gorilla gorilla gorilla) IGKC.
Colliers de Perles:Western lowland gorilla (Gorilla gorilla gorilla) IGKV.
Colliers de Perles:Western lowland gorilla (Gorilla gorilla gorilla) IGKC.

2022

22 November 2022 - CREATION: IMGT rules for quality assessment of IG and TR loci in genome assemblies in IMGT Scientific chart


Creation of IMGT rules for quality assessment of IG and TR loci in genome assemblies
Introduction
IMGT preselction criteria of a genome assembly
IMGT assessment of the locus quality

26 October 2022 - CREATION and UPDATE 2022: Western lowland gorilla (Gorilla gorilla gorilla) IGK in IMGT/GENE-DB, IMGT/LIGM-DB and IMGT Web resources

Creation of the western lowland gorilla (Gorilla gorilla gorilla) IGK reference directory (IMGT/GENE-DB data updates).
Addition in IMGT/GENE-DB of:
IMGT000077 (IMGT000077): first locus annotation.
IMGT000089 (IMGT000089): second locus annotation.
43 western lowland gorilla (Gorilla gorilla gorilla) IGKV genes corresponding to 60 allelic sequences.
5 western lowland gorilla (Gorilla gorilla gorilla) IGKJ genes corresponding to 6 allelic sequences.
1 western lowland gorilla (Gorilla gorilla gorilla) IGKC gene corresponding to 1 allelic sequence.

Addition of western lowland gorilla (Gorilla gorilla gorilla) IGK locus annotation of IMGT locus reference sequence IMGT000077 and IMGT000089

Creation of 20 web pages in IMGT Repertoire (IG and TR):
Locus representation: Western lowland gorilla (Gorilla gorilla gorilla) IGK.
Locus description:Western lowland gorilla (Gorilla gorilla gorilla) IGK.
Locus gene order:Western lowland gorilla (Gorilla gorilla gorilla) IGK.
Locus in genome assembly:Western lowland gorilla (Gorilla gorilla gorilla) IGK.
Potential germline repertoire:Western lowland gorilla (Gorilla gorilla gorilla) IGKV and IGKJ genes.
[CDR1-IMGT.CDR2-IMGT.CDR3-IMGT] lengths:Western lowland gorilla (Gorilla gorilla gorilla) per IGKV subgroup.
Locus bornes: IGK locus 5' and 3' bornes.
Gene table:Western lowland gorilla (Gorilla gorilla gorilla) IGKV.
Gene table:Western lowland gorilla (Gorilla gorilla gorilla) IGKJ.
Gene table:Western lowland gorilla (Gorilla gorilla gorilla) IGKC.
Alignment of alleles:Western lowland gorilla (Gorilla gorilla gorilla) IGKV.
Alignment of alleles:Western lowland gorilla (Gorilla gorilla gorilla) IGKJ.
Alignment of alleles:Western lowland gorilla (Gorilla gorilla gorilla) IGKC.
Protein displays:Western lowland gorilla (Gorilla gorilla gorilla) IGKV.
Protein displays:Western lowland gorilla (Gorilla gorilla gorilla) IGKJ.
Protein displays:Western lowland gorilla (Gorilla gorilla gorilla) IGKC.
Colliers de Perles:Western lowland gorilla (Gorilla gorilla gorilla) IGKV.
Colliers de Perles:Western lowland gorilla (Gorilla gorilla gorilla) IGKC.

19 October 2022 - CREATION and UPDATE 2022: House mouse (Mus musculus) IGL in IMGT/GENE-DB, IMGT/LIGM-DB and IMGT Web resources

Creation of the House mouse (Mus musculus) IGL reference directory (IMGT/GENE-DB data updates).
Addition in IMGT/GENE-DB of:
IMGT000117 (IMGT000117): first locus annotation.
3 House mouse (Mus musculus) IGLV genes corresponding to 3 allelic sequences.
6 House mouse (Mus musculus) IGLJ genes corresponding to 6 allelic sequences.
4 House mouse (Mus musculus) IGLC genes corresponding to 4 allelic sequences.

Addition of House mouse (Mus musculus) IGL locus annotation of IMGT locus reference sequence IMGT000117

Update of 4 web pages in IMGT Repertoire (IG and TR):
Gene order:mouse (Mus musculus) IGL.
Gene table:mouse (Mus musculus) IGLV.
Gene table:mouse (Mus musculus) IGLJ.
Gene table:mouse (Mus musculus) IGLC.

Creation of 3 web pages in IMGT Repertoire (IG and TR):
Locus description: Mouse (Mus musculus) IGL.
Locus in genome assembly: Mouse (Mus musculus) IGL.
Potential germline repertoire: Mouse (Mus musculus) IGL.

14 October 2022 - CREATION and UPDATE 2022: Mouse (Mus musculus) TRA in IMGT/GENE-DB, IMGT/LIGM-DB and IMGT Web resources

Update of the mouse (Mus musculus) IGH reference directory (IMGT/GENE-DB data updates).
Addition in IMGT/GENE-DB of:
IMGT000082 (IMGT000082): locus annotation.
New mouse (Mus musculus) TRAV genes corresponding to 60 allelic sequences.
New mouse (Mus musculus) TRAJ genes corresponding to 9 allelic sequences.
New mouse (Mus musculus) TRDV genes corresponding to 3 allelic sequences.
New mouse (Mus musculus) TRDD genes corresponding to 1 allelic sequences.

Addition of mouse (Mus musculus) TRA locus annotation of IMGT locus reference sequence IMGT000082

Update of 26 web pages in IMGT Repertoire (IG and TR):
Locus representation: Mouse (Mus musculus) TRA.
Gene table:mouse (Mus musculus) TRAV.
Gene table:mouse (Mus musculus) TRAJ.
Gene table:mouse (Mus musculus) TRAC.
Gene table:mouse (Mus musculus) TRDV.
Gene table:mouse (Mus musculus) TRDD.
Gene table:mouse (Mus musculus) TRDJ.
Gene table:mouse (Mus musculus) TRDC.
Alignment of alleles:mouse (Mus musculus) TRAV.
Alignment of alleles:mouse (Mus musculus) TRAJ.
Alignment of alleles:mouse (Mus musculus) TRAC.
Alignment of alleles:mouse (Mus musculus) TRDV.
Alignment of alleles:mouse (Mus musculus) TRDD.
Alignment of alleles:mouse (Mus musculus) TRDJ.
Alignment of alleles:mouse (Mus musculus) TRDC.
Protein displays:mouse (Mus musculus) TRAV.
Protein displays:mouse (Mus musculus) TRAJ.
Protein displays:mouse (Mus musculus) TRAC.
Protein displays:mouse (Mus musculus) TRDV.
Protein displays:mouse (Mus musculus) TRDD.
Protein displays:mouse (Mus musculus) TRDJ.
Protein displays:mouse (Mus musculus) TRDC.
Colliers de Perles:mouse (Mus musculus) TRAV.
Colliers de Perles:mouse (Mus musculus) TRAC.
Colliers de Perles:mouse (Mus musculus) TRDV.
Colliers de Perles:mouse (Mus musculus) TRDC.

Creation of 8 web pages in IMGT Repertoire (IG and TR):
Locus description: Mouse (Mus musculus) TRD.
Locus description: Mouse (Mus musculus) TRA.
Locus in genome assembly: Mouse (Mus musculus) TRA/TRD.
Potential germline repertoire: Mouse (Mus musculus) TRA.
Potential germline repertoire: Mouse (Mus musculus) TRD.
[CDR1-IMGT.CDR2-IMGT.CDR3-IMGT] lengths: Mouse (Mus musculus) per TRAV subgroup.
[CDR1-IMGT.CDR2-IMGT.CDR3-IMGT] lengths: Mouse (Mus musculus) per TRDV subgroup.
Locus bornes: TRA/D locus 5' and 3' bornes.

28 September 2022 - CREATION and UPDATE 2022: Ring-tailed lemur (Lemur catta) IGH in IMGT/GENE-DB, IMGT/LIGM-DB and IMGT Web resources

Creation of the ring-tailed lemur (Lemur catta) IGH reference directory (IMGT/GENE-DB data updates).
Addition in IMGT/GENE-DB of:
IMGT000097 (IMGT000097): locus annotation.
84 ring-tailed lemur (Lemur catta) IGHV genes corresponding to 84 allelic sequences.
11 ring-tailed lemur (Lemur catta) IGHD genes corresponding to 11 allelic sequences.
7 ring-tailed lemur (Lemur catta) IGHJ genes corresponding to 7 allelic sequences.
4 ring-tailed lemur (Lemur catta) IGHC genes corresponding to 4 allelic sequences.

Addition of ring-tailed lemur (Lemur catta) IGH locus annotation of IMGT locus reference sequence IMGT000097

Creation of 20 web pages in IMGT Repertoire (IG and TR):
Locus representation: Ring-tailed lemur (Lemur catta) IGH.
Locus description:Ring-tailed lemur (Lemur catta) IGH.
Locus gene order:Ring-tailed lemur (Lemur catta) IGH.
Locus in genome assembly:Ring-tailed lemur (Lemur catta) IGH.
Potential germline repertoire:Ring-tailed lemur (Lemur catta) IGHV, IGHD and IGHJ genes.
[CDR1-IMGT.CDR2-IMGT.CDR3-IMGT] lengths:Ring-tailed lemur (Lemur catta) per IGHV subgroup.
Locus bornes: IGH locus 5' and 3' bornes.
Gene table:Ring-tailed lemur (Lemur catta) IGHV.
Gene table:Ring-tailed lemur (Lemur catta) IGHD.
Gene table:Ring-tailed lemur (Lemur catta) IGHJ.
Gene table:Ring-tailed lemur (Lemur catta) IGHC.
Alignment of alleles:Ring-tailed lemur (Lemur catta) IGHV.
Alignment of alleles:Ring-tailed lemur (Lemur catta) IGHD.
Alignment of alleles:Ring-tailed lemur (Lemur catta) IGHJ.
Alignment of alleles:Ring-tailed lemur (Lemur catta) IGHC.
Protein displays:Ring-tailed lemur (Lemur catta) IGHV.
Protein displays:Ring-tailed lemur (Lemur catta) IGHJ.
Protein displays:Ring-tailed lemur (Lemur catta) IGHC.
Colliers de Perles:Ring-tailed lemur (Lemur catta) IGHV.
Colliers de Perles:Ring-tailed lemur (Lemur catta) IGHC.

17 June 2022 - CREATION and UPDATE 2022: Western lowland gorilla (Gorilla gorilla gorilla) IGH in IMGT/GENE-DB, IMGT/LIGM-DB and IMGT Web resources

Creation of the western lowland gorilla (Gorilla gorilla gorilla) IGH reference directory (IMGT/GENE-DB data updates).
Addition in IMGT/GENE-DB of:
IMGT000074 (IMGT000074): first locus annotation.
IMGT000078 (IMGT000078): second locus annotation.
151 western lowland gorilla (Gorilla gorilla gorilla) IGHV genes corresponding to 221 allelic sequences.
9 western lowland gorilla (Gorilla gorilla gorilla) IGHJ genes corresponding to 15 allelic sequences.
32 western lowland gorilla (Gorilla gorilla gorilla) IGHD genes corresponding to 36 allelic sequences.
9 western lowland gorilla (Gorilla gorilla gorilla) IGHC genes corresponding to 12 allelic sequences.

Addition of western lowland gorilla (Gorilla gorilla gorilla) IGH locus annotation of IMGT locus reference sequence IMGT000074 and IMGT000078

Creation of 20 web pages in IMGT Repertoire (IG and TR):
Locus representation: Western lowland gorilla (Gorilla gorilla gorilla) IGH.
Locus description:Western lowland gorilla (Gorilla gorilla gorilla) IGH.
Locus gene order:Western lowland gorilla (Gorilla gorilla gorilla) IGH.
Locus in genome assembly:Western lowland gorilla (Gorilla gorilla gorilla) IGH.
Potential germline repertoire:Western lowland gorilla (Gorilla gorilla gorilla) IGHV, IGHD and IGHJ genes.
[CDR1-IMGT.CDR2-IMGT.CDR3-IMGT] lengths:Western lowland gorilla (Gorilla gorilla gorilla) per IGHV subgroup.
Locus bornes: IGH locus 5' and 3' bornes.
Gene table:Western lowland gorilla (Gorilla gorilla gorilla) IGHV.
Gene table:Western lowland gorilla (Gorilla gorilla gorilla) IGHD.
Gene table:Western lowland gorilla (Gorilla gorilla gorilla) IGHJ.
Gene table:Western lowland gorilla (Gorilla gorilla gorilla) IGHC.
Alignment of alleles:Western lowland gorilla (Gorilla gorilla gorilla) IGHV.
Alignment of alleles:Western lowland gorilla (Gorilla gorilla gorilla) IGHD.
Alignment of alleles:Western lowland gorilla (Gorilla gorilla gorilla) IGHJ.
Alignment of alleles:Western lowland gorilla (Gorilla gorilla gorilla) IGHC.
Protein displays:Western lowland gorilla (Gorilla gorilla gorilla) IGHV.
Protein displays:Western lowland gorilla (Gorilla gorilla gorilla) IGHJ.
Protein displays:Western lowland gorilla (Gorilla gorilla gorilla) IGHC.
Colliers de Perles:Western lowland gorilla (Gorilla gorilla gorilla) IGHV.
Colliers de Perles:Western lowland gorilla (Gorilla gorilla gorilla) IGHC.

17 June 2022 - CREATION and UPDATE 2021: Western lowland gorilla (Gorilla gorilla gorilla) TRG in IMGT/GENE-DB, IMGT/LIGM-DB and IMGT Web resources

Creation of the western lowland gorilla (Gorilla gorilla gorilla) TRG reference directory (IMGT/GENE-DB data updates).
Addition in IMGT/GENE-DB of:
IMGT000102 (IMGT000102): first locus annotation.
IMGT000103 (IMGT000103): second locus annotation.
15 western lowland gorilla (Gorilla gorilla gorilla) TRGV genes corresponding to 23 allelic sequences.
5 western lowland gorilla (Gorilla gorilla gorilla) TRGJ genes corresponding to 5 allelic sequences.
2 western lowland gorilla (Gorilla gorilla gorilla) TRGC genes corresponding to 4 allelic sequences.

Addition of western lowland gorilla (Gorilla gorilla gorilla) TRG locus annotation of IMGT locus reference sequence IMGT000102 and IMGT000103

Creation of 18 web pages in IMGT Repertoire (IG and TR):
Locus representation: Western lowland gorilla (Gorilla gorilla gorilla) TRG.
Locus description:Western lowland gorilla (Gorilla gorilla gorilla) TRG.
Locus gene order:Western lowland gorilla (Gorilla gorilla gorilla) TRG.
Locus in genome assembly:Western lowland gorilla (Gorilla gorilla gorilla) TRG.
Potential germline repertoire:Western lowland gorilla (Gorilla gorilla gorilla) TRGV and TRGJ genes.
[CDR1-IMGT.CDR2-IMGT.CDR3-IMGT] lengths:Western lowland gorilla (Gorilla gorilla gorilla) per TRGV subgroup.
Locus bornes: TRG locus 5' and 3' bornes.
Gene table:Western lowland gorilla (Gorilla gorilla gorilla) TRGV.
Gene table:Western lowland gorilla (Gorilla gorilla gorilla) TRGJ.
Gene table:Western lowland gorilla (Gorilla gorilla gorilla) TRGC.
Alignment of alleles:Western lowland gorilla (Gorilla gorilla gorilla) TRGV.
Alignment of alleles:Western lowland gorilla (Gorilla gorilla gorilla) TRGJ.
Alignment of alleles:Western lowland gorilla (Gorilla gorilla gorilla) TRGC.
Protein displays:Western lowland gorilla (Gorilla gorilla gorilla) TRGV.
Protein displays:Western lowland gorilla (Gorilla gorilla gorilla) TRGJ.
Protein displays:Western lowland gorilla (Gorilla gorilla gorilla) TRGC.
Colliers de Perles:Western lowland gorilla (Gorilla gorilla gorilla) TRGV.
Colliers de Perles:Western lowland gorilla (Gorilla gorilla gorilla) TRGC.

14 June 2022 - UPDATE 2022: Ring-tailed lemur (Lemur catta) IGKV reference directory in IMGT/GENE-DB (IMGT/GENE-DB data updates), IMGT/LIGM-DB and IMGT Web resources

Creation of ring-tailed lemur (Lemur catta). Addition in GENE-DB):
17 ring-tailed lemur (Lemur catta) IGKV genes corresponding to 30 allelic sequences.
IMGT000098 (IMGT000098): first locus annotation.
IMGT000101 (IMGT000101): second locus annotation.
17 IGKV genes, 5 IGKJ genes and 1 IGKC gene added.

Addition of ring-tailed lemur (Lemur catta) IGK locus annotation of IMGT locus reference sequence IMGT000098 and IMGT000101

Creation of 13 web pages in IMGT Repertoire (IG and TR):
Locus representation: ring-tailed lemur (Lemur catta) IGK.
Locus description: ring-tailed lemur (Lemur catta) IGK.
Locus gene order: ring-tailed lemur (Lemur catta) IGK.
Locus in genome assembly: ring-tailed lemur (Lemur catta) IGK.
Potential germline repertoire: ring-tailed lemur (Lemur catta) IGKV and IGKJ genes.
[CDR1-IMGT.CDR2-IMGT.CDR3-IMGT] lengths per IGKV subgroup: ring-tailed lemur (Lemur catta) IGKV genes.
Locus bornes: IGK locus 5' and 3' bornes.
Gene table: ring-tailed lemur (Lemur catta) IGKV.
Gene table: ring-tailed lemur (Lemur catta) IGKJ.
Gene table: ring-tailed lemur (Lemur catta) IGKC.
Alignment of alleles: ring-tailed lemur (Lemur catta) IGKV.
Alignment of alleles: ring-tailed lemur (Lemur catta) IGKJ.
Alignment of alleles: ring-tailed lemur (Lemur catta) IGKC.

28 January 2022 - UPDATE 2022: Rhesus monkey (Macaca mulatta) IGHV reference directory in IMGT/GENE-DB (IMGT/GENE-DB data updates), IMGT/LIGM-DB and IMGT Web resources

Update of 3 Rhesus monkey (Macaca mulatta) IGHV reference sequences in IMGT reference directory:
IGHV7-128*01 (IMGT000064): update of L-PART1 annotation.
IGHV3-103*02 (NW_001122023): update of functionality: initially P, now ORF.
IGHV3S3*01 (NW_001122023: update of sequence gapping.

Update of 3 web pages in IMGT Repertoire (IG and TR):
Locus representation: Rhesus monkey (Macaca mulatta) IGH.
Potential germline repertoire: Rhesus monkey (Macaca mulatta) IGHV, IGHD and IGHJ genes on chromosome 7.
Gene table: Rhesus monkey (Macaca mulatta) IGHV.

28 January 2022 - UPDATE 2022: Rhesus monkey (Macaca mulatta) IGKJ reference directory in IMGT/GENE-DB (IMGT/GENE-DB data updates), IMGT/LIGM-DB and IMGT Web resources

Update of 1 Rhesus monkey (Macaca mulatta) IGHJ reference sequences in IMGT reference directory:
IGKJ5*01 (NW_001099007 and IMGT000063): update of functionality: initially ORF, now F

Update of 3 web pages in IMGT Repertoire (IG and TR):
Locus representation: Rhesus monkey (Macaca mulatta) IGK.
Potential germline repertoire: Rhesus monkey (Macaca mulatta) IGKV and IGKJ genes on chromosome 13.
Gene table: Rhesus monkey (Macaca mulatta) IGKJ.

2021

01 December 2021 - CREATION and UPDATE 2021: bovine (Bos taurus) TRB in IMGT/GENE-DB, IMGT/LIGM-DB and IMGT Web resources

Creation of the bovine (Bos taurus) TRB reference directory (IMGT/GENE-DB data updates).
Addition in IMGT/GENE-DB of:
123 bovine (Bos taurus) TRBV genes corresponding to 124 allelic sequences.
19 bovine (Bos taurus) TRBJ genes corresponding to 22 allelic sequences.
3 bovine (Bos taurus) TRBD genes corresponding to 3 allelic sequences.
3 bovine (Bos taurus) TRBC genes corresponding to 6 allelic sequences.

Addition of bovine (Bos taurus) TRB locus annotation of IMGT locus reference sequence IMGT000084

Update of bovine (Bos taurus) TRB locus annotation of IMGT locus sequence AF453325

Creation of 20 web pages in IMGT Repertoire (IG and TR):
Locus representation: bovine (Bos taurus) TRB.
Locus description: bovine (Bos taurus) TRB.
Locus gene order: bovine (Bos taurus) TRB.
Locus in genome assembly: bovine (Bos taurus) TRB.
Potential germline repertoire: bovine (Bos taurus) TRBV, TRBD and TRBJ genes.
[CDR1-IMGT.CDR2-IMGT.CDR3-IMGT] lengths: bovine (Bos taurus) per TRBV subgroup.
Locus bornes: TRB locus 5' and 3' bornes.
Gene table: bovine (Bos taurus) TRBV.
Gene table: bovine (Bos taurus) TRBD.
Gene table: bovine (Bos taurus) TRBJ.
Gene table: bovine (Bos taurus) TRBC.
Alignment of alleles: bovine (Bos taurus) TRBV.
Alignment of alleles: bovine (Bos taurus) TRBD.
Alignment of alleles: bovine (Bos taurus) TRBJ.
Alignment of alleles: bovine (Bos taurus) TRBC.
Protein displays: bovine (Bos taurus) TRBV.
Protein displays: bovine (Bos taurus) TRBJ.
Protein displays: bovine (Bos taurus) TRBC.
Colliers de Perles: bovine (Bos taurus) TRBV.
Colliers de Perles: bovine (Bos taurus) TRBC.

01 December 2021 - UPDATE 2021: Human (Homo sapiens) IGHV reference directory in IMGT/GENE-DB (IMGT/GENE-DB data updates), IMGT/LIGM-DB and IMGT Web resources

Biocuration of the IMGT-NC_Report_2021-3-1117_Homsap_IGHV pdf
  • Addition of 8 new IGKV alleles: IGHV1-69*20 F (OU596106), IGHV3-21*07 F (OU596107), IGHV3-30*20 F (OU596105), IGHV3-9*04 F (MN337621), IGHV4-39*08 F (OU596110), IGHV4-39*09 F (OU596103), IGHV4-4*10 F (OU596101), IGHV4-61*11 F (OU596109) and 2 sequences assigned to 2 known IGHV allele: IGHV3-33*08 F (OU596104), IGHV3-9*04 F (OU596108) ('Lit').
  • Update of MN337621 previously assigned to IGHV3-9*01 (sequence from the literature) have been now assigned to IGHV3-9*04 (IMGT reference sequence). Authors change the nucleotide sequence version 1 T307>C in version 2 in EMBL flat file.

  • Update of 2 web pages in IMGT Repertoire (IG and TR):
    Gene table: human (Homo sapiens) IGHV.
    Alignment of alleles: human (Homo sapiens) IGHV.

    29 October 2021 - UPDATE 2021: Human (Homo sapiens) IGHV reference directory in IMGT/GENE-DB (IMGT/GENE-DB data updates), IMGT/LIGM-DB and IMGT Web resources

    Update of 4 Homo sapiens IGHV reference sequences in IMGT reference directory:
    IGHV1-69*02 (MG719325), IGHV3-25*03 (AC245166), IGHV3-52*02 (AC279961), IGHV3-63*02 (IMGT000058).
    Addition in IMGT/GENE-DB of:
    1 new allele (ORF): IGHV8-51-1*04 ORF (AC279961)
    Update of the IMGT/LIGM-DB reference sequences of Homo sapiens (human) IGHV1-69*02 (MG719325), IGHV3-25*03 (AC245166), IGHV3-52*02 (AC279961), IGHV3-63*02 (IMGT000058)

    Update of 2 web pages in IMGT Repertoire (IG and TR):
    Gene table: human (Homo sapiens) IGHV.
    Alignment of alleles: human (Homo sapiens) IGHV.

    06 October 2021 - CREATION and UPDATE 2021: Naked mole-rat (Heterocephalus glaber) TRB in IMGT/GENE-DB, IMGT/LIGM-DB and IMGT Web resources

    Provisional nomenclature (scaffolds only, no chromosome assembly).

    Creation of the Naked mole-rat (Heterocephalus glaber) TRB reference directory (IMGT/GENE-DB data updates).
    Addition in IMGT/GENE-DB of:
    33 Naked mole-rat (Heterocephalus glaber) TRBV genes corresponding to 38 allelic sequences.
    12 Naked mole-rat (Heterocephalus glaber) TRBJ genes corresponding to 12 allelic sequences.
    2 Naked mole-rat (Heterocephalus glaber) TRBD genes corresponding to 2 allelic sequences.
    2 Naked mole-rat (Heterocephalus glaber) TRBC genes corresponding to 3 allelic sequences.

    Addition of Naked mole-rat (Heterocephalus glaber) TRB locus annotation of IMGT locus contig sequences IMGT000070, IMGT000079, IMGT000080, IMGT000087, IMGT000088, IMGT000090 and IMGT000091 in IMGT/LIGM-DB.

    Creation of 20 web pages in IMGT Repertoire (IG and TR):
    Locus representation: Naked mole-rat (Heterocephalus glaber) TRB.
    Locus description: Naked mole-rat (Heterocephalus glaber) TRB.
    Locus gene order: Naked mole-rat (Heterocephalus glaber) TRB.
    Locus in genome assembly: Naked mole-rat (Heterocephalus glaber) TRB.
    Potential germline repertoire: Naked mole-rat (Heterocephalus glaber) TRBV, TRBD and TRBJ genes.
    [CDR1-IMGT.CDR2-IMGT.CDR3-IMGT] lengths: Naked mole-rat (Heterocephalus glaber) per TRBV subgroup.
    Locus bornes: TRB locus 5' and 3' bornes.
    Gene table: Naked mole-rat (Heterocephalus glaber) TRBV.
    Gene table: Naked mole-rat (Heterocephalus glaber) TRBJ.
    Gene table: Naked mole-rat (Heterocephalus glaber) TRBD.
    Gene table: Naked mole-rat (Heterocephalus glaber) TRBC.
    Alignment of alleles: Naked mole-rat (Heterocephalus glaber) TRBV.
    Alignment of alleles: Naked mole-rat (Heterocephalus glaber) TRBD.
    Alignment of alleles: Naked mole-rat (Heterocephalus glaber) TRBJ.
    Alignment of alleles: Naked mole-rat (Heterocephalus glaber) TRBC.
    Protein displays: Naked mole-rat (Heterocephalus glaber) TRBV.
    Protein displays: Naked mole-rat (Heterocephalus glaber) TRBJ.
    Protein displays: Naked mole-rat (Heterocephalus glaber) TRBC.
    Colliers de Perles: Naked mole-rat (Heterocephalus glaber) TRBV.
    Colliers de Perles: Naked mole-rat (Heterocephalus glaber) TRBC.

    06 October 2021 - CREATION and UPDATE 2021: Naked mole-rat (Heterocephalus glaber) TRG in IMGT/GENE-DB, IMGT/LIGM-DB and IMGT Web resources

    Provisional nomenclature (scaffolds only, no chromosome assembly).

    Creation of the Naked mole-rat (Heterocephalus glaber) TRG reference directory (IMGT/GENE-DB data updates).
    Addition in IMGT/GENE-DB of:
    15 Naked mole-rat (Heterocephalus glaber) TRGV genes corresponding to 16 allelic sequences.
    11 Naked mole-rat (Heterocephalus glaber) TRGJ genes corresponding to 13 allelic sequences.
    6 Naked mole-rat (Heterocephalus glaber) TRGC genes corresponding to 7 allelic sequences.

    Addition of Naked mole-rat (Heterocephalus glaber) TRG locus annotation of IMGT locus contig sequences IMGT000072 and IMGT000083 in IMGT/LIGM-DB.

    Creation of 18 web pages in IMGT Repertoire (IG and TR):
    Locus representation: Naked mole-rat (Heterocephalus glaber) TRG.
    Locus description: Naked mole-rat (Heterocephalus glaber) TRG.
    Locus gene order: Naked mole-rat (Heterocephalus glaber) TRG.
    Locus in genome assembly: Naked mole-rat (Heterocephalus glaber) TRG.
    Potential germline repertoire: Naked mole-rat (Heterocephalus glaber) TRGV and TRGJ genes.
    [CDR1-IMGT.CDR2-IMGT.CDR3-IMGT] lengths: Naked mole-rat (Heterocephalus glaber) per TRGV subgroup.
    Locus bornes: TRG locus 5' and 3' bornes.
    Gene table: Naked mole-rat (Heterocephalus glaber) TRGV.
    Gene table: Naked mole-rat (Heterocephalus glaber) TRGJ.
    Gene table: Naked mole-rat (Heterocephalus glaber) TRGC.
    Alignment of alleles: Naked mole-rat (Heterocephalus glaber) TRGV.
    Alignment of alleles: Naked mole-rat (Heterocephalus glaber) TRGJ.
    Alignment of alleles: Naked mole-rat (Heterocephalus glaber) TRGC.
    Protein displays: Naked mole-rat (Heterocephalus glaber) TRGV.
    Protein displays: Naked mole-rat (Heterocephalus glaber) TRGJ.
    Protein displays: Naked mole-rat (Heterocephalus glaber) TRGC.
    Colliers de Perles: Naked mole-rat (Heterocephalus glaber) TRGV.
    Colliers de Perles: Naked mole-rat (Heterocephalus glaber) TRGC.

    27 September 2021 - UPDATE 2021: Rhesus monkey (Macaca mulatta) TRA/TRD in IMGT/GENE-DB, IMGT/LIGM-DB and IMGT Web resources

    Update of the Rhesus monkey (Macaca mulatta) TRA/TRD reference directory (IMGT/GENE-DB data updates).
    Addition in IMGT/GENE-DB of:
    26 Rhesus monkey (Macaca mulatta) TRAV new alleles.
    15 Rhesus monkey (Macaca mulatta) TRAJ new alleles.
    1 Rhesus monkey (Macaca mulatta) TRAC new allele.
    3 Rhesus monkey (Macaca mulatta) TRDV new alleles.
    1 Rhesus monkey (Macaca mulatta) TRDJ new allele.
    1 Rhesus monkey (Macaca mulatta) TRDC new allele.

    Addition of new alleles TRA/TRD annotation of IMGT reference sequence IMGT000076 and update of TRA/TRD annotation of IMGT000013 in IMGT/LIGM-DB.

    Update of 30 web pages in IMGT Repertoire (IG and TR):
    Gene table: Rhesus monkey (Macaca mulatta) TRAV.
    Gene table: Rhesus monkey (Macaca mulatta) TRAJ.
    Gene table: Rhesus monkey (Macaca mulatta) TRAC.
    Gene table: Rhesus monkey (Macaca mulatta) TRDV.
    Gene table: Rhesus monkey (Macaca mulatta) TRDJ.
    Gene table: Rhesus monkey (Macaca mulatta) TRDC.
    Alignment of alleles: Rhesus monkey (Macaca mulatta) TRAV.
    Alignment of alleles: Rhesus monkey (Macaca mulatta) TRAJ.
    Alignment of alleles: Rhesus monkey (Macaca mulatta) TRAC.
    Alignment of alleles: Rhesus monkey (Macaca mulatta) TRDV.
    Alignment of alleles: Rhesus monkey (Macaca mulatta) TRDJ.
    Alignment of alleles: Rhesus monkey (Macaca mulatta) TRDC.
    Protein displays: Rhesus monkey (Macaca mulatta) TRAV.
    Protein displays: Rhesus monkey (Macaca mulatta) TRAJ.
    Protein displays: Rhesus monkey (Macaca mulatta) TRAC.
    Protein displays: Rhesus monkey (Macaca mulatta) TRDV.
    Protein displays: Rhesus monkey (Macaca mulatta) TRDJ.
    Protein displays: Rhesus monkey (Macaca mulatta) TRDC.
    Colliers de Perles: Rhesus monkey (Macaca mulatta) TRAV.
    Colliers de Perles: Rhesus monkey (Macaca mulatta) TRAC.
    Colliers de Perles: Rhesus monkey (Macaca mulatta) TRDV.
    Colliers de Perles: Rhesus monkey (Macaca mulatta) TRDC.
    Locus representation: Rhesus monkey (Macaca mulatta) TRA/TRD.
    Locus in genome assembly: Rhesus monkey (Macaca mulatta) TRA/TRD.
    Locus description: Rhesus monkey (Macaca mulatta) TRA.
    Locus description: Rhesus monkey (Macaca mulatta) TRD.
    Locus gene order: Rhesus monkey (Macaca mulatta) TRA/TRD.
    Potential germline repertoire: Rhesus monkey (Macaca mulatta) TRAV and TRAJ genes on chromosome 7.
    Potential germline repertoire: Rhesus monkey (Macaca mulatta) TRDV, TRDD and TRDJ genes on chromosome 7.
    [CDR1-IMGT.CDR2-IMGT.CDR3-IMGT] lengths: Rhesus monkey (Macaca mulatta) TRAV.
    [CDR1-IMGT.CDR2-IMGT.CDR3-IMGT] lengths: Rhesus monkey (Macaca mulatta) TRDV.

    21 September 2021 - UPDATE 2021: Human (Homo sapiens) IGKV and IGLV reference directory in IMGT/GENE-DB (IMGT/GENE-DB data updates), IMGT/LIGM-DB and IMGT Web resources

    Biocuration of the 25-IUIS-NOM-IMGT-NC_Report_2021-1-0611_Homsap_IGKV_IGLV pdf
  • Addition of 5 new IGKV alleles: IGKV1-5*04 F (MW316670), IGKV1-5*05 F (MW316676), IGKV1-8*02 F (MW316669), IGKV1-8*03 F (MW316671), IGKV4-1*02 F (MW316673) (NEW) and 1 sequence assigned to 1 known IGKV allele: 1 IGKV1-8*01 (MW316672) ('Lit').
  • Addition of 4 new IGLV alleles: IGLV1-44*02 F (MW316667), IGLV1-44*03 F (MW316668), 1 IGLV2-14*05 F (MW316674), IGLV7-46*04 F (MW316675). (NEW) and 2 reference sequences assigned to 2 known IGLV alleles: IGLV6-57*04 (MW316677), IGLV10- 54*04 (MW316678) (Refseq).

  • Update of 4 web pages in IMGT Repertoire (IG and TR):
    Gene table: human (Homo sapiens) IGKV.
    Gene table: human (Homo sapiens) IGLV.
    Alignment of alleles: human (Homo sapiens) IGKV.
    Alignment of alleles: human (Homo sapiens) IGLV.

    28 July 2021 - CREATION and UPDATE 2021: Crab-eating macaque (Macaca fascicularis) TRB in IMGT/GENE-DB, IMGT/LIGM-DB and IMGT Web resources

    Creation of the Crab-eating macaque (Macaca fascicularis) TRB reference directory (IMGT/GENE-DB data updates).
    Addition in IMGT/GENE-DB of:
    78 Crab-eating macaque (Macaca fascicularis) TRBV genes corresponding to 78 allelic sequences.
    2 Crab-eating macaque (Macaca fascicularis) TRBD genes corresponding to 2 allelic sequences.
    14 Crab-eating macaque (Macaca fascicularis) TRBJ genes corresponding to 14 allelic sequences.
    2 Crab-eating macaque (Macaca fascicularis) TRBC genes corresponding to 2 allelic sequences.

    Addition of Crab-eating macaque (Macaca fascicularis) TRB locus annotation of IMGT locus reference sequence IMGT000075

    Creation of 20 web pages in IMGT Repertoire (IG and TR):
    Locus representation: Crab-eating macaque (Macaca fascicularis) TRB.
    Locus description: Crab-eating macaque (Macaca fascicularis) TRB.
    Locus gene order: Crab-eating macaque (Macaca fascicularis) TRB.
    Locus in genome assembly: Crab-eating macaque (Macaca fascicularis) TRB.
    Potential germline repertoire: Crab-eating macaque (Macaca fascicularis) TRBV, TRBD and TRBJ genes.
    [CDR1-IMGT.CDR2-IMGT.CDR3-IMGT] lengths: Crab-eating macaque (Macaca fascicularis) per TRBV subgroup.
    Locus bornes: TRB locus 5' and 3' bornes.
    Gene table: Crab-eating macaque (Macaca fascicularis) TRBV.
    Gene table: Crab-eating macaque (Macaca fascicularis) TRBD.
    Gene table: Crab-eating macaque (Macaca fascicularis) TRBJ.
    Gene table: Crab-eating macaque (Macaca fascicularis) TRBC.
    Alignment of alleles: Crab-eating macaque (Macaca fascicularis) TRBV.
    Alignment of alleles: Crab-eating macaque (Macaca fascicularis) TRBD.
    Alignment of alleles: Crab-eating macaque (Macaca fascicularis) TRBJ.
    Alignment of alleles: Crab-eating macaque (Macaca fascicularis) TRBC.
    Protein displays: crab-eating macaque (Macaca fascicularis) TRBV.
    Protein displays: crab-eating macaque (Macaca fascicularis) TRBJ.
    Protein displays: crab-eating macaque (Macaca fascicularis) TRBC.
    Colliers de Perles: Crab-eating macaque (Macaca fascicularis) TRBV.
    Colliers de Perles: Crab-eating macaque (Macaca fascicularis) TRBC.

    01 July 2021 - UPDATE 2021: Human (Homo sapiens) IGHV reference directory in IMGT/GENE-DB (IMGT/GENE-DB data updates), IMGT/LIGM-DB and IMGT Web resources

    Addition in IMGT/GENE-DB of:
    3 new genes (3 (P)): IGHV1-68D*02 (P), IGHV(III)-67-4D*02 (P), IGHV(III)-67-3D*02 (P) (BK063799).

    Update of 4 web pages in IMGT Repertoire (IG and TR):
    Gene table: human (Homo sapiens) IGHV. Addition of IGHV1-68D*02.
    Gene table: human (Homo sapiens) IGHV. Addition of IGHV(III)-67-4D*02 and IGHV(III)-67-3D*02.
    Alignment of alleles: human (Homo sapiens) IGHV: IGHV1-68 and IGHV1-68D. Addition of IGHV1-68D*02.
    Locus representation: Human (Homo sapiens) IGH. : IGHV1-68D*02 (P), IGHV(III)-67-4D*02 (P) and IGHV(III)-67-3D*02 added in Copy Number Variation CNV1i (#16-21). PMID: 32878258

    03 June 2021 - CREATION and UPDATE 2021: Rhesus monkey (Macaca mulatta) IGL in IMGT/GENE-DB, IMGT/LIGM-DB and IMGT Web resources

    Creation of the Rhesus monkey (Macaca mulatta) IGL reference directory (IMGT/GENE-DB data updates).
    Addition in IMGT/GENE-DB of:
    149 Rhesus monkey (Macaca mulatta) IGLV genes corresponding to 225 allelic sequences.
    8 Rhesus monkey (Macaca mulatta) IGLJ genes corresponding to 9 allelic sequences.
    8 Rhesus monkey (Macaca mulatta) IGLC genes corresponding to 13 allelic sequences.

    Addition of Rhesus monkey (Macaca mulatta) IGL locus annotation of IMGT locus reference sequence IMGT000062 in IMGT/LIGM-DB.

    Update of IGL annotation of reference sequences NW_001095158; AM055970 to AM056022, AC214063 and AC215787 in IMGT/LIGM-DB.

    Creation of 6 web pages in IMGT Repertoire (IG and TR):
    Locus representation: Rhesus monkey (Macaca mulatta) IGL.
    Locus description: Rhesus monkey (Macaca mulatta) IGL.
    Locus gene order: Rhesus monkey (Macaca mulatta) IGL.
    Locus in genome assembly: Rhesus monkey (Macaca mulatta) IGL.
    Potential germline repertoire: Rhesus monkey (Macaca mulatta) IGLV and IGLJ genes on chromosome 10.
    [CDR1-IMGT.CDR2-IMGT.CDR3-IMGT] lengths: Rhesus monkey (Macaca mulatta) per IGLV subgroup.

    Update of 12 web pages in IMGT Repertoire (IG and TR):
    Locus bornes: IGL locus 5' and 3' bornes.
    Gene table: Rhesus monkey (Macaca mulatta) IGLV.
    Gene table: Rhesus monkey (Macaca mulatta) IGLJ.
    Gene table: Rhesus monkey (Macaca mulatta) IGLC.
    Alignment of alleles: Rhesus monkey (Macaca mulatta) IGLV.
    Alignment of alleles: Rhesus monkey (Macaca mulatta) IGLJ.
    Alignment of alleles: Rhesus monkey (Macaca mulatta) IGLC.
    Protein displays: Rhesus monkey (Macaca mulatta) IGLV.
    Protein displays: Rhesus monkey (Macaca mulatta) IGLJ.
    Protein displays: Rhesus monkey (Macaca mulatta) IGLC.
    Colliers de Perles: Rhesus monkey (Macaca mulatta) IGLV.
    Colliers de Perles: Rhesus monkey (Macaca mulatta) IGLC.

    30 April 2021 - CREATION and UPDATE 2021: Rhesus monkey (Macaca mulatta) IGK in IMGT/GENE-DB, IMGT/LIGM-DB and IMGT Web resources

    Creation of the Rhesus monkey (Macaca mulatta) IGK reference directory (IMGT/GENE-DB data updates).
    Addition in IMGT/GENE-DB of:
    138 Rhesus monkey (Macaca mulatta) IGKV genes corresponding to 207 allelic sequences.
    5 Rhesus monkey (Macaca mulatta) IGKJ genes corresponding to 5 allelic sequences.
    1 Rhesus monkey (Macaca mulatta) IGKC genes corresponding to 2 allelic sequences.

    Addition of Rhesus monkey (Macaca mulatta) IGK locus annotation of IMGT locus reference sequence IMGT000063 in IMGT/LIGM-DB.

    Update of IGK annotation of reference sequences NW_001099007; AY963709 to AY963773, X79831 in IMGT/LIGM-DB.

    Creation of 6 web pages in IMGT Repertoire (IG and TR):
    Locus representation: Rhesus monkey (Macaca mulatta) IGK.
    Locus description: Rhesus monkey (Macaca mulatta) IGK.
    Locus gene order: Rhesus monkey (Macaca mulatta) IGK.
    Locus in genome assembly: Rhesus monkey (Macaca mulatta) IGK.
    Potential germline repertoire: Rhesus monkey (Macaca mulatta) IGKV and IGKJ genes on chromosome 13.
    [CDR1-IMGT.CDR2-IMGT.CDR3-IMGT] lengths: Rhesus monkey (Macaca mulatta) per IGKV subgroup.

    Update of 12 web pages in IMGT Repertoire (IG and TR):
    Locus bornes: IGK locus 5' and 3' bornes.
    Gene table: Rhesus monkey (Macaca mulatta) IGKV.
    Gene table: Rhesus monkey (Macaca mulatta) IGKJ.
    Gene table: Rhesus monkey (Macaca mulatta) IGKC.
    Alignment of alleles: Rhesus monkey (Macaca mulatta) IGKV.
    Alignment of alleles: Rhesus monkey (Macaca mulatta) IGKJ.
    Alignment of alleles: Rhesus monkey (Macaca mulatta) IGKC.
    Protein displays: Rhesus monkey (Macaca mulatta) IGKV.
    Protein displays: Rhesus monkey (Macaca mulatta) IGKJ.
    Protein displays: Rhesus monkey (Macaca mulatta) IGKC.
    Colliers de Perles: Rhesus monkey (Macaca mulatta) IGKV.
    Colliers de Perles: Rhesus monkey (Macaca mulatta) IGKC.

    30 April 2021 - UPDATE 2021: Rhesus monkey (Macaca mulatta) TRB in IMGT/GENE-DB, IMGT/LIGM-DB and IMGT Web resources

    Update of the Rhesus monkey (Macaca mulatta) TRB reference directory (IMGT/GENE-DB data updates).
    Addition in IMGT/GENE-DB of:
    49 Rhesus monkey (Macaca mulatta) TRBV new alleles.
    2 Rhesus monkey (Macaca mulatta) TRBJ new alleles.
    2 Rhesus monkey (Macaca mulatta) TRBC new alleles.

    Addition of new alleles TRB annotation of IMGT reference sequence IMGT000073 and update of TRB annotation of IMGT000012 and NW_001114291 in IMGT/LIGM-DB.

    Update of 16 web pages in IMGT Repertoire (IG and TR):
    Gene table: Rhesus monkey (Macaca mulatta) TRBV.
    Gene table: Rhesus monkey (Macaca mulatta) TRBJ.
    Gene table: Rhesus monkey (Macaca mulatta) TRBC.
    Alignment of alleles: Rhesus monkey (Macaca mulatta) TRBV.
    Alignment of alleles: Rhesus monkey (Macaca mulatta) TRBJ.
    Alignment of alleles: Rhesus monkey (Macaca mulatta) TRBC.
    Protein displays: Rhesus monkey (Macaca mulatta) TRBV.
    Protein displays: Rhesus monkey (Macaca mulatta) TRBJ.
    Protein displays: Rhesus monkey (Macaca mulatta) TRBC.
    Colliers de Perles: Rhesus monkey (Macaca mulatta) TRBV.
    Colliers de Perles: Rhesus monkey (Macaca mulatta) TRBC.
    Locus representation: Rhesus monkey (Macaca mulatta) TRB.
    Locus in genome assembly: Rhesus monkey (Macaca mulatta) TRB.
    Locus description: Rhesus monkey (Macaca mulatta) TRB.
    Potential germline repertoire: Rhesus monkey (Macaca mulatta) TRBV, TRBD and TRBJ genes on chromosome 3.
    [CDR1-IMGT.CDR2-IMGT.CDR3-IMGT] lengths: Rhesus monkey (Macaca mulatta) TRBV.

    12 March 2021 - UPDATE 2020: Human (Homo sapiens) IGKV and IGLV reference directory in IMGT/GENE-DB (IMGT/GENE-DB data updates), IMGT/LIGM-DB and IMGT Web resources

    Update 1 Homo sapiens IGKV and 2 Homo sapiens IGLV reference sequences in IMGT reference directory:
    IGKV1D-8*04 (F), IGLV10-54*04 (F), IGLV6-57*04 (F), (IMGT-NC_Report_2020-3-1120_Homsap_IGKV_IGLV_201120).
    Addition in IMGT/GENE-DB of:
    3 new alleles (3 (F)): IGKV1D-8*04 F (MK308861), IGLV10-54*04 (F) (MK308862), IGLV6-57*04 (F) (MK308866).

    Update of 4 web pages in IMGT Repertoire (IG and TR):
    Gene table: human (Homo sapiens) IGKV.
    Gene table: human (Homo sapiens) IGLV.
    Alignment of alleles: human (Homo sapiens) IGKV.
    Alignment of alleles: human (Homo sapiens) IGLV.

    05 March 2021 - UPDATE 2020: Human (Homo sapiens) IGHV reference directory in IMGT/GENE-DB (IMGT/GENE-DB data updates), IMGT/LIGM-DB and IMGT Web resources

    Update 5 Homo sapiens IGHV reference sequences in IMGT reference directory:
    IGHV2-70*20 F, IGHV3-33*08 F, IGHV3-35*02 F, IGHV2-26*04 F, (IMGT-NC_Report_2020-2-1008_Homsap_IGHV), IGHV1-68*03 P.
    Addition in IMGT/GENE-DB of:
    4 new alleles (4 P): IGHV(III)-67-4*02 P (AC279908), IGHV(II)-28-1*04 P, IGHV(II)-33-1*02 P (AC279998), IGHV(III)-38-1*03 P (AC280057).

    Update of 3 web pages in IMGT Repertoire (IG and TR):
    Gene table: human (Homo sapiens) IGHV.
    Alignment of alleles: human (Homo sapiens) IGHV.
    Locus representation: Human (Homo sapiens) IGH.

    23 February 2021 - 30 July 2021 - CREATION and UPDATE 2021: Rhesus monkey (Macaca mulatta) IGH in IMGT/GENE-DB, IMGT/LIGM-DB and IMGT Web resources


    Addition of IGH annotation of IMGT locus reference sequence IMGT000064 in IMGT/LIGM-DB.

    Addition in IMGT/GENE-DB of:
    86 Rhesus monkey (Macaca mulatta) IGHV genes corresponding to 86 allelic sequences
    13 Rhesus monkey (Macaca mulatta) IGHD genes corresponding to 13 allelic sequences
    1 Rhesus monkey (Macaca mulatta) IGHC gene corresponding to 1 allelic sequence

    Update in IMGT/GENE-DB of:
    142 Rhesus monkey (Macaca mulatta) IGHV genes corresponding to 251 allelic sequences
    32 Rhesus monkey (Macaca mulatta) IGHD genes corresponding to 36 allelic sequences
    7 Rhesus monkey (Macaca mulatta) IGHJ genes corresponding to 10 allelic sequences
    7 Rhesus monkey (Macaca mulatta) IGHC genes corresponding to 51 allelic sequences

    Update of 2 web pages in IMGT Repertoire (IG and TR):
    Gene table: Rhesus monkey (Macaca mulatta) IGHC.
    Colliers de Perles: Rhesus monkey (Macaca mulatta) IGHC.

    Creation of 17 web pages in IMGT Repertoire (IG and TR):
    Locus in genome assembly: Rhesus monkey (Macaca mulatta) IGH.
    Locus description: Rhesus monkey (Macaca mulatta) IGH.
    Locus gene order: Rhesus monkey (Macaca mulatta) IGH.
    Locus representation: Rhesus monkey (Macaca mulatta) IGH.
    Gene table: Rhesus monkey (Macaca mulatta) IGHV.
    Gene table: Rhesus monkey (Macaca mulatta) IGHD.
    Gene table: Rhesus monkey (Macaca mulatta) IGHJ.
    Potential germline repertoire: Rhesus monkey (Macaca mulatta) IGHV, IGHD and IGHJ genes on chromosome 7.
    Alignment of alleles: Rhesus monkey (Macaca mulatta) IGHV.
    Alignment of alleles: Rhesus monkey (Macaca mulatta) IGHD.
    Alignment of alleles: Rhesus monkey (Macaca mulatta) IGHJ.
    Alignment of alleles: Rhesus monkey (Macaca mulatta) IGHC.
    Protein displays: Rhesus monkey (Macaca mulatta) IGHV.
    Protein displays: Rhesus monkey (Macaca mulatta) IGHJ.
    Protein displays: Rhesus monkey (Macaca mulatta) IGHC.
    Colliers de Perles: Rhesus monkey (Macaca mulatta) IGHV.
    [CDR1-IMGT.CDR2-IMGT.CDR3-IMGT] lengths: Rhesus monkey (Macaca mulatta) per IGHV subgroup.

    15 January 2021 - NEW GENES and UPDATE 2021: Human (Homo sapiens) IGHV/OR16 orphon set reference directory in IMGT/GENE-DB, IMGT/LIGM-DB and IMGT Web resources

    Addition in IMGT/GENE-DB (IMGT/GENE-DB data updates) of:
    12 new genes and alleles (2 ORF, 10 P): IGHV3/OR16-17*01 ORF, IGHV3/OR16-18*01 P, IGHV3/OR16-19*01 P, IGHV3/OR16-20*01 ORF, IGHV1/OR16-21*01 P, IGHV1/OR16-22*01 P, IGHV2/OR16-23*01 P, IGHV1/OR16-24*01 P, IGHV(III)/OR16-25*01 P, IGHV1/OR16-26*01 P, IGHV(III)/OR16-27*01 P and IGHV(III)/OR16-28*01 P (IMGT000069).
    Update of 12 Homo sapiens IGHV/OR16 orphon set reference sequences in IMGT reference directory:
    IGHV1/OR16-1*01 P, IGHV1/OR16-2*01 P, IGHV1/OR16-3*01 P, IGHV1/OR16-4*01 P, IGHV3/OR16-7*01 P, IGHV3/OR16-8*01 ORF, IGHV3/OR16-9*01 ORF, IGHV3/OR16-10*01 ORF, IGHV3/OR16-11*01 P, IGHV3/OR16-12*01 ORF, IGHV3/OR16-13*01 ORF, IGHV3/OR16-16*01 P.

    Update of 6 web pages in IMGT Repertoire (IG and TR):
    Locus in genome assembly: human (Homo sapiens) IGH. Human (Homo sapiens) IGHV/OR16 orphon set locus.
    Locus representation: human (Homo sapiens) IGH orphons on chromosome 16 (16p11.2).
    Gene table: human (Homo sapiens) Chromosomal orphon set IGHV.
    List of the IG orphons per chromosome localization.
    IG and TR orphons (overview): Human.
    IG chromosomal orphon sets and links with HGNC, NCBI Gene and OMIM.

    2020

    07 October 2020 - UPDATE 2020: Human (Homo sapiens) IGLV reference directory in IMGT/GENE-DB (IMGT/GENE-DB data updates), IMGT/LIGM-DB and IMGT Web resources

    Update 7 Homo sapiens IGLV reference sequences in IMGT reference directory:
    IGLV4-60*03 F, IGLV2-14*03 F (IMGT-NC_Report_2020-1-0917_Homsap_IGLV), IGLV3-29*01, IGLV2-28*01, IGLV3-26*01, IGLV3-12*01, IGLV2-11*01.
    Addition in IMGT/GENE-DB of:
    1 new gene and allele (1P): IGLV(I)-11-1*01 P (AC279423).
    4 new alleles (4 P): IGLV(III)-60-1*02 P, IGLV(III)-59-1*02 P, IGLV(V)-58*02 P (AC279317), IGLV3-13*02 P (AC279423).

    Update of 3 web pages in IMGT Repertoire (IG and TR):
    Gene table: human (Homo sapiens) IGLV.
    Alignment of alleles: human (Homo sapiens) IGLV.
    Locus representation: Human (Homo sapiens) IGL.

    28 July 2020 - UPDATE 2020: Dog (Canis lupus familiaris) IGK in IMGT/GENE-DB, IMGT/LIGM-DB and IMGT Web resources

    Update of the dog (Canis lupus familiaris) IGK reference directory (IMGT/GENE-DB data updates).
    Addition in IMGT/GENE-DB of:
    27 dog (Canis lupus familiaris) IGKV genes corresponding to 36 allelic sequences.
    5 dog (Canis lupus familiaris) IGKJ genes corresponding to 5 allelic sequences.
    1 dog (Canis lupus familiaris) IGKC gene corresponding to 2 allelic sequences.

    Addition of IGK annotation of IMGT locus reference sequence IMGT000067 and update of IGK annotation of IMGT000002 in IMGT/LIGM-DB.

    Update of 17 web pages in IMGT Repertoire (IG and TR):
    Gene table: dog (Canis lupus familiaris) IGKV.
    Gene table: dog (Canis lupus familiaris) IGKJ.
    Gene table: dog (Canis lupus familiaris) IGKC.
    Alignment of alleles: dog (Canis lupus familiaris) IGKV.
    Alignment of alleles: dog (Canis lupus familiaris) IGKJ.
    Alignment of alleles: dog (Canis lupus familiaris) IGKC.
    Protein displays: dog (Canis lupus familiaris) IGKV.
    Protein displays: dog (Canis lupus familiaris) IGKJ.
    Protein displays: dog (Canis lupus familiaris) IGKC.
    Colliers de Perles: dog (Canis lupus familiaris) IGKV.
    Colliers de Perles: dog (Canis lupus familiaris) IGKC.
    Locus representation: dog (Canis lupus familiaris) IGK.
    Locus gene order: dog (Canis lupus familiaris) IGK.
    Locus in genome assembly: dog (Canis lupus familiaris) IGK.
    Locus description: dog (Canis lupus familiaris) IGK.
    Potential germline repertoire: dog (Canis lupus familiaris) IGKV.
    [CDR1-IMGT.CDR2-IMGT.CDR3-IMGT] lengths: dog (Canis lupus familiaris) IGKV.

    27 July 2020 - CREATION 2020 : Horse (Equus caballus) IGH in IMGT/GENE-DB, IMGT/LIGM-DB and IMGT Web resources

    Creation of the horse (Equus caballus) IGH reference directory (IMGT/GENE-DB data updates).
    Addition in IMGT/GENE-DB of:
    99 horse (Equus caballus) IGHV genes corresponding to 118 allelic sequences.
    40 horse (Equus caballus) IGHD genes corresponding to 40 allelic sequences.
    9 horse (Equus caballus) IGHJ genes corresponding to 9 allelic sequences.
    11 horse (Equus caballus) IGHC genes corresponding to 38 allelic sequences.

    Addition of IGH annotation of IMGT locus reference sequence IMGT000040 in IMGT/LIGM-DB.

    Creation of 19 web pages in IMGT Repertoire (IG and TR):
    Gene table: horse (Equus caballus) IGHV.
    Gene table: horse (Equus caballus) IGHD.
    Gene table: horse (Equus caballus) IGHJ.
    Gene table: horse (Equus caballus) IGHC.
    Alignment of alleles: horse (Equus caballus) IGHV.
    Alignment of alleles: horse (Equus caballus) IGHD.
    Alignment of alleles: horse (Equus caballus) IGHJ.
    Alignment of alleles: horse (Equus caballus) IGHC.
    Protein displays: horse (Equus caballus) IGHV.
    Protein displays: horse (Equus caballus) IGHJ.
    Protein displays: horse (Equus caballus) IGHC.
    Colliers de Perles: horse (Equus caballus) IGHV.
    Colliers de Perles: horse (Equus caballus) IGHC.
    Locus representation: horse (Equus caballus) IGH.
    Locus gene order: horse (Equus caballus) IGH.
    Locus in genome assembly: horse (Equus caballus) IGH.
    Locus description: horse (Equus caballus) IGH.
    Potential germline repertoire: horse (Equus caballus) IGHV, IGHD and IGHJ genes on chromosome 24.
    Horse (Equus caballus) [CDR1-IMGT.CDR2-IMGT.CDR3-IMGT] lengths per IGHV subgroup.

    25 June 2020 - UPDATE 2020: Sheep (Ovis aries) TRA/TRD in IMGT/GENE-DB, IMGT/LIGM-DB and IMGT Web resources

    Update of the sheep (Ovis aries) TRA/TRD reference directory (IMGT/GENE-DB data updates).
    Addition in IMGT/GENE-DB of:
    290 sheep (Ovis aries) TRAV genes corresponding to 341 allelic sequences.
    80 sheep (Ovis aries) TRAJ genes corresponding to 87 allelic sequences.
    1 sheep (Ovis aries) TRAC gene corresponding to 1 allelic sequence.
    77 sheep (Ovis aries) TRDV genes corresponding to 93 allelic sequences.
    9 sheep (Ovis aries) TRDD genes corresponding to 10 allelic sequences.
    4 sheep (Ovis aries) TRDJ genes corresponding to 4 allelic sequences.
    1 sheep (Ovis aries) TRDC gene corresponding to 2 allelic sequence.

    Addition of TRA/TRD locus annotation of IMGT locus reference sequence IMGT000048 in IMGT/LIGM-DB.

    Creation of 8 web pages in IMGT Repertoire (IG and TR):
    Locus gene order: sheep (Ovis aries) TRA/TRD.
    Locus in genome assembly: sheep (Ovis aries) TRA/TRD.
    Locus description: sheep (Ovis aries) TRA.
    Locus description: sheep (Ovis aries) TRD.
    Potential germline repertoire: sheep (Ovis aries) TRAV and TRAJ genes on chromosome 7.
    Potential germline repertoire: sheep (Ovis aries) TRDV, TRDD and TRDJ genes on chromosome 7.
    [CDR1-IMGT.CDR2-IMGT.CDR3-IMGT] lengths: sheep (Ovis aries) TRAV.
    [CDR1-IMGT.CDR2-IMGT.CDR3-IMGT] lengths: sheep (Ovis aries) TRDV.

    Update of 25 web pages in IMGT Repertoire (IG and TR):
    Gene table: sheep (Ovis aries) TRAV.
    Gene table: sheep (Ovis aries) TRAJ.
    Gene table: sheep (Ovis aries) TRAC.
    Gene table: sheep (Ovis aries) TRDV.
    Gene table: sheep (Ovis aries) TRDD.
    Gene table: sheep (Ovis aries) TRDJ.
    Gene table: sheep (Ovis aries) TRDC.
    Alignment of alleles: sheep (Ovis aries) TRAV.
    Alignment of alleles: sheep (Ovis aries) TRAJ.
    Alignment of alleles: sheep (Ovis aries) TRAC.
    Alignment of alleles: sheep (Ovis aries) TRDV.
    Alignment of alleles: sheep (Ovis aries) TRDD.
    Alignment of alleles: sheep (Ovis aries) TRDJ.
    Alignment of alleles: sheep (Ovis aries) TRDC.
    Protein displays: sheep (Ovis aries) TRAV.
    Protein displays: sheep (Ovis aries) TRAJ.
    Protein displays: sheep (Ovis aries) TRAC.
    Protein displays: sheep (Ovis aries) TRDV.
    Protein displays: sheep (Ovis aries) TRDJ.
    Protein displays: sheep (Ovis aries) TRDC.
    Colliers de Perles: sheep (Ovis aries) TRAV.
    Colliers de Perles: sheep (Ovis aries) TRAC.
    Colliers de Perles: sheep (Ovis aries) TRDV.
    Colliers de Perles: sheep (Ovis aries) TRDC.
    Locus representation: sheep (Ovis aries) TRA/TRD.

    11 June 2020 - CREATION 2020 : Arabian camel (Camelus dromedarius) IGK in IMGT/GENE-DB, IMGT/LIGM-DB and IMGT Web resources

    Creation of the Arabian camel (Camelus dromedarius) IGK reference directory (IMGT/GENE-DB data updates).
    Addition in IMGT/GENE-DB of:
    32 Arabian camel (Camelus dromedarius) IGKV genes corresponding to 32 allelic sequences.
    5 Arabian camel (Camelus dromedarius) IGKJ genes corresponding to 5 allelic sequences.
    1 Arabian camel (Camelus dromedarius) IGKC genes corresponding to 1 allelic sequences.

    Addition of IGK annotation of IMGT locus reference sequence IMGT000061 in IMGT/LIGM-DB.

    Creation of 17 web pages in IMGT Repertoire (IG and TR):
    Gene table: Arabian camel (Camelus dromedarius) IGKV.
    Gene table: Arabian camel (Camelus dromedarius) IGKJ.
    Gene table: Arabian camel (Camelus dromedarius) IGKC.
    Alignment of alleles: Arabian camel (Camelus dromedarius) IGKV.
    Alignment of alleles: Arabian camel (Camelus dromedarius) IGKJ.
    Alignment of alleles: Arabian camel (Camelus dromedarius) IGKC.
    Protein displays: Arabian camel (Camelus dromedarius) IGKV.
    Protein displays: Arabian camel (Camelus dromedarius) IGKJ.
    Protein displays: Arabian camel (Camelus dromedarius) IGKC.
    Colliers de Perles: Arabian camel (Camelus dromedarius) IGKV.
    Colliers de Perles: Arabian camel (Camelus dromedarius) IGKC.
    Locus representation: Arabian camel (Camelus dromedarius) IGK.
    Locus gene order: Arabian camel (Camelus dromedarius) IGK.
    Locus in genome assembly: Arabian camel (Camelus dromedarius) IGK.
    Locus description: Arabian camel (Camelus dromedarius) IGK.
    Potential germline repertoire: Arabian camel (Camelus dromedarius) IGKV and IGKJ genes on chromosome 28.
    Arabian camel (Camelus dromedarius) [CDR1-IMGT.CDR2-IMGT.CDR3-IMGT] lengths per IGKV subgroup.

    8 June 2020 - UPDATE 2020: Bovine (Bos taurus) TRA/TRD in IMGT/GENE-DB, IMGT/LIGM-DB and IMGT Web resources

    Update of the bovine (Bos taurus) TRA/TRD reference directory (IMGT/GENE-DB data updates).
    Addition in IMGT/GENE-DB of:
    183 bovine (Bos taurus) TRAV genes corresponding to 263 allelic sequences.
    60 bovine (Bos taurus) TRAJ genes corresponding to 72 allelic sequences.
    1 bovine (Bos taurus) TRAC gene corresponding to 2 allelic sequence.
    55 bovine (Bos taurus) TRDV genes corresponding to 72 allelic sequences.
    9 bovine (Bos taurus) TRDD genes corresponding to 9 allelic sequences.
    4 bovine (Bos taurus) TRDJ genes corresponding to 4 allelic sequences.
    1 bovine (Bos taurus) TRDC gene corresponding to 1 allelic sequence.

    Addition of TRA/TRD locus annotation of IMGT locus reference sequence IMGT000049 in IMGT/LIGM-DB.

    Creation of 12 web pages in IMGT Repertoire (IG and TR):
    Gene table: bovine (Bos taurus) TRAV.
    Alignment of alleles: bovine (Bos taurus) TRAV.
    Protein displays: bovine (Bos taurus) TRAV.
    Colliers de Perles: bovine (Bos taurus) TRAV.
    Locus gene order: bovine (Bos taurus) TRA/TRD.
    Locus in genome assembly: bovine (Bos taurus) TRA/TRD.
    Locus description: bovine (Bos taurus) TRA.
    Locus description: bovine (Bos taurus) TRD.
    Potential germline repertoire: bovine (Bos taurus) TRAV and TRAJ genes on chromosome 10.
    Potential germline repertoire: bovine (Bos taurus) TRDV, TRDD and TRDJ genes on chromosome 10.
    [CDR1-IMGT.CDR2-IMGT.CDR3-IMGT] lengths: bovine (Bos taurus) TRAV.
    [CDR1-IMGT.CDR2-IMGT.CDR3-IMGT] lengths: bovine (Bos taurus) TRDV.

    Update of 21 web pages in IMGT Repertoire (IG and TR):
    Gene table: bovine (Bos taurus) TRAJ.
    Gene table: bovine (Bos taurus) TRAC.
    Gene table: bovine (Bos taurus) TRDV.
    Gene table: bovine (Bos taurus) TRDD.
    Gene table: bovine (Bos taurus) TRDJ.
    Gene table: bovine (Bos taurus) TRDC.
    Alignment of alleles: bovine (Bos taurus) TRAJ.
    Alignment of alleles: bovine (Bos taurus) TRAC.
    Alignment of alleles: bovine (Bos taurus) TRDV.
    Alignment of alleles: bovine (Bos taurus) TRDD.
    Alignment of alleles: bovine (Bos taurus) TRDJ.
    Alignment of alleles: bovine (Bos taurus) TRDC.
    Protein displays: bovine (Bos taurus) TRAJ.
    Protein displays: bovine (Bos taurus) TRAC.
    Protein displays: bovine (Bos taurus) TRDV.
    Protein displays: bovine (Bos taurus) TRDJ.
    Protein displays: bovine (Bos taurus) TRDC.
    Colliers de Perles: bovine (Bos taurus) TRAC.
    Colliers de Perles: bovine (Bos taurus) TRDV.
    Colliers de Perles: bovine (Bos taurus) TRDC.
    Locus representation: bovine (Bos taurus) TRA/TRD.

    07 May 2020 - UPDATE 2020: Human (Homo sapiens) IGLV in IMGT/GENE-DB, IMGT/LIGM-DB and IMGT Web resources

    Update of IMGT gene name in IMGT/LIGM-DB, IMGT/GENE-DB and IMGT Web resources of 1 IGLV gene :
    The IMGT sequence from the literature D87014 have been now assigned to the IMGT reference sequence of IGLV3-32.

    30 April 2020 - UPDATE 2020: Human (Homo sapiens) IGLV in IMGT/GENE-DB, IMGT/LIGM-DB and IMGT Web resources

    Update of the human (Homo sapiens) IGL reference directory (IMGT/GENE-DB data updates).
    Addition in IMGT/GENE-DB of:
    16 IGLV genes corresponding to 16 allelic sequences : IGLV(VI)-22-1*02 P, IGLV3-22*03 F, IGLV3-21*04 F, IGLV(I)-20*02 P, IGLV3-19*02 F, IGLV(II)-24-1*01 P, IGLV3-24*03 P, IGLV6-57*03 F, IGLV(IV)-55-1*01 P, IGLV(IV)-53*02 P, IGLV(VI)-22-1*03 P, IGLV(III)-60-1*01 P, IGLV4-60*04 P, IGLV(III)-59-1*01 P, IGLV1-47*03 F, IGLV3-10*03 F.

    Addition of IMGT reference sequence annotation of IGLV(VI)-22-1*02 P, IGLV3-22*03 F, IGLV3-21*04 F, IGLV(I)-20*02 P, IGLV3-19*02 F (AC279208), IGLV(II)-24-1*01 P (D86994), IGLV3-24*03 P (AC279219), IGLV(IV)-55-1*01 P (D86996), IGLV6-57*03 F, IGLV(IV)-53*02 P (AC279220), IGLV(VI)-22-1*03 P (AC279210), IGLV(III)-60-1*01 P, IGLV(III)-59-1*01 P (D87000), IGLV4-60*04 P (AC279212), IGLV1-47*03 F (AC279207), IGLV3-10*03 F (AC279221).

    Update of 2 web pages in IMGT Repertoire (IG and TR):
    Gene table: human (Homo sapiens) IGLV.
    Alignment of alleles: human (Homo sapiens) IGLV.
    Locus representation: Human (Homo sapiens) IGL.

    31 March 2020 - UPDATE 2020: Sheep (Ovis aries) IGL in IMGT/GENE-DB, IMGT/LIGM-DB and IMGT Web resources

    Creation of the sheep (Ovis aries) IGL reference directory (IMGT/GENE-DB data updates).
    Addition in IMGT/GENE-DB of:
    127 sheep (Ovis aries) IGLV genes corresponding to 157 allelic sequences.
    2 sheep (Ovis aries) IGLJ genes corresponding to 2 allelic sequences.
    2 sheep (Ovis aries) IGLC genes corresponding to 4 allelic sequences.
    1 sheep (Ovis aries) VPREB3 gene corresponding to 1 allelic sequence.
    1 sheep (Ovis aries) IGLL3 gene corresponding to 1 allelic sequence.

    Addition of sheep (Ovis aries) IGL locus annotation of IMGT locus reference sequence IMGT000034 and IMGT000041 in IMGT/LIGM-DB.

    Update of IGL annotation of reference sequences AF040900 to AF040924, M60440 and M60441 in IMGT/LIGM-DB.

    Creation of 18 web pages in IMGT Repertoire (IG and TR):
    Gene table: sheep (Ovis aries) IGLC.
    Gene and allele table: sheep (Ovis aries) VPREB in IMGT Repertoire (RPI)
    Gene and allele table: sheep (Ovis aries) IGLL in IMGT Repertoire (RPI)
    Alignment of alleles: sheep (Ovis aries) IGLV.
    Alignment of alleles: sheep (Ovis aries) IGLJ.
    Alignment of alleles: sheep (Ovis aries) IGLC.
    Alignment of alleles: sheep (Ovis aries) VPREB3 in IMGT Repertoire (RPI)
    Alignment of alleles: sheep (Ovis aries) IGLL3 in IMGT Repertoire (RPI)
    Protein displays: sheep (Ovis aries) VPREB3 in IMGT Repertoire (RPI)
    Protein displays: sheep (Ovis aries) IGLL3 in IMGT Repertoire (RPI)
    Colliers de Perles: sheep (Ovis aries) IGLV.
    Colliers de Perles: sheep (Ovis aries) IGLC.
    Locus representation: sheep (Ovis aries) IGL.
    Potential germline repertoire: sheep (Ovis aries) IGLV and IGLJ genes on chromosome 17.
    Locus description: sheep (Ovis aries) IGL.
    Locus gene order: sheep (Ovis aries) IGL.
    Locus in genome assembly: sheep (Ovis aries) IGL.
    [CDR1-IMGT.CDR2-IMGT.CDR3-IMGT] lengths: sheep (Ovis aries) IGLV.

    Update of 5 web pages in IMGT Repertoire (IG and TR):
    Gene table: sheep (Ovis aries) IGLV.
    Gene table: sheep (Ovis aries) IGLJ.
    Protein displays: sheep (Ovis aries) IGLV.
    Protein displays: sheep (Ovis aries) IGLJ.
    Protein displays: sheep (Ovis aries) IGLC.

    24 March 2020 - UPDATE 2020: Human (Homo sapiens) IGHV in IMGT/GENE-DB, IMGT/LIGM-DB and IMGT Web resources

    Update of the human (Homo sapiens) IGH reference directory (IMGT/GENE-DB data updates).
    Addition in IMGT/GENE-DB of:
    7 IGHV genes corresponding to 7 allelic sequences : IGHV1-2*07 F, IGHV1-3*05 F, IGHV1-69*19 F, IGHV3-7*05 F, IGHV3-21*06 F, IGHV3-64D*08 F, IGHV3-64D*09 F.

    Addition of IMGT reference sequence annotation of IGHV1-2*07 (MN337615), IGHV1-3*05 (MN337616), IGHV1-69*19 (MN337618), IGHV3-7*05 (MN337619), IGHV3-21*06 (MN337623), IGHV3-64D*08 (MN337624), IGHV3-64D*09 (MN337625).

    Update of 2 web pages in IMGT Repertoire (IG and TR):
    Gene table: human (Homo sapiens) IGHV.
    Alignment of alleles: human (Homo sapiens) IGHV.

    19 February 2020 - UPDATE 2020: Human (Homo sapiens) IGHV in IMGT/GENE-DB, IMGT/LIGM-DB and IMGT Web resources

    Update of the human (Homo sapiens) IGH reference directory (IMGT/GENE-DB data updates).
    Addition in IMGT/GENE-DB of:
    3 IGHV genes corresponding to 3 allelic sequences : IGHV4-61*10 (F), IGHV1-69*18 (F), IGHV4-4*09 (F).

    Addition of IMGT reference sequence annotation of IGHV4-61*10 (MK471386), IGHV1-69*18 (MK471382), IGHV4-4*09 (MK471384) in IMGT/LIGM-DB.

    Update of 2 web pages in IMGT Repertoire (IG and TR):
    Gene table: human (Homo sapiens) IGHV.
    Alignment of alleles: human (Homo sapiens) IGHV.

    11 February 2020 - CREATION 2020 : Horse (Equus caballus) IGK in IMGT/GENE-DB, IMGT/LIGM-DB and IMGT Web resources

    Creation of the horse (Equus caballus) IGK reference directory (IMGT/GENE-DB data updates).
    Addition in IMGT/GENE-DB of:
    66 horse (Equus caballus) IGKV genes corresponding to 80 allelic sequences.
    5 horse (Equus caballus) IGKJ genes corresponding to 6 allelic sequences.
    1 horse (Equus caballus) IGKC genes corresponding to 2 allelic sequences.

    Addition of IGK annotation of IMGT locus reference sequence IMGT000053 and IMGT000060 in IMGT/LIGM-DB.

    Creation of 17 web pages in IMGT Repertoire (IG and TR):
    Gene table: horse (Equus caballus) IGKV.
    Gene table: horse (Equus caballus) IGKJ.
    Gene table: horse (Equus caballus) IGKC.
    Alignment of alleles: horse (Equus caballus) IGKV.
    Alignment of alleles: horse (Equus caballus) IGKJ.
    Alignment of alleles: horse (Equus caballus) IGKC.
    Protein displays: horse (Equus caballus) IGKV.
    Protein displays: horse (Equus caballus) IGKJ.
    Protein displays: horse (Equus caballus) IGKC.
    Colliers de Perles: horse (Equus caballus) IGKV.
    Colliers de Perles: horse (Equus caballus) IGKC.
    Locus representation: horse (Equus caballus) IGK.
    Locus gene order: horse (Equus caballus) IGK.
    Locus in genome assembly: horse (Equus caballus) IGK.
    Locus description: horse (Equus caballus) IGK.
    Potential germline repertoire: horse (Equus caballus) IGKV and IGKJ genes on chromosome 15.
    Horse (Equus caballus) [CDR1-IMGT.CDR2-IMGT.CDR3-IMGT] lengths per IGKV subgroup.

    03 February 2020 - CREATION 2020: Rhesus monkey (Macaca mulatta) TRG in IMGT/GENE-DB, IMGT/LIGM-DB and IMGT Web resources

    Creation of the Rhesus monkey (Macaca mulatta) TRG reference directory (IMGT/GENE-DB data updates).
    Addition in IMGT/GENE-DB of:
    12 Rhesus monkey (Macaca mulatta) TRGV genes corresponding to 12 allelic sequences.
    5 Rhesus monkey (Macaca mulatta) TRGJ genes corresponding to 5 allelic sequences.
    2 Rhesus monkey (Macaca mulatta) TRGC genes corresponding to 2 allelic sequences.

    Addition of TRG annotation of IMGT locus reference sequence IMGT000059 in IMGT/LIGM-DB.

    Creation of 17 web pages in IMGT Repertoire (IG and TR):
    Gene table: Rhesus monkey (Macaca mulatta) TRGV.
    Gene table: Rhesus monkey (Macaca mulatta) TRGJ.
    Gene table: Rhesus monkey (Macaca mulatta) TRGC.
    Alignment of alleles: Rhesus monkey (Macaca mulatta) TRGV.
    Alignment of alleles: Rhesus monkey (Macaca mulatta) TRGJ.
    Alignment of alleles: Rhesus monkey (Macaca mulatta) TRGC.
    Protein displays: Rhesus monkey (Macaca mulatta) TRGV.
    Protein displays: Rhesus monkey (Macaca mulatta) TRGJ.
    Protein displays: Rhesus monkey (Macaca mulatta) TRGC.
    Colliers de Perles: Rhesus monkey (Macaca mulatta) TRGV.
    Colliers de Perles: Rhesus monkey (Macaca mulatta) TRGC.
    Locus representation: Rhesus monkey (Macaca mulatta) TRG.
    Locus gene order: Rhesus monkey (Macaca mulatta) TRG.
    Locus in genome assembly: Rhesus monkey (Macaca mulatta) TRG.
    Locus description: Rhesus monkey (Macaca mulatta) TRG.
    Potential germline repertoire: Rhesus monkey (Macaca mulatta) TRGV and TRGJ genes on chromosome 3.
    Rhesus monkey (Macaca mulatta) [CDR1-IMGT.CDR2-IMGT.CDR3-IMGT] lengths per TRGV subgroup.

    2019

    23 December 2019 - UPDATE 2019: Human (Homo sapiens) TRA/TRD in IMGT/GENE-DB, IMGT/LIGM-DB and IMGT Web resources

    Update of the human (Homo sapiens) TRA/TRD reference directory (IMGT/GENE-DB data updates).
    Addition in IMGT/GENE-DB of:
    7 human (Homo sapiens) TRAV genes: TRAV46 (P), TRAVA (P), TRAVB (P), TRAVC (P), TRAV11-1 (P), TRAV14-1 (P), TRAV8-6-1 (P),
    64 human (Homo sapiens) TRAV allelic sequences (22 NEW, 42 Litt).
    61 human (Homo sapiens) TRAJ allelic sequences (5 NEW, 56 Litt).
    1 human (Homo sapiens) TRAC allelic sequence (1 Litt).
    3 human (Homo sapiens) TRDV allelic sequences (3 Litt).
    3 human (Homo sapiens) TRDD allelic sequences (3 Litt).
    4 human (Homo sapiens) TRDJ allelic sequences (4 Litt).
    1 human (Homo sapiens) TRDC allelic sequence (1 Litt).

    Addition of TRA/TRD annotation of IMGT locus reference sequence IMGT000024 in IMGT/LIGM-DB.

    Creation of 1 web page in IMGT Repertoire (IG and TR):
    Locus in genome assembly: human (Homo sapiens) TRA/TRD.

    Update of 28 web pages in IMGT Repertoire (IG and TR):
    Gene table: human (Homo sapiens) TRAV.
    Gene table: human (Homo sapiens) TRAJ.
    Gene table: human (Homo sapiens) TRAC.
    Gene table: human (Homo sapiens) TRDV.
    Gene table: human (Homo sapiens) TRDD.
    Gene table: human (Homo sapiens) TRDJ.
    Gene table: human (Homo sapiens) TRDC.
    Alignment of alleles: human (Homo sapiens) TRAV.
    Alignment of alleles: human (Homo sapiens) TRAJ.
    Alignment of alleles: human (Homo sapiens) TRAC.
    Alignment of alleles: human (Homo sapiens) TRDV.
    Alignment of alleles: human (Homo sapiens) TRDD.
    Alignment of alleles: human (Homo sapiens) TRDJ.
    Alignment of alleles: human (Homo sapiens) TRDC.
    Protein displays: human (Homo sapiens) TRAV.
    Protein displays: human (Homo sapiens) TRAJ.
    Protein displays: human (Homo sapiens) TRAC.
    Protein displays: human (Homo sapiens) TRDV.
    Protein displays: human (Homo sapiens) TRDJ.
    Protein displays: human (Homo sapiens) TRDC.
    Colliers de Perles: human (Homo sapiens) TRAV.
    Colliers de Perles: human (Homo sapiens) TRAC.
    Colliers de Perles: human (Homo sapiens) TRDV.
    Colliers de Perles: human (Homo sapiens) TRDC.
    Locus representation: human (Homo sapiens) TRA/TRD.
    Locus gene order: human (Homo sapiens) TRA/TRD.
    Potential germline repertoire: human (Homo sapiens) TRAV genes on chromosome 14.
    Potential germline repertoire: human (Homo sapiens) TRDV genes on chromosome 14.

    17 December 2019 - UPDATE 2019: Human (Homo sapiens) IGHV in IMGT/GENE-DB, IMGT/LIGM-DB and IMGT Web resources

    Update of the human (Homo sapiens) IGH reference directory (IMGT/GENE-DB data updates).
    Addition in IMGT/GENE-DB of:
    3 IGHV genes corresponding to 3 allelic sequences : IGHV3-21*05 (F), IGHV3-53*05 (F), IGHV3-7*04 (F) .

    Addition of IMGT reference sequence annotation of IGHV3-21*05 (MK308859), IGHV3-53*05 (MK308860), IGHV3-7*04 (BK010574) in IMGT/LIGM-DB.

    Update of 3 web pages in IMGT Repertoire (IG and TR):
    Gene table: human (Homo sapiens) IGHV.
    Alignment of alleles: human (Homo sapiens) IGHV.

    15 December 2019 - UPDATE 2019: Human (Homo sapiens) IGHV in IMGT/GENE-DB, IMGT/LIGM-DB and IMGT Web resources

    Update of the human (Homo sapiens) IGH reference directory (IMGT/GENE-DB data updates).
    Addition in IMGT/GENE-DB of:
    6 IGHV genes corresponding to 6 allelic sequences : IGHV3-33*07 F, IGHV4-59*13 F, IGHV5-51*07 F, IGHV6-1*03 P, IGHV7-34-1*03 P, IGHV8-51-1*03 P.

    Addition of IMGT reference sequence annotation of IGHV3-33*07 (IMGT000056), IGHV4-59*13 (IMGT000058), IGHV5-51*07 (IMGT000055), IGHV6-1*03 (IMGT000054), IGHV7-34-1*03 (IMGT000056), IGHV8-51-1*03 (IMGT000055) in IMGT/LIGM-DB.

    Update of 3 web pages in IMGT Repertoire (IG and TR):
    Gene table: human (Homo spaiens) IGHV.
    Alignment of alleles: human (Homo spaiens) IGHV.
    Locus representation: Human (Homo sapiens) IGH.

    15 Octobre 2019 - CREATION 2019: Rainbow trout (Oncorhynchus mykiss) IGH in IMGT/GENE-DB, IMGT/LIGM-DB and IMGT Web resources

    Creation of the rainbow trout (Oncorhynchus mykiss) IGH reference directory (IMGT/GENE-DB data updates).
    Addition in IMGT/GENE-DB of:
    202 rainbow trout (Oncorhynchus mykiss) IGHV genes corresponding to 211 allelic sequences.
    32 rainbow trout (Oncorhynchus mykiss) IGHD genes corresponding to 34 allelic sequences.
    19 rainbow trout (Oncorhynchus mykiss) IGHJ genes corresponding to 21 allelic sequences.
    5 rainbow trout (Oncorhynchus mykiss) IGHC genes corresponding to 7 allelic sequences.

    Addition of IGH annotation of IMGT locus reference sequence IMGT000043, IMGT000044 and AY872256 in IMGT/LIGM-DB.

    Creation of 19 web pages in IMGT Repertoire (IG and TR):
    Gene table: rainbow trout (Oncorhynchus mykiss) IGHV.
    Gene table: rainbow trout (Oncorhynchus mykiss) IGHD.
    Gene table: rainbow trout (Oncorhynchus mykiss) IGHJ.
    Gene table: rainbow trout (Oncorhynchus mykiss) IGHC.
    Alignment of alleles: rainbow trout (Oncorhynchus mykiss) IGHV.
    Alignment of alleles: rainbow trout (Oncorhynchus mykiss) IGHD.
    Alignment of alleles: rainbow trout (Oncorhynchus mykiss) IGHJ.
    Alignment of alleles: rainbow trout (Oncorhynchus mykiss) IGHC.
    Protein displays: rainbow trout (Oncorhynchus mykiss) IGHV.
    Protein displays: rainbow trout (Oncorhynchus mykiss) IGHJ.
    Protein displays: rainbow trout (Oncorhynchus mykiss) IGHC.
    Colliers de Perles: rainbow trout (Oncorhynchus mykiss) IGHV.
    Colliers de Perles: rainbow trout (Oncorhynchus mykiss) IGHC.
    Locus representation: rainbow trout (Oncorhynchus mykiss) IGH.
    Locus gene order: rainbow trout (Oncorhynchus mykiss) IGH.
    Locus in genome assembly: rainbow trout (Oncorhynchus mykiss) IGH.
    Locus description: rainbow trout (Oncorhynchus mykiss) IGH.
    Potential germline repertoire: rainbow trout (Oncorhynchus mykiss) IGHV, IGHD and IGHJ genes.
    Rainbow trout (Oncorhynchus mykiss) [CDR1-IMGT.CDR2-IMGT.CDR3-IMGT] lengths per IGHV subgroup.

    26 August 2019 - CREATION 2019: Domestic cat (Felis catus) IGK in IMGT/GENE-DB, IMGT/LIGM-DB and IMGT Web resources

    Creation of the domestic cat (Felis catus) IGK reference directory (IMGT/GENE-DB data updates).
    Addition in IMGT/GENE-DB of:
    18 domestic cat (Felis catus) IGKV genes corresponding to 18 allelic sequences.
    5 domestic cat (Felis catus) IGKJ genes corresponding to 5 allelic sequences.
    1 domestic cat (Felis catus) IGKC genes corresponding to 1 allelic sequences.

    Addition of IGK annotation of IMGT locus reference sequence IMGT000050 in IMGT/LIGM-DB.

    Creation of 17 web pages in IMGT Repertoire (IG and TR):
    Gene table: domestic cat (Felis catus) IGKV.
    Gene table: domestic cat (Felis catus) IGKJ.
    Gene table: domestic cat (Felis catus) IGKC.
    Alignment of alleles: domestic cat (Felis catus) IGKV.
    Alignment of alleles: domestic cat (Felis catus) IGKJ.
    Alignment of alleles: domestic cat (Felis catus) IGKC.
    Protein displays: domestic cat (Felis catus) IGKV.
    Protein displays: domestic cat (Felis catus) IGKJ.
    Protein displays: domestic cat (Felis catus) IGKC.
    Colliers de Perles: domestic cat (Felis catus) IGKV.
    Colliers de Perles: domestic cat (Felis catus) IGKC.
    Locus representation: domestic cat (Felis catus) IGK.
    Locus gene order: domestic cat (Felis catus) IGK.
    Locus in genome assembly: domestic cat (Felis catus) IGK.
    Locus description: domestic cat (Felis catus) IGK.
    Potential germline repertoire: domestic cat (Felis catus) IGKV and IGKJ genes on chromosome 11.
    Domestic cat (Felis catus) [CDR1-IMGT.CDR2-IMGT.CDR3-IMGT] lengths per IGKV subgroup.

    1 August 2019 - UPDATE 2019: Human (Homo sapiens) IGHV in IMGT/GENE-DB, IMGT/LIGM-DB and IMGT Web resources

    Update of the human (Homo sapiens) IGH reference directory (IMGT/GENE-DB data updates).
    Addition in IMGT/GENE-DB of:
    15 IGHV genes corresponding to 15 allelic sequences : IGHV1-3*03 F, IGHV3-20*04 F, IGHV3-64*07 F, IGHV4-61*09 F, IGHV4-59*11 F, IGHV2-70*18 F, IGHV2-70*19 F, IGHV1-46*04 F, IGHV(II)-62-1*03 P, IGHV3-62*04 F, IGHV(II)-60-1*02 P, IGHV3-60*03 P, IGHV3-57*03 P, IGHV3-71*04 P, IGHV1-68*02 P.

    Addition of IMGT reference sequence annotation of IGHV1-3*03 (MK540645), IGHV3-20*04 (MK540646), IGHV3-64*07, IGHV(II)-62-1*03, IGHV3-62*04, IGHV4-61*09, IGHV(II)-60-1*02, IGHV3-60*03, IGHV4-59*11, IGHV3-57*03 (MK540647), IGHV3-71*04, IGHV2-70*18, IGHV1-68*02 (MK540648), IGHV2-70*19 (MK540649), IGHV1-46*04 (MK540650) in IMGT/LIGM-DB.

    Update of 3 web pages in IMGT Repertoire (IG and TR):
    Gene table: human (Homo spaiens) IGHV.
    Alignment of alleles: human (Homo spaiens) IGHV.
    Locus representation: Human (Homo sapiens) IGH.

    12 July 2019 - CREATION 2019: Goat (Capra hircus) IGL in IMGT/GENE-DB, IMGT/LIGM-DB and IMGT Web resources

    Creation of the goat (Capra hircus) IGL reference directory (IMGT/GENE-DB data updates).
    Addition in IMGT/GENE-DB of:
    73 goat (Capra hircus) IGLV genes corresponding to 73 allelic sequences.
    2 goat (Capra hircus) IGLJ genes corresponding to 2 allelic sequences.
    2 goat (Capra hircus) IGLC genes corresponding to 2 allelic sequences.
    1 goat (Capra hircus) VPREB3 gene corresponding to 1 allelic sequence.

    Addition of goat (Capra hircus) IGL locus annotation of IMGT locus reference sequence IMGT000033 in IMGT/LIGM-DB.

    Creation of 20 web pages in IMGT Repertoire (IG and TR):
    Gene table: goat (Capra hircus) IGLV.
    Gene table: goat (Capra hircus) IGLJ.
    Gene table: goat (Capra hircus) IGLC.
    Gene and allele table: goat (Capra hircus) VPREB in IMGT Repertoire (RPI)
    Alignment of alleles: goat (Capra hircus) IGLV.
    Alignment of alleles: goat (Capra hircus) IGLJ.
    Alignment of alleles: goat (Capra hircus) IGLC.
    Alignment of alleles: goat (Capra hircus) VPREB3 in IMGT Repertoire (RPI)
    Protein displays: goat (Capra hircus) IGLV.
    Protein displays: goat (Capra hircus) IGLJ.
    Protein displays: goat (Capra hircus) IGLC.
    Protein displays: goat (Capra hircus) VPREB3 in IMGT Repertoire (RPI)
    Colliers de Perles: goat (Capra hircus) IGLV.
    Colliers de Perles: goat (Capra hircus) IGLC.
    Locus representation: goat (Capra hircus) IGL.
    Potential germline repertoire: goat (Capra hircus) IGLV and IGLJ genes on chromosome 11.
    Locus description: goat (Capra hircus) IGL.
    Locus gene order: goat (Capra hircus) IGL.
    Locus in genome assembly: goat (Capra hircus) IGL.
    [CDR1-IMGT.CDR2-IMGT.CDR3-IMGT] lengths: goat (Capra hircus) IGLV.

    12 July 2019 - CREATION 2019: Domestic cat (Felis catus) TRA/TRD in IMGT/GENE-DB, IMGT/LIGM-DB and IMGT Web resources

    Creation of the domestic cat (Felis catus) TRA/TRD reference directory (IMGT/GENE-DB data updates).
    Addition in IMGT/GENE-DB of:
    62 domestic cat (Felis catus) TRAV genes corresponding to 62 allelic sequences.
    64 domestic cat (Felis catus) TRAJ genes corresponding to 64 allelic sequences.
    1 domestic cat (Felis catus) TRAC gene corresponding to 1 allelic sequence.
    11 domestic cat (Felis catus) TRDV genes corresponding to 11 allelic sequences.
    2 domestic cat (Felis catus) TRDD genes corresponding to 2 allelic sequences.
    5 domestic cat (Felis catus) TRDJ genes corresponding to 5 allelic sequences.
    1 domestic cat (Felis catus) TRDC gene corresponding to 1 allelic sequence.

    Addition of TRA/TRD locus annotation of IMGT locus reference sequence IMGT000045 in IMGT/LIGM-DB.

    Creation of 33 web pages in IMGT Repertoire (IG and TR):
    Gene table: domestic cat (Felis catus) TRAV.
    Gene table: domestic cat (Felis catus) TRAJ.
    Gene table: domestic cat (Felis catus) TRAC.
    Gene table: domestic cat (Felis catus) TRDV.
    Gene table: domestic cat (Felis catus) TRDD.
    Gene table: domestic cat (Felis catus) TRDJ.
    Gene table: domestic cat (Felis catus) TRDC.
    Alignment of alleles: domestic cat (Felis catus) TRAV.
    Alignment of alleles: domestic cat (Felis catus) TRAJ.
    Alignment of alleles: domestic cat (Felis catus) TRAC.
    Alignment of alleles: domestic cat (Felis catus) TRDV.
    Alignment of alleles: domestic cat (Felis catus) TRDD.
    Alignment of alleles: domestic cat (Felis catus) TRDJ.
    Alignment of alleles: domestic cat (Felis catus) TRDC.
    Protein displays: domestic cat (Felis catus) TRAV.
    Protein displays: domestic cat (Felis catus) TRAJ.
    Protein displays: domestic cat (Felis catus) TRAC.
    Protein displays: domestic cat (Felis catus) TRDV.
    Protein displays: domestic cat (Felis catus) TRDJ.
    Protein displays: domestic cat (Felis catus) TRDC.
    Colliers de Perles: domestic cat (Felis catus) TRAV.
    Colliers de Perles: domestic cat (Felis catus) TRAC.
    Colliers de Perles: domestic cat (Felis catus) TRDV.
    Colliers de Perles: domestic cat (Felis catus) TRDC.
    Locus representation: domestic cat (Felis catus) TRA/TRD.
    Locus gene order: domestic cat (Felis catus) TRA/TRD.
    Locus in genome assembly: domestic cat (Felis catus) TRA/TRD.
    Locus description: domestic cat (Felis catus) TRA.
    Locus description: domestic cat (Felis catus) TRD.
    Potential germline repertoire: domestic cat (Felis catus) TRAV and TRAJ genes on chromosome B3.
    Potential germline repertoire: domestic cat (Felis catus) TRDV, TRDD and TRDJ genes on chromosome B3.
    [CDR1-IMGT.CDR2-IMGT.CDR3-IMGT] lengths: domestic cat (Felis catus) TRAV.
    [CDR1-IMGT.CDR2-IMGT.CDR3-IMGT] lengths: domestic cat (Felis catus) TRDV.

    2 July 2019 - CREATION 2019: Bovine (Bos taurus) IGK in IMGT/GENE-DB, IMGT/LIGM-DB and IMGT Web resources

    Creation of the bovine (Bos taurus) IGK reference directory (IMGT/GENE-DB data updates).
    Addition in IMGT/GENE-DB of:
    25 bovine (Bos taurus) IGKV genes corresponding to 25 allelic sequences.
    5 bovine (Bos taurus) IGKJ genes corresponding to 5 allelic sequences.
    1 bovine (Bos taurus) IGKC genes corresponding to 1 allelic sequences.

    Addition of IGK annotation of IMGT locus reference sequence IMGT000047 in IMGT/LIGM-DB.

    Creation of 17 web pages in IMGT Repertoire (IG and TR):
    Gene table: bovine (Bos taurus) IGKV.
    Gene table: bovine (Bos taurus) IGKJ.
    Gene table: bovine (Bos taurus) IGKC.
    Alignment of alleles: bovine (Bos taurus) IGKV.
    Alignment of alleles: bovine (Bos taurus) IGKJ.
    Alignment of alleles: bovine (Bos taurus) IGKC.
    Protein displays: bovine (Bos taurus) IGKV.
    Protein displays: bovine (Bos taurus) IGKJ.
    Protein displays: bovine (Bos taurus) IGKC.
    Colliers de Perles: bovine (Bos taurus) IGKV.
    Colliers de Perles: bovine (Bos taurus) IGKC.
    Locus representation: bovine (Bos taurus) IGK.
    Locus gene order: bovine (Bos taurus) IGK.
    Locus in genome assembly: bovine (Bos taurus) IGK.
    Locus description: bovine (Bos taurus) IGK.
    Potential germline repertoire: bovine (Bos taurus) IGKV and IGKJ genes on chromosome 11.
    Bovine (Bos taurus) [CDR1-IMGT.CDR2-IMGT.CDR3-IMGT] lengths per IGKV subgroup.

    2 July 2019 - CREATION 2019: Bovine (Bos taurus) IGL in IMGT/GENE-DB, IMGT/LIGM-DB and IMGT Web resources

    Creation of the bovine (Bos taurus) IGL reference directory (IMGT/GENE-DB data updates).
    Addition in IMGT/GENE-DB of:
    74 bovine (Bos taurus) IGLV genes corresponding to 93 allelic sequences.
    8 bovine (Bos taurus) IGLJ genes corresponding to 8 allelic sequences.
    9 bovine (Bos taurus) IGLC genes corresponding to 9 allelic sequences.

    Addition of IGL annotation of IMGT locus reference sequence IMGT000046 in IMGT/LIGM-DB.

    Creation of 17 web pages in IMGT Repertoire (IG and TR):
    Gene table: bovine (Bos taurus) IGLV.
    Gene table: bovine (Bos taurus) IGLJ.
    Gene table: bovine (Bos taurus) IGLC.
    Alignment of alleles: bovine (Bos taurus) IGLV.
    Alignment of alleles: bovine (Bos taurus) IGLJ.
    Alignment of alleles: bovine (Bos taurus) IGLC.
    Protein displays: bovine (Bos taurus) IGLV.
    Protein displays: bovine (Bos taurus) IGLJ.
    Protein displays: bovine (Bos taurus) IGLC.
    Colliers de Perles: bovine (Bos taurus) IGLV.
    Colliers de Perles: bovine (Bos taurus) IGLC.
    Locus representation: bovine (Bos taurus) IGL.
    Locus gene order: bovine (Bos taurus) IGL.
    Locus in genome assembly: bovine (Bos taurus) IGL.
    Locus description: bovine (Bos taurus) IGL.
    Potential germline repertoire: bovine (Bos taurus) IGLV and IGLJ genes on chromosome 17.
    Bovine (Bos taurus) [CDR1-IMGT.CDR2-IMGT.CDR3-IMGT] lengths per IGLV subgroup.

    29 April 2019 - CREATION 2019: Atlantic salmon (Salmo salar) IGH in IMGT/GENE-DB, IMGT/LIGM-DB and IMGT Web resources

    Creation of the Atlantic salmon (Salmo salar) IGH reference directory (IMGT/GENE-DB data updates).
    Addition in IMGT/GENE-DB of:
    303 Atlantic salmon (Salmo salar) IGHV genes corresponding to 320 allelic sequences.
    28 Atlantic salmon (Salmo salar) IGHD genes corresponding to 28 allelic sequences.
    21 Atlantic salmon (Salmo salar) IGHJ genes corresponding to 23 allelic sequences.
    12 Atlantic salmon (Salmo salar) IGHC genes corresponding to 18 allelic sequences.

    Addition of IGH annotation of IMGT locus reference sequence GU129139, GU129140, IMGT000028 and IMGT000029 in IMGT/LIGM-DB.

    Creation of 19 web pages in IMGT Repertoire (IG and TR):
    Gene table: Atlantic salmon (Salmo salar) IGHV.
    Gene table: Atlantic salmon (Salmo salar) IGHD.
    Gene table: Atlantic salmon (Salmo salar) IGHJ.
    Gene table: Atlantic salmon (Salmo salar) IGHC.
    Alignment of alleles: Atlantic salmon (Salmo salar) IGHV.
    Alignment of alleles: Atlantic salmon (Salmo salar) IGHD.
    Alignment of alleles: Atlantic salmon (Salmo salar) IGHJ.
    Alignment of alleles: Atlantic salmon (Salmo salar) IGHC.
    Protein displays: Atlantic salmon (Salmo salar) IGHV.
    Protein displays: Atlantic salmon (Salmo salar) IGHJ.
    Protein displays: Atlantic salmon (Salmo salar) IGHC.
    Colliers de Perles: Atlantic salmon (Salmo salar) IGHV.
    Colliers de Perles: Atlantic salmon (Salmo salar) IGHC.
    Locus representation: Atlantic salmon (Salmo salar) IGH.
    Locus gene order: Atlantic salmon (Salmo salar) IGH.
    Locus in genome assembly: Atlantic salmon (Salmo salar) IGH.
    Locus description: Atlantic salmon (Salmo salar) IGH.
    Potential germline repertoire: Atlantic salmon (Salmo salar) IGHV, IGHD and IGHJ genes.
    Atlantic salmon (Salmo salar) [CDR1-IMGT.CDR2-IMGT.CDR3-IMGT] lengths per IGHV subgroup.

    18 April 2019 - UPDATE 2019: Human (Homo sapiens) IGHV in IMGT/GENE-DB, IMGT/LIGM-DB and IMGT Web resources

    Update of the human (Homo sapiens) IGH reference directory (IMGT/GENE-DB data updates).
    Addition in IMGT/GENE-DB of:
    6 IGHV genes corresponding to 6 allelic sequences : IGHV1-3*04, IGHV1-58*03, IGHV4-30-4*08, IGHV4-31*11, IGHV4-59*12, IGHV5-51*06.

    Addition of IMGT reference sequence annotation of IGHV1-3*04 (MH779622), IGHV1-58*03 (MK321684), IGHV4-30-4*08 (MH779624), IGHV4-31*11 (MK321691), IGHV4-59*12 (MK321692), IGHV5-51*06 (MK321694) in IMGT/LIGM-DB.

    Update of 2 web pages in IMGT Repertoire (IG and TR):
    Gene table: human (Homo spaiens) IGHV.
    Alignment of alleles: human (Homo spaiens) IGHV.

    12 April 2019 - CREATION 2019: Sheep (Ovis aries) TRB in IMGT/GENE-DB, IMGT/LIGM-DB and IMGT Web resources

    Creation of the sheep (Ovis aries) TRB reference directory (IMGT/GENE-DB data updates).
    Addition in IMGT/GENE-DB of:
    94 sheep (Ovis aries) TRBV genes corresponding to 94 allelic sequences.
    3 sheep (Ovis aries) TRBD genes corresponding to 5 allelic sequences.
    19 sheep (Ovis aries) TRBJ genes corresponding to 23 allelic sequences.
    3 sheep (Ovis aries) TRBC genes corresponding to 6 allelic sequences.

    Addition of TRB annotation of IMGT locus reference sequence IMGT000042 in IMGT/LIGM-DB.

    Creation of 19 web pages in IMGT Repertoire (IG and TR):
    Gene table: sheep (Ovis aries) TRBV.
    Gene table: sheep (Ovis aries) TRBD.
    Gene table: sheep (Ovis aries) TRBJ.
    Gene table: sheep (Ovis aries) TRBC.
    Alignment of alleles: sheep (Ovis aries) TRBV.
    Alignment of alleles: sheep (Ovis aries) TRBD.
    Alignment of alleles: sheep (Ovis aries) TRBJ.
    Alignment of alleles: sheep (Ovis aries) TRBC.
    Protein displays: sheep (Ovis aries) TRBV.
    Protein displays: sheep (Ovis aries) TRBJ.
    Protein displays: sheep (Ovis aries) TRBC.
    Colliers de Perles: sheep (Ovis aries) TRBV.
    Colliers de Perles: sheep (Ovis aries) TRBC.
    Locus representation: sheep (Ovis aries) TRB.
    Locus gene order: sheep (Ovis aries) TRB.
    Locus in genome assembly: sheep (Ovis aries) TRB.
    Locus description: sheep (Ovis aries) TRB.
    Potential germline repertoire: sheep (Ovis aries) TRBV, TRBD and TRBJ genes on chromosome 4.
    Sheep (Ovis aries) [CDR1-IMGT.CDR2-IMGT.CDR3-IMGT] lengths per TRBV subgroup.

    10 April 2019 - UPDATE: Human (Homo sapiens) IGHV in IMGT/LIGM-DB, IMGT/GENE-DB and IMGT Web resources

    Update of IMGT gene name in IMGT/LIGM-DB, IMGT/GENE-DB and IMGT Web resources of 1 IGHV gene :
    The IMGT reference sequence AB019438 previously designated as IGHV3-51-5*01 (previously IGHV(III)-51-1*01), have been now assigned to the IMGT allele of IGHV8-51-1*01 which is pseudogene.
    The IMGT reference sequence BK063799 previously designated as IGHV3-51-1*02 (previously IGHV(III)-51-1*02), have been now assigned to the IMGT allele of IGHV8-51-1*02 which is ORF.

    27 March 2019 - UPDATE 2019: Human (Homo sapiens) IGH in IMGT/GENE-DB, IMGT/LIGM-DB and IMGT Web resources

    Update of the human (Homo sapiens) IGH reference directory (IMGT/GENE-DB data updates).
    Addition in IMGT/GENE-DB of:
    18 human (Homo sapiens) IGHV gene corresponding to 18 allelic sequences.
    2 human (Homo sapiens) IGHJ gene corresponding to 2 allelic sequences.
    2 human (Homo sapiens) IGHC genes corresponding to 2 allelic sequences.

    Addition of IGH annotation of IMGT locus reference sequence BK063799 in IMGT/LIGM-DB.

    Creation of 1 web page in IMGT Repertoire (IG and TR):
    Locus in genome assembly: human (Homo sapiens) IGH.

    Update of 13 web pages in IMGT Repertoire (IG and TR):
    Gene table: human (Homo sapiens) IGHV.
    Gene table: human (Homo sapiens) IGHJ.
    Gene table: human (Homo sapiens) IGHC.
    Alignment of alleles: human (Homo sapiens) IGHV.
    Alignment of alleles: human (Homo sapiens) IGHJ.
    Alignment of alleles: human (Homo sapiens) IGHC.
    Protein displays: human (Homo sapiens) IGHV.
    Protein displays: human (Homo sapiens) IGHJ.
    Protein displays: human (Homo sapiens) IGHC.
    Colliers de Perles: human (Homo sapiens) IGHV.
    Colliers de Perles: human (Homo sapiens) IGHC.
    Locus representation: human (Homo sapiens) IGH.
    Locus gene order: human (Homo sapiens) IGH.

    20 March 2019 - CREATION 2019: Domestic cat (Felis catus) TRG in IMGT/GENE-DB, IMGT/LIGM-DB and IMGT Web resources

    Creation of the domestic cat (Felis catus) TRG reference directory (IMGT/GENE-DB data updates).
    Addition in IMGT/GENE-DB of:
    12 domestic cat (Felis catus) TRGV genes corresponding to 12 allelic sequences.
    12 domestic cat (Felis catus) TRGJ genes corresponding to 12 allelic sequences.
    6 domestic cat (Felis catus) TRGC genes corresponding to 6 allelic sequences.

    Addition of TRG annotation of IMGT locus reference sequence IMGT000036 in IMGT/LIGM-DB.

    Creation of 17 web pages in IMGT Repertoire (IG and TR):
    Gene table: domestic cat (Felis catus) TRGV.
    Gene table: domestic cat (Felis catus) TRGJ.
    Gene table: domestic cat (Felis catus) TRGC.
    Alignment of alleles: domestic cat (Felis catus) TRGV.
    Alignment of alleles: domestic cat (Felis catus) TRGJ.
    Alignment of alleles: domestic cat (Felis catus) TRGC.
    Protein displays: domestic cat (Felis catus) TRGV.
    Protein displays: domestic cat (Felis catus) TRGJ.
    Protein displays: domestic cat (Felis catus) TRGC.
    Colliers de Perles: domestic cat (Felis catus) TRGV.
    Colliers de Perles: domestic cat (Felis catus) TRGC.
    Locus representation: domestic cat (Felis catus) TRG.
    Locus gene order: domestic cat (Felis catus) TRG.
    Locus in genome assembly: domestic cat (Felis catus) TRG.
    Locus description: domestic cat (Felis catus) TRG.
    Potential germline repertoire: domestic cat (Felis catus) TRGV and TRGJ genes on chromosome A2.
    Domestic cat (Felis catus) [CDR1-IMGT.CDR2-IMGT.CDR3-IMGT] lengths per TRGV subgroup.

    15 March 2019 - CREATION 2019: Domestic cat (Felis catus) TRB in IMGT/GENE-DB, IMGT/LIGM-DB and IMGT Web resources

    Creation of the domestic cat (Felis catus) TRB reference directory (IMGT/GENE-DB data updates).
    Addition in IMGT/GENE-DB of:
    33 domestic cat (Felis catus) TRBV genes corresponding to 33 allelic sequences.
    2 domestic cat (Felis catus) TRBD genes corresponding to 2 allelic sequences.
    11 domestic cat (Felis catus) TRBJ genes corresponding to 11 allelic sequences.
    2 domestic cat (Felis catus) TRBC genes corresponding to 2 allelic sequences.

    Addition of TRB annotation of IMGT locus reference sequence IMGT000037 in IMGT/LIGM-DB.

    Creation of 19 web pages in IMGT Repertoire (IG and TR):
    Gene table: domestic cat (Felis catus) TRBV.
    Gene table: domestic cat (Felis catus) TRBD.
    Gene table: domestic cat (Felis catus) TRBJ.
    Gene table: domestic cat (Felis catus) TRBC.
    Alignment of alleles: domestic cat (Felis catus) TRBV.
    Alignment of alleles: domestic cat (Felis catus) TRBD.
    Alignment of alleles: domestic cat (Felis catus) TRBJ.
    Alignment of alleles: domestic cat (Felis catus) TRBC.
    Protein displays: domestic cat (Felis catus) TRBV.
    Protein displays: domestic cat (Felis catus) TRBJ.
    Protein displays: domestic cat (Felis catus) TRBC.
    Colliers de Perles: domestic cat (Felis catus) TRBV.
    Colliers de Perles: domestic cat (Felis catus) TRBC.
    Locus representation: domestic cat (Felis catus) TRB.
    Locus gene order: domestic cat (Felis catus) TRB.
    Locus in genome assembly: domestic cat (Felis catus) TRB.
    Locus description: domestic cat (Felis catus) TRB.
    Potential germline repertoire: domestic cat (Felis catus) TRBV, TRBD and TRBJ genes on chromosome A2.
    Domestic cat (Felis catus) [CDR1-IMGT.CDR2-IMGT.CDR3-IMGT] lengths per TRBV subgroup.

    06 March 2019 - CREATION 2019: Domestic cat (Felis catus) IGL in IMGT/GENE-DB, IMGT/LIGM-DB and IMGT Web resources

    Creation of the domestic cat (Felis catus) IGL reference directory (IMGT/GENE-DB data updates).
    Addition in IMGT/GENE-DB of:
    94 domestic cat (Felis catus) IGLV genes corresponding to 94 allelic sequences.
    12 domestic cat (Felis catus) IGLJ genes corresponding to 12 allelic sequences.
    12 domestic cat (Felis catus) IGLC genes corresponding to 12 allelic sequences.

    Addition of IGL annotation of IMGT locus reference sequence IMGT000038 in IMGT/LIGM-DB.

    Creation of 17 web pages in IMGT Repertoire (IG and TR):
    Gene table: domestic cat (Felis catus) IGLV.
    Gene table: domestic cat (Felis catus) IGLJ.
    Gene table: domestic cat (Felis catus) IGLC.
    Alignment of alleles: domestic cat (Felis catus) IGLV.
    Alignment of alleles: domestic cat (Felis catus) IGLJ.
    Alignment of alleles: domestic cat (Felis catus) IGLC.
    Protein displays: domestic cat (Felis catus) IGLV.
    Protein displays: domestic cat (Felis catus) IGLJ.
    Protein displays: domestic cat (Felis catus) IGLC.
    Colliers de Perles: domestic cat (Felis catus) IGLV.
    Colliers de Perles: domestic cat (Felis catus) IGLC.
    Locus representation: domestic cat (Felis catus) IGL.
    Locus gene order: domestic cat (Felis catus) IGL.
    Locus in genome assembly: domestic cat (Felis catus) IGL.
    Locus description: domestic cat (Felis catus) IGL.
    Potential germline repertoire: domestic cat (Felis catus) IGLV and IGLJ genes on chromosome D3.
    Domestic cat (Felis catus) [CDR1-IMGT.CDR2-IMGT.CDR3-IMGT] lengths per IGLV subgroup.

    20 February 2019 - CREATION 2019: Pig (Sus scrofa) TRB in IMGT/GENE-DB, IMGT/LIGM-DB and IMGT Web resources

    Creation of the pig (Sus scrofa) TRB reference directory (IMGT/GENE-DB data updates).
    Addition in IMGT/GENE-DB of:
    38 pig (Sus scrofa) TRBV genes corresponding to 38 allelic sequences.
    3 pig (Sus scrofa) TRBD genes corresponding to 3 allelic sequences.
    20 pig (Sus scrofa) TRBJ genes corresponding to 20 allelic sequences.
    3 pig (Sus scrofa) TRBC genes corresponding to 3 allelic sequences.

    Addition of TRB annotation of IMGT locus reference sequence IMGT000039 in IMGT/LIGM-DB.

    Creation of 19 web pages in IMGT Repertoire (IG and TR):
    Gene table: pig (Sus scrofa) TRBV.
    Gene table: pig (Sus scrofa) TRBD.
    Gene table: pig (Sus scrofa) TRBJ.
    Gene table: pig (Sus scrofa) TRBC.
    Alignment of alleles: pig (Sus scrofa) TRBV.
    Alignment of alleles: pig (Sus scrofa) TRBD.
    Alignment of alleles: pig (Sus scrofa) TRBJ.
    Alignment of alleles: pig (Sus scrofa) TRBC.
    Protein displays: pig (Sus scrofa) TRBV.
    Protein displays: pig (Sus scrofa) TRBJ.
    Protein displays: pig (Sus scrofa) TRBC.
    Colliers de Perles: pig (Sus scrofa) TRBV.
    Colliers de Perles: pig (Sus scrofa) TRBC.
    Locus representation: pig (Sus scrofa) TRB.
    Locus gene order: pig (Sus scrofa) TRB.
    Locus in genome assembly: pig (Sus scrofa) TRB.
    Locus description: pig (Sus scrofa) TRB.
    Potential germline repertoire: pig (Sus scrofa) TRBV, TRBD and TRBJ genes.
    Pig (Sus scrofa) [CDR1-IMGT.CDR2-IMGT.CDR3-IMGT] lengths per TRBV subgroup.

    24 January 2019 - CREATION 2019: Rabbit (Oryctolagus cuniculus) TRB in IMGT/GENE-DB, IMGT/LIGM-DB and IMGT Web resources

    Creation of the bovine (Bos taurus) IGH reference directory (IMGT/GENE-DB data updates).
    Addition in IMGT/GENE-DB of:
    77 rabbit (Oryctolagus cuniculus) TRBV genes corresponding to 80 allelic sequences.
    2 rabbit (Oryctolagus cuniculus) TRBD genes corresponding to 2 allelic sequences.
    12 rabbit (Oryctolagus cuniculus) TRBJ genes corresponding to 13 allelic sequences.
    2 rabbit (Oryctolagus cuniculus) TRBC genes corresponding to 5 allelic sequences.

    Addition of TRB annotation of IMGT locus reference sequence IMGT000032 in IMGT/LIGM-DB.

    Creation of 19 web pages in IMGT Repertoire (IG and TR):
    Gene table: rabbit (Oryctolagus cuniculus) TRBV.
    Gene table: rabbit (Oryctolagus cuniculus) TRBD.
    Gene table: rabbit (Oryctolagus cuniculus) TRBJ.
    Gene table: rabbit (Oryctolagus cuniculus) TRBC.
    Alignment of alleles: rabbit (Oryctolagus cuniculus) TRBV.
    Alignment of alleles: rabbit (Oryctolagus cuniculus) TRBD.
    Alignment of alleles: rabbit (Oryctolagus cuniculus) TRBJ.
    Alignment of alleles: rabbit (Oryctolagus cuniculus) TRBC.
    Protein displays: rabbit (Oryctolagus cuniculus) TRBV.
    Protein displays: rabbit (Oryctolagus cuniculus) TRBJ.
    Protein displays: rabbit (Oryctolagus cuniculus) TRBC.
    Colliers de Perles: rabbit (Oryctolagus cuniculus) TRBV.
    Colliers de Perles: rabbit (Oryctolagus cuniculus) TRBC.
    Locus representation: rabbit (Oryctolagus cuniculus) TRB.
    Locus gene order: rabbit (Oryctolagus cuniculus) TRB.
    Locus in genome assembly: rabbit (Oryctolagus cuniculus) TRB.
    Locus description: rabbit (Oryctolagus cuniculus) TRB.
    Potential germline repertoire: rabbit (Oryctolagus cuniculus) TRBV, TRBD and TRBJ genes.
    Rabbit (Oryctolagus cuniculus) [CDR1-IMGT.CDR2-IMGT.CDR3-IMGT] lengths per TRBV subgroup.

    2018

    21 December 2018 - UPDATE 2018: Human (Homo sapiens) TRB in IMGT/GENE-DB, IMGT/LIGM-DB and IMGT Web resources

    Update of the human (Homo sapiens) TRB reference directory (IMGT/GENE-DB data updates).
    Addition in IMGT/GENE-DB of:
    62 human (Homo sapiens) TRBV genes corresponding to 62 allelic sequence.
    2 human (Homo sapiens) TRBD genes corresponding to 2 allelic sequences.
    14 human (Homo sapiens) TRBJ genes corresponding to 14 allelic sequence.
    2 human (Homo sapiens) TRBC genes corresponding to 2 allelic sequences.

    Addition of TRB annotation of IMGT locus reference sequence IMGT000021 in IMGT/LIGM-DB.

    Creation of 1 web page in IMGT Repertoire (IG and TR):
    Locus in genome assembly: human (Homo sapiens) TRB.

    Update of 15 web pages in IMGT Repertoire (IG and TR):
    Gene table: human (Homo sapiens) TRBV.
    Gene table: human (Homo sapiens) TRBD.
    Gene table: human (Homo sapiens) TRBJ.
    Gene table: human (Homo sapiens) TRBC.
    Alignment of alleles: human (Homo sapiens) TRBV.
    Alignment of alleles: human (Homo sapiens) TRBD.
    Alignment of alleles: human (Homo sapiens) TRBJ.
    Alignment of alleles: human (Homo sapiens) TRBC.
    Protein displays: human (Homo sapiens) TRBV.
    Protein displays: human (Homo sapiens) TRBJ.
    Protein displays: human (Homo sapiens) TRBC.
    Colliers de Perles: human (Homo sapiens) TRBV.
    Colliers de Perles: human (Homo sapiens) TRBC.
    Locus representation: human (Homo sapiens) TRB.
    Locus gene order: human (Homo sapiens) TRB.

    11 December 2018 - CREATION 2018: Dog (Canis lupus familiaris) IGL in IMGT/GENE-DB, IMGT/LIGM-DB and IMGT Web resources

    Creation of the dog (Canis lupus familiaris) IGL reference directory (IMGT/GENE-DB data updates).
    Addition in IMGT/GENE-DB of:
    261 dog (Canis lupus familiaris) IGLV genes corresponding to 261 allelic sequences.
    9 dog (Canis lupus familiaris) IGLJ genes corresponding to 9 allelic sequences.
    9 dog (Canis lupus familiaris) IGLC genes corresponding to 9 allelic sequences.

    Addition of IGL annotation of IMGT locus reference sequence IMGT000003 in IMGT/LIGM-DB.

    Creation of 17 web pages in IMGT Repertoire (IG and TR):
    Gene table: dog (Canis lupus familiaris) IGLV.
    Gene table: dog (Canis lupus familiaris) IGLJ.
    Gene table: dog (Canis lupus familiaris) IGLC.
    Alignment of alleles: dog (Canis lupus familiaris) IGLV.
    Alignment of alleles: dog (Canis lupus familiaris) IGLJ.
    Alignment of alleles: dog (Canis lupus familiaris) IGLC.
    Protein displays: dog (Canis lupus familiaris) IGLV.
    Protein displays: dog (Canis lupus familiaris) IGLJ.
    Protein displays: dog (Canis lupus familiaris) IGLC.
    Colliers de Perles: dog (Canis lupus familiaris) IGLV.
    Colliers de Perles: dog (Canis lupus familiaris) IGLC.
    Locus representation: dog (Canis lupus familiaris) IGL.
    Locus gene order: dog (Canis lupus familiaris) IGL.
    Locus in genome assembly: dog (Canis lupus familiaris) IGL.
    Locus description: dog (Canis lupus familiaris) IGL.
    Potential germline repertoire: dog (Canis lupus familiaris) IGLV and IGLJ genes on chromosome 26.
    [CDR1-IMGT.CDR2-IMGT.CDR3-IMGT] lengths: dog (Canis lupus familiaris) IGLV.

    22 November 2018 - CREATION 2018: Rabbit (Oryctolagus cuniculus) TRA/TRD in IMGT/GENE-DB, IMGT/LIGM-DB and IMGT Web resources

    Creation of the rabbit (Oryctolagus cuniculus) TRA/TRD reference directory (IMGT/GENE-DB data updates).
    Addition in IMGT/GENE-DB of:
    61 rabbit (Oryctolagus cuniculus) TRAV genes corresponding to 61 allelic sequences.
    58 rabbit (Oryctolagus cuniculus) TRAJ genes corresponding to 58 allelic sequences.
    1 rabbit (Oryctolagus cuniculus) TRAC gene corresponding to 1 allelic sequence.
    4 rabbit (Oryctolagus cuniculus) TRDV genes corresponding to 4 allelic sequences.
    2 rabbit (Oryctolagus cuniculus) TRDD genes corresponding to 2 allelic sequences.
    3 rabbit (Oryctolagus cuniculus) TRDJ genes corresponding to 3 allelic sequences.
    1 rabbit (Oryctolagus cuniculus) TRDC gene corresponding to 1 allelic sequence.

    Addition of TRA/TRD locus annotation of IMGT locus reference sequence IMGT000031 in IMGT/LIGM-DB.

    Creation of 33 web pages in IMGT Repertoire (IG and TR):
    Gene table: rabbit (Oryctolagus cuniculus) TRAV.
    Gene table: rabbit (Oryctolagus cuniculus) TRAJ.
    Gene table: rabbit (Oryctolagus cuniculus) TRAC.
    Gene table: rabbit (Oryctolagus cuniculus) TRDV.
    Gene table: rabbit (Oryctolagus cuniculus) TRDD.
    Gene table: rabbit (Oryctolagus cuniculus) TRDJ.
    Gene table: rabbit (Oryctolagus cuniculus) TRDC.
    Alignment of alleles: rabbit (Oryctolagus cuniculus) TRAV.
    Alignment of alleles: rabbit (Oryctolagus cuniculus) TRAJ.
    Alignment of alleles: rabbit (Oryctolagus cuniculus) TRAC.
    Alignment of alleles: rabbit (Oryctolagus cuniculus) TRDV.
    Alignment of alleles: rabbit (Oryctolagus cuniculus) TRDD.
    Alignment of alleles: rabbit (Oryctolagus cuniculus) TRDJ.
    Alignment of alleles: rabbit (Oryctolagus cuniculus) TRDC.
    Protein displays: rabbit (Oryctolagus cuniculus) TRAV.
    Protein displays: rabbit (Oryctolagus cuniculus) TRAJ.
    Protein displays: rabbit (Oryctolagus cuniculus) TRAC.
    Protein displays: rabbit (Oryctolagus cuniculus) TRDV.
    Protein displays: rabbit (Oryctolagus cuniculus) TRDJ.
    Protein displays: rabbit (Oryctolagus cuniculus) TRDC.
    Colliers de Perles: rabbit (Oryctolagus cuniculus) TRAV.
    Colliers de Perles: rabbit (Oryctolagus cuniculus) TRAC.
    Colliers de Perles: rabbit (Oryctolagus cuniculus) TRDV.
    Colliers de Perles: rabbit (Oryctolagus cuniculus) TRDC.
    Locus representation: rabbit (Oryctolagus cuniculus) TRA/TRD.
    Locus gene order: rabbit (Oryctolagus cuniculus) TRA/TRD.
    Locus in genome assembly: rabbit (Oryctolagus cuniculus) TRA/TRD.
    Locus description: rabbit (Oryctolagus cuniculus) TRA.
    Locus description: rabbit (Oryctolagus cuniculus) TRD.
    Potential germline repertoire: rabbit (Oryctolagus cuniculus) TRAV and TRAJ genes on chromosome 17.
    Potential germline repertoire: rabbit (Oryctolagus cuniculus) TRDV, TRDD and TRDJ genes on chromosome 17.
    [CDR1-IMGT.CDR2-IMGT.CDR3-IMGT] lengths: rabbit (Oryctolagus cuniculus) TRAV.
    [CDR1-IMGT.CDR2-IMGT.CDR3-IMGT] lengths: rabbit (Oryctolagus cuniculus) TRDV.

    22 November 2018 - CREATION 2018: Rabbit (Oryctolagus cuniculus) TRG in IMGT/GENE-DB, IMGT/LIGM-DB and IMGT Web resources

    Creation of the rabbit (Oryctolagus cuniculus) TRG reference directory (IMGT/GENE-DB data updates).
    Addition in IMGT/GENE-DB of:
    11 rabbit (Oryctolagus cuniculus) TRGV genes corresponding to 25 allelic sequences.
    2 rabbit (Oryctolagus cuniculus) TRGJ genes corresponding to 2 allelic sequences.
    1 rabbit (Oryctolagus cuniculus) TRGC gene corresponding to 1 allelic sequence.

    Addition of TRG annotation of IMGT locus reference sequence IMGT000030 in IMGT/LIGM-DB.

    Creation of 17 web pages in IMGT Repertoire (IG and TR):
    Gene table: rabbit (Oryctolagus cuniculus) TRGV.
    Gene table: rabbit (Oryctolagus cuniculus) TRGJ.
    Gene table: rabbit (Oryctolagus cuniculus) TRGC.
    Alignment of alleles: rabbit (Oryctolagus cuniculus) TRGV.
    Alignment of alleles: rabbit (Oryctolagus cuniculus) TRGJ.
    Alignment of alleles: rabbit (Oryctolagus cuniculus) TRGC.
    Protein displays: rabbit (Oryctolagus cuniculus) TRGV.
    Protein displays: rabbit (Oryctolagus cuniculus) TRGJ.
    Protein displays: rabbit (Oryctolagus cuniculus) TRGC.
    Colliers de Perles: rabbit (Oryctolagus cuniculus) TRGV.
    Colliers de Perles: rabbit (Oryctolagus cuniculus) TRGC.
    Locus representation: rabbit (Oryctolagus cuniculus) TRG.
    Locus gene order: rabbit (Oryctolagus cuniculus) TRG.
    Locus in genome assembly: rabbit (Oryctolagus cuniculus) TRG.
    Locus description: rabbit (Oryctolagus cuniculus) TRG.
    Potential germline repertoire: rabbit (Oryctolagus cuniculus) TRGV and TRGJ genes on chromosome 10.
    Rabbit (Oryctolagus cuniculus) [CDR1-IMGT.CDR2-IMGT.CDR3-IMGT] lengths per TRGV subgroup.

    25 October 2018 - UPDATE 2018: Rhesus monkey (Macaca mulatta) TRB in IMGT/GENE-DB, IMGT/LIGM-DB and IMGT Web resources

    Creation of the Rhesus monkey (Macaca mulatta) TRB reference directory (IMGT/GENE-DB data updates).
    Addition in IMGT/GENE-DB of:
    77 Rhesus monkey (Macaca mulatta) TRBV genes corresponding to 96 allelic sequences.
    2 Rhesus monkey (Macaca mulatta) TRBD genes corresponding to 2 allelic sequences.
    14 Rhesus monkey (Macaca mulatta) TRBJ genes corresponding to 17 allelic sequences.
    2 Rhesus monkey (Macaca mulatta) TRBC genes corresponding to 3 allelic sequences.

    Addition of TRB annotation of IMGT locus reference sequence IMGT000012 in IMGT/LIGM-DB.
    Update of TRB annotation of IMGT locus reference sequence NW_001114291 in IMGT/LIGM-DB.

    Creation of 16 web pages in IMGT Repertoire (IG and TR):
    Gene table: Rhesus monkey (Macaca mulatta) TRBV.
    Gene table: Rhesus monkey (Macaca mulatta) TRBD.
    Gene table: Rhesus monkey (Macaca mulatta) TRBJ.
    Gene table: Rhesus monkey (Macaca mulatta) TRBC.
    Alignment of alleles: Rhesus monkey (Macaca mulatta) TRBV.
    Alignment of alleles: Rhesus monkey (Macaca mulatta) TRBD.
    Alignment of alleles: Rhesus monkey (Macaca mulatta) TRBJ.
    Alignment of alleles: Rhesus monkey (Macaca mulatta) TRBC.
    Colliers de Perles: Rhesus monkey (Macaca mulatta) TRBV.
    Colliers de Perles: Rhesus monkey (Macaca mulatta) TRBC.
    Locus representation: Rhesus monkey (Macaca mulatta) TRB.
    Potential germline repertoire: Rhesus monkey (Macaca mulatta) TRBV, TRBD and TRBJ genes.
    Locus description: Rhesus monkey (Macaca mulatta) TRB.
    Locus gene order: Rhesus monkey (Macaca mulatta) TRB.
    Locus in genome assembly: Rhesus monkey (Macaca mulatta) TRB.
    Rhesus monkey (Macaca mulatta) [CDR1-IMGT.CDR2-IMGT.CDR3-IMGT] lengths per TRBV subgroup.

    Update of 3 web pages in IMGT Repertoire (IG and TR):
    Protein displays: Rhesus monkey (Macaca mulatta) TRBV.
    Protein displays: Rhesus monkey (Macaca mulatta) TRBJ.
    Protein displays: Rhesus monkey (Macaca mulatta) TRBC.

    04 October 2018 - UPDATE 2018: human (Homo sapiens) IGHV in IMGT/GENE-DB, IMGT/LIGM-DB and IMGT Web resources

    Update of the human (Homo sapiens) IGH reference directory (IMGT/GENE-DB data updates).
    Addition in IMGT/GENE-DB of:
    3 IGHV genes corresponding to 3 allelic sequences : IGHV3-42D*04 (P), IGHV3-43D*04 (F), IGHV(II)-43-1D*02 (P).

    Addition of IMGT reference sequence annotation of IGHV3-42D*04, IGHV3-43D*04, IGHV(II)-43-1D*02 (AC242184) in IMGT/LIGM-DB.

    Update of 2 web pages in IMGT Repertoire (IG and TR):
    Gene table: human (Homo sapiens) IGHV.
    Alignment of alleles: human (Homo sapiens) IGHV3-43D.

    01 October 2018 - CREATION 2018: Domestic ferret (Mustela putorius furo) TRB in IMGT/GENE-DB, IMGT/LIGM-DB and IMGT Web resources

    Creation of the domestic ferret (Mustela putorius furo) TRB reference directory (IMGT/GENE-DB data updates).
    Addition in IMGT/GENE-DB of:
    34 domestic ferret (Mustela putorius furo) TRBV genes corresponding to 34 allelic sequences.
    2 domestic ferret (Mustela putorius furo) TRBD genes corresponding to 2 allelic sequences.
    12 domestic ferret (Mustela putorius furo) TRBJ genes corresponding to 12 allelic sequences.
    2 domestic ferret (Mustela putorius furo) TRBC genes corresponding to 2 allelic sequences.

    Addition of TRB annotation of IMGT locus reference sequence IMGT000022 and IMGT000023 in IMGT/LIGM-DB.

    Creation of 19 web pages in IMGT Repertoire (IG and TR):
    Gene table: domestic ferret (Mustela putorius furo) TRBV.
    Gene table: domestic ferret (Mustela putorius furo) TRBD.
    Gene table: domestic ferret (Mustela putorius furo) TRBJ.
    Gene table: domestic ferret (Mustela putorius furo) TRBC.
    Alignment of alleles: domestic ferret (Mustela putorius furo) TRBV.
    Alignment of alleles: domestic ferret (Mustela putorius furo) TRBD.
    Alignment of alleles: domestic ferret (Mustela putorius furo) TRBJ.
    Alignment of alleles: domestic ferret (Mustela putorius furo) TRBC.
    Protein displays: domestic ferret (Mustela putorius furo) TRBV.
    Protein displays: domestic ferret (Mustela putorius furo) TRBJ.
    Protein displays: domestic ferret (Mustela putorius furo) TRBC.
    Colliers de Perles: domestic ferret (Mustela putorius furo) TRBV.
    Colliers de Perles: domestic ferret (Mustela putorius furo) TRBC.
    Locus representation: domestic ferret (Mustela putorius furo) TRB.
    Potential germline repertoire: domestic ferret (Mustela putorius furo) TRBV, TRBD and TRBJ genes.
    Locus description: domestic ferret (Mustela putorius furo) TRB.
    Locus gene order: domestic ferret (Mustela putorius furo) TRB.
    Locus in genome assembly: domestic ferret (Mustela putorius furo) TRB.
    Domestic ferret (Mustela putorius furo) [CDR1-IMGT.CDR2-IMGT.CDR3-IMGT] lengths per TRBV subgroup.

    26 September 2018 - CREATION 2018: Dolphin (Tursiops truncatus) TRA/TRD in IMGT/GENE-DB, IMGT/LIGM-DB and IMGT Web resources

    Creation of the dolphin (Tursiops truncatus) TRA/TRD reference directory (IMGT/GENE-DB data updates).
    Addition in IMGT/GENE-DB of:
    18 dolphin (Tursiops truncatus) TRAV genes corresponding to 23 allelic sequences.
    60 dolphin (Tursiops truncatus) TRAJ genes corresponding to 60 allelic sequences.
    1 dolphin (Tursiops truncatus) TRAC genes corresponding to 1 allelic sequences.
    6 dolphin (Tursiops truncatus) TRDV genes corresponding to 6 allelic sequences.
    2 dolphin (Tursiops truncatus) TRDD genes corresponding to 2 allelic sequences.
    4 dolphin (Tursiops truncatus) TRDJ genes corresponding to 4 allelic sequences.
    1 dolphin (Tursiops truncatus) TRDC genes corresponding to 2 allelic sequences.

    Addition of TRA/TRD complete annotation in IMGT/LIGM-DB.

    Creation of 27 web pages in IMGT Repertoire (IG and TR):
    Gene table: dolphin (Tursiops truncatus) TRAV.
    Gene table: dolphin (Tursiops truncatus) TRAJ.
    Gene table: dolphin (Tursiops truncatus) TRAC.
    Gene table: dolphin (Tursiops truncatus) TRDV.
    Gene table: dolphin (Tursiops truncatus) TRDD.
    Gene table: dolphin (Tursiops truncatus) TRDJ.
    Gene table: dolphin (Tursiops truncatus) TRDC.
    Alignment of alleles: dolphin (Tursiops truncatus) TRAV.
    Alignment of alleles: dolphin (Tursiops truncatus) TRAJ.
    Alignment of alleles: dolphin (Tursiops truncatus) TRAC.
    Alignment of alleles: dolphin (Tursiops truncatus) TRDV.
    Alignment of alleles: dolphin (Tursiops truncatus) TRDD.
    Alignment of alleles: dolphin (Tursiops truncatus) TRDJ.
    Alignment of alleles: dolphin (Tursiops truncatus) TRDC.
    Protein displays: dolphin (Tursiops truncatus) TRAV.
    Protein displays: dolphin (Tursiops truncatus) TRAJ.
    Protein displays: dolphin (Tursiops truncatus) TRAC.
    Protein displays: dolphin (Tursiops truncatus) TRDV.
    Protein displays: dolphin (Tursiops truncatus) TRDJ.
    Protein displays: dolphin (Tursiops truncatus) TRDC.
    Colliers de Perles: dolphin (Tursiops truncatus) TRAV.
    Colliers de Perles: dolphin (Tursiops truncatus) TRAC.
    Colliers de Perles: dolphin (Tursiops truncatus) TRDV.
    Colliers de Perles: dolphin (Tursiops truncatus) TRDC.
    Locus representation: dolphin (Tursiops truncatus) TRA/TRD.
    Bottlenose dolphin (Tursiops truncatus) [CDR1-IMGT.CDR2-IMGT.CDR3-IMGT] lengths per TRAV subgroup.
    Bottlenose dolphin (Tursiops truncatus) [CDR1-IMGT.CDR2-IMGT.CDR3-IMGT] lengths per TRDV subgroup.

    17 September 2018 - CREATION 2018: Rhesus monkey (Macaca mulatta) TRA/TRD in IMGT/GENE-DB, IMGT/LIGM-DB and IMGT Web resources

    Creation of the Rhesus monkey (Macaca mulatta) TRA/TRD reference directory (IMGT/GENE-DB data updates).
    Addition in IMGT/GENE-DB of:
    60 Rhesus monkey (Macaca mulatta) TRAV genes corresponding to 60 allelic sequences.
    61 Rhesus monkey (Macaca mulatta) TRAJ genes corresponding to 62 allelic sequences.
    1 Rhesus monkey (Macaca mulatta) TRAC genes corresponding to 1 allelic sequences.
    4 Rhesus monkey (Macaca mulatta) TRDV genes corresponding to 5 allelic sequences.
    4 Rhesus monkey (Macaca mulatta) TRDD genes corresponding to 4 allelic sequences.
    4 Rhesus monkey (Macaca mulatta) TRDJ genes corresponding to 4 allelic sequences.
    1 Rhesus monkey (Macaca mulatta) TRDC genes corresponding to 2 allelic sequences.

    Addition of TRA/TRD locus annotation of IMGT locus reference sequence IMGT000013 and IMGT000026 in IMGT/LIGM-DB.

    Creation of 36 web pages in IMGT Repertoire (IG and TR):
    Gene table: Rhesus monkey (Macaca mulatta) TRAV.
    Gene table: Rhesus monkey (Macaca mulatta) TRAJ.
    Gene table: Rhesus monkey (Macaca mulatta) TRAC.
    Gene table: Rhesus monkey (Macaca mulatta) TRDV.
    Gene table: Rhesus monkey (Macaca mulatta) TRDD.
    Gene table: Rhesus monkey (Macaca mulatta) TRDJ.
    Gene table: Rhesus monkey (Macaca mulatta) TRDC.
    Alignment of alleles: Rhesus monkey (Macaca mulatta) TRAV.
    Alignment of alleles: Rhesus monkey (Macaca mulatta) TRAJ.
    Alignment of alleles: Rhesus monkey (Macaca mulatta) TRAC.
    Alignment of alleles: Rhesus monkey (Macaca mulatta) TRDV.
    Alignment of alleles: Rhesus monkey (Macaca mulatta) TRDD.
    Alignment of alleles: Rhesus monkey (Macaca mulatta) TRDJ.
    Alignment of alleles: Rhesus monkey (Macaca mulatta) TRDC.
    Protein displays: Rhesus monkey (Macaca mulatta) TRAV.
    Protein displays: Rhesus monkey (Macaca mulatta) TRAJ.
    Protein displays: Rhesus monkey (Macaca mulatta) TRAC.
    Protein displays: Rhesus monkey (Macaca mulatta) TRDV.
    Protein displays: Rhesus monkey (Macaca mulatta) TRDJ.
    Protein displays: Rhesus monkey (Macaca mulatta) TRDC.
    Colliers de Perles: Rhesus monkey (Macaca mulatta) TRAV.
    Colliers de Perles: Rhesus monkey (Macaca mulatta) TRAC.
    Colliers de Perles: Rhesus monkey (Macaca mulatta) TRDV.
    Colliers de Perles: Rhesus monkey (Macaca mulatta) TRDC.
    Locus representation: Rhesus monkey (Macaca mulatta) TRA.
    Locus representation: Rhesus monkey (Macaca mulatta) TRD.
    Potential germline repertoire: Rhesus monkey (Macaca mulatta) TRAV.
    Potential germline repertoire: Rhesus monkey (Macaca mulatta) TRDV.
    Locus gene order: Rhesus monkey (Macaca mulatta) TRA.
    Locus gene order: Rhesus monkey (Macaca mulatta) TRD.
    Locus in genome assembly: Rhesus monkey (Macaca mulatta) TRA.
    Locus in genome assembly: Rhesus monkey (Macaca mulatta) TRD.
    [CDR1-IMGT.CDR2-IMGT.CDR3-IMGT] lengths: Rhesus monkey (Macaca mulatta) TRAV.
    [CDR1-IMGT.CDR2-IMGT.CDR3-IMGT] lengths: Rhesus monkey (Macaca mulatta) TRDV.
    Locus description: Rhesus monkey (Macaca mulatta) TRA.
    Locus description: Rhesus monkey (Macaca mulatta) TRD.

    06 September 2018 - UPDATE 2018: human (Homo sapiens) IGHC in IMGT/GENE-DB, IMGT/LIGM-DB and IMGT Web resources

    Update of the human (Homo sapiens) IGH reference directory (IMGT/GENE-DB data updates).
    Addition in IMGT/GENE-DB of:
    1 IGHC gene corresponding to 1 allelic sequence : IGHG3*20.

    Addition of IMGT reference sequence annotation of IGHG3*20 (MG920256) in IMGT/LIGM-DB.

    Update of 2 web pages in IMGT Repertoire (IG and TR):
    Gene table: human (Homo spaiens) IGHC.
    Alignment of alleles: human (Homo spaiens) IGHG3.

    31 August 2018 - CREATION 2018: Dolphin (Tursiops truncatus) TRG in IMGT/GENE-DB, IMGT/LIGM-DB and IMGT Web resources

    Creation of the dolphin (Tursiops truncatus) TRG reference directory (IMGT/GENE-DB data updates).
    Addition in IMGT/GENE-DB of:
    2 dolphin (Tursiops truncatus) TRGV genes corresponding to 3 allelic sequences.
    3 dolphin (Tursiops truncatus) TRGJ genes corresponding to 4 allelic sequence.
    1 dolphin (Tursiops truncatus) TRGC gene corresponding to 1 allelic sequence.

    Addition of TRG annotation of IMGT locus reference sequence JH473572 in IMGT/LIGM-DB.

    Creation of 17 web pages in IMGT Repertoire (IG and TR):
    Gene table: bottlenose dolphin (Tursiops truncatus) TRGV.
    Gene table: bottlenose dolphin (Tursiops truncatus) TRGJ.
    Gene table: bottlenose dolphin (Tursiops truncatus) TRGC.
    Alignment of alleles: bottlenose dolphin (Tursiops truncatus) TRGV.
    Alignment of alleles: bottlenose dolphin (Tursiops truncatus) TRGJ.
    Alignment of alleles: bottlenose dolphin (Tursiops truncatus) TRGC.
    Protein displays: bottlenose dolphin (Tursiops truncatus) TRGV.
    Protein displays: bottlenose dolphin (Tursiops truncatus) TRGJ.
    Protein displays: bottlenose dolphin (Tursiops truncatus) TRGC.
    Colliers de Perles: bottlenose dolphin (Tursiops truncatus) TRGV.
    Colliers de Perles: bottlenose dolphin (Tursiops truncatus) TRGC.
    Locus representation: bottlenose dolphin (Tursiops truncatus) TRG.
    Potential germline repertoire: bottlenose dolphin (Tursiops truncatus) TRGV and TRGJ genes.
    Locus description: bottlenose dolphin (Tursiops truncatus) TRG.
    Locus gene order: bottlenose dolphin (Tursiops truncatus) TRG.
    Locus in genome assembly: bottlenose dolphin (Tursiops truncatus) TRG.
    Bottlenose dolphin (Tursiops truncatus) [CDR1-IMGT.CDR2-IMGT.CDR3-IMGT] lengths per TRGV subgroup.

    24 July 2018 - UPDATE 2018: human (Homo sapiens) IGHV in IMGT/GENE-DB, IMGT/LIGM-DB and IMGT Web resources

    Update of the human (Homo sapiens) IGH reference directory (IMGT/GENE-DB data updates).
    Addition in IMGT/GENE-DB of:
    3 IGHV genes corresponding to 3 allelic sequences : IGHV1-2*06, IGHV1-69*17 and IGHV3-20*03.

    Addition of IMGT reference sequence annotation of IGHV1-2*06 (MH267285), IGHV1-69*17 (MH359407) and IGHV3-20*03 (MH332884) in IMGT/LIGM-DB.

    Update of 2 web pages in IMGT Repertoire (IG and TR):
    Gene table: human (Homo spaiens) IGHV.
    Alignment of alleles: human (Homo spaiens) IGHV.

    17 July 2018 - CREATION 2018: Chicken (Gallus gallus) IGL in IMGT/GENE-DB, IMGT/LIGM-DB and IMGT Web resources

    Creation of the chicken (Gallus gallus) IGL reference directory (IMGT/GENE-DB data updates).
    Addition in IMGT/GENE-DB of:
    34 chicken (Gallus gallus) IGLV genes corresponding to 51 allelic sequences.
    1 chicken (Gallus gallus) IGLJ gene corresponding to 1 allelic sequence.
    1 chicken (Gallus gallus) IGLC gene corresponding to 1 allelic sequence.

    Addition of IGL annotation of IMGT locus reference sequence IMGT000008 in IMGT/LIGM-DB.

    Creation of 17 web pages in IMGT Repertoire (IG and TR):
    Gene table: chicken (Gallus gallus) IGLV.
    Gene table: chicken (Gallus gallus) IGLJ.
    Gene table: chicken (Gallus gallus) IGLC.
    Alignment of alleles: chicken (Gallus gallus) IGLV.
    Alignment of alleles: chicken (Gallus gallus) IGLJ.
    Alignment of alleles: chicken (Gallus gallus) IGLC.
    Protein displays: chicken (Gallus gallus) IGLV.
    Protein displays: chicken (Gallus gallus) IGLJ.
    Protein displays: chicken (Gallus gallus) IGLC.
    Colliers de Perles: chicken (Gallus gallus) IGLV.
    Colliers de Perles: chicken (Gallus gallus) IGLC.
    Locus representation: chicken (Gallus gallus) IGL.
    Potential germline repertoire: chicken (Gallus gallus) IGLV and IGLJ genes on chromosome 15.
    Locus description: chicken (Gallus gallus) IGL.
    Locus gene order: chicken (Gallus gallus) IGL.
    Locus in genome assembly: chicken (Gallus gallus) IGL.
    [CDR1-IMGT.CDR2-IMGT.CDR3-IMGT] lengths: chicken (Gallus gallus) IGLV.

    27 June 2018 - CREATION and UPDATE 2018: Dog (Canis lupus familiaris) IGH in IMGT/GENE-DB, IMGT/LIGM-DB and IMGT Web resources

    Creation of the dog (Canis lupus familiaris) IGH reference directory (IMGT/GENE-DB data updates).
    Addition in IMGT/GENE-DB of:
    89 dog (Canis lupus familiaris) IGHV genes corresponding to 89 allelic sequences.
    6 dog (Canis lupus familiaris) IGHD genes corresponding to 6 allelic sequences.
    6 dog (Canis lupus familiaris) IGHJ gene corresponding to 6 allelic sequence.
    Update of 8 dog (Canis lupus familiaris) IGHC gene corresponding to 11 allelic sequence.

    Addition of IGH annotation of IMGT locus reference sequence IMGT000001 in IMGT/LIGM-DB.

    Creation of 15 web pages in IMGT Repertoire (IG and TR):
    Gene table: dog (Canis lupus familiaris) IGHV.
    Gene table: dog (Canis lupus familiaris) IGHD.
    Gene table: dog (Canis lupus familiaris) IGHJ.
    Alignment of alleles: dog (Canis lupus familiaris) IGHV.
    Alignment of alleles: dog (Canis lupus familiaris) IGHD.
    Alignment of alleles: dog (Canis lupus familiaris) IGHJ.
    Protein displays: dog (Canis lupus familiaris) IGHV.
    Protein displays: dog (Canis lupus familiaris) IGHJ.
    Colliers de Perles: dog (Canis lupus familiaris) IGHV.
    Locus representation: dog (Canis lupus familiaris) IGH.
    Potential germline repertoire: dog (Canis lupus familiaris) IGHV, IGHD and IGHJ genes on chromosome 8 .
    Locus description: dog (Canis lupus familiaris) IGH.
    Locus gene order: dog (Canis lupus familiaris) IGH.
    Locus in genome assembly: dog (Canis lupus familiaris) IGH.
    [CDR1-IMGT.CDR2-IMGT.CDR3-IMGT] lengths: dog (Canis lupus familiaris) IGHV.

    Update of 3 web pages in IMGT Repertoire (IG and TR):
    Gene table: dog (Canis lupus familiaris) IGHC.
    Alignment of alleles: dog (Canis lupus familiaris) IGHC.
    Protein displays: dog (Canis lupus familiaris) IGHC.

    15 June 2018 - UPDATE 2018: Human (Homo sapiens) TRG in IMGT/GENE-DB, IMGT/LIGM-DB and IMGT Web resources

    Creation of the bovine (Bos taurus) IGH reference directory (IMGT/GENE-DB data updates).
    Addition in IMGT/GENE-DB of:
    1 human (Homo sapiens) TRGV gene corresponding to 1 allelic sequence.
    1 human (Homo sapiens) TRGJ gene corresponding to 1 allelic sequence.

    Addition of TRG annotation of IMGT locus reference sequence IMGT000011 in IMGT/LIGM-DB.

    Creation of 1 web page in IMGT Repertoire (IG and TR):
    Locus in genome assembly: human (Homo sapiens) TRG.

    Update of 7 web pages in IMGT Repertoire (IG and TR):
    Gene table: human (Homo sapiens) TRGV.
    Gene table: human (Homo sapiens) TRGJ.
    Gene table: human (Homo sapiens) TRGC.
    Alignment of alleles: human (Homo sapiens) TRGV.
    Alignment of alleles: human (Homo sapiens) TRGJ.
    Alignment of alleles: human (Homo sapiens) TRGC.
    Locus representation: human (Homo sapiens) TRG.

    11 June 2018 - CREATION 2018: Chicken (Gallus gallus) IGH in IMGT/GENE-DB, IMGT/LIGM-DB and IMGT Web resources

    Creation of the chicken (Gallus gallus) IGH reference directory (IMGT/GENE-DB data updates).
    Addition in IMGT/GENE-DB of:
    104 chicken (Gallus gallus) IGHV genes corresponding to 122 allelic sequences.
    4 chicken (Gallus gallus) IGHD genes corresponding to 4 allelic sequences.
    1 chicken (Gallus gallus) IGHJ gene corresponding to 1 allelic sequence.
    3 chicken (Gallus gallus) IGHC gene corresponding to 3 allelic sequence.

    Addition of IGH annotation of IMGT locus reference sequence IMGT000007 and IMGT000014 in IMGT/LIGM-DB.

    Creation of 19 web pages in IMGT Repertoire (IG and TR):
    Gene table: chicken (Gallus gallus) IGHV.
    Gene table: chicken (Gallus gallus) IGHD.
    Gene table: chicken (Gallus gallus) IGHJ.
    Gene table: chicken (Gallus gallus) IGHC.
    Alignment of alleles: chicken (Gallus gallus) IGHV.
    Alignment of alleles: chicken (Gallus gallus) IGHD.
    Alignment of alleles: chicken (Gallus gallus) IGHJ.
    Alignment of alleles: chicken (Gallus gallus) IGHC.
    Protein displays: chicken (Gallus gallus) IGHV.
    Protein displays: chicken (Gallus gallus) IGHJ.
    Protein displays: chicken (Gallus gallus) IGHC.
    Colliers de Perles: chicken (Gallus gallus) IGHV.
    Colliers de Perles: chicken (Gallus gallus) IGHC.
    Locus representation: chicken (Gallus gallus) IGH.
    Potential germline repertoire: chicken (Gallus gallus) IGHV, IGHD and IGHJ genes on chromosome 31.
    Locus description: chicken (Gallus gallus) IGH.
    Locus gene order: chicken (Gallus gallus) IGH.
    Locus in genome assembly: chicken (Gallus gallus) IGH.
    [CDR1-IMGT.CDR2-IMGT.CDR3-IMGT] lengths: chicken (Gallus gallus) IGHV.

    15 May 2018 - CREATION 2018: Mouse (Mus musculus) IGHV in IMGT Web resources

    Creation of 1 web page in IMGT Repertoire (IG and TR):
    Alignment of alleles: mouse (Mus musculus) IGHV.

    19 April 2018 - UPDATE 2018: Dog (Canis lupus familiaris) TRG in IMGT/GENE-DB, IMGT/LIGM-DB and IMGT Web resources

    Update of the dog (Canis lupus familiaris) TRG reference directory (IMGT/GENE-DB data updates).
    Update in IMGT/GENE-DB of:
    16 dog (Canis lupus familiaris) TRGV genes corresponding to 16 allelic sequences.
    16 dog (Canis lupus familiaris) TRGJ genes corresponding to 16 allelic sequences.
    8 dog (Canis lupus familiaris) TRGC genes corresponding to 8 allelic sequences.

    Update of TRG annotation of IMGT locus reference sequence IMGT000006 in IMGT/LIGM-DB.

    Creation of 4 web pages in IMGT Repertoire (IG and TR):
    Potential germline repertoire: dog (Canis lupus familiaris) TRGV and TRGJ genes on chromosome 18.
    Locus gene order: dog (Canis lupus familiaris) TRG.
    Locus in genome assembly: dog (Canis lupus familiaris) TRG.
    [CDR1-IMGT.CDR2-IMGT.CDR3-IMGT] lengths: dog (Canis lupus familiaris) TRGV.

    Update of 12 web pages in IMGT Repertoire (IG and TR):
    Gene table: dog (Canis lupus familiaris) TRGV.
    Gene table: dog (Canis lupus familiaris) TRGJ.
    Gene table: dog (Canis lupus familiaris) TRGC.
    Alignment of alleles: dog (Canis lupus familiaris) TRGV.
    Alignment of alleles: dog (Canis lupus familiaris) TRGJ.
    Alignment of alleles: dog (Canis lupus familiaris) TRGC.
    Protein displays: dog (Canis lupus familiaris) TRGV.
    Protein displays: dog (Canis lupus familiaris) TRGJ.
    Protein displays: dog (Canis lupus familiaris) TRGC.
    Colliers de Perles: dog (Canis lupus familiaris) TRGV.
    Colliers de Perles: dog (Canis lupus familiaris) TRGC.
    Locus representation: dog (Canis lupus familiaris) TRG.

    26 March 2018 - CREATION 2018: Sheep (Ovis aries) IGK in IMGT/GENE-DB, IMGT/LIGM-DB and IMGT Web resources

    Creation of the sheep (Ovis aries) IGK reference directory (IMGT/GENE-DB data updates).
    Addition in IMGT/GENE-DB of:
    18 sheep (Ovis aries) IGKV genes corresponding to 18 allelic sequences.
    4 sheep (Ovis aries) IGKJ genes corresponding to 4 allelic sequences.
    1 sheep (Ovis aries) IGKC genes corresponding to 1 allelic sequences.

    Addition of sheep (Ovis aries) IGK locus annotation of IMGT locus reference sequence IMGT000010 in IMGT/LIGM-DB.

    Creation of 17 web pages in IMGT Repertoire (IG and TR):
    Gene table: sheep (Ovis aries) IGKV.
    Gene table: sheep (Ovis aries) IGKJ.
    Gene table: sheep (Ovis aries) IGKC.
    Alignment of alleles: sheep (Ovis aries) IGKV.
    Alignment of alleles: sheep (Ovis aries) IGKJ.
    Alignment of alleles: sheep (Ovis aries) IGKC.
    Protein displays: sheep (Ovis aries) IGKV.
    Protein displays: sheep (Ovis aries) IGKJ.
    Protein displays: sheep (Ovis aries) IGKC.
    Colliers de Perles: sheep (Ovis aries) IGKV.
    Colliers de Perles: sheep (Ovis aries) IGKC.
    Locus representation: sheep (Ovis aries) IGK.
    Potential germline repertoire: sheep (Ovis aries) IGKV and IGKJ genes on chromosome 3.
    Locus description: sheep (Ovis aries) IGK.
    Locus gene order: sheep (Ovis aries) IGK.
    Locus in genome assembly: sheep (Ovis aries) IGK.
    [CDR1-IMGT.CDR2-IMGT.CDR3-IMGT] lengths: sheep (Ovis aries) IGKV.

    15 February 2018 - CREATION 2018: Goat (Capra hircus) IGK in IMGT/GENE-DB, IMGT/LIGM-DB and IMGT Web resources

    Creation of thegoat (Capra hircus) IGK reference directory (IMGT/GENE-DB data updates).
    Addition in IMGT/GENE-DB of:
    Addition of 21 goat (Capra hircus) IGKV genes corresponding to 21 allelic sequences.
    Addition of 4 goat (Capra hircus) IGKJ genes corresponding to 4 allelic sequences.
    Addition of goat (Capra hircus) 1 IGKC genes corresponding to 1 allelic sequences.

    Addition of goat (Capra hircus) IGK locus annotation of IMGT locus reference sequence IMGT000009 in IMGT/LIGM-DB.

    Creation of 17 web pages in IMGT Repertoire (IG and TR):
    Gene table: goat (Capra hircus) IGKV.
    Gene table: goat (Capra hircus) IGKJ.
    Gene table: goat (Capra hircus) IGKC.
    Alignment of alleles: goat (Capra hircus) IGKV.
    Alignment of alleles: goat (Capra hircus) IGKJ.
    Alignment of alleles: goat (Capra hircus) IGKC.
    Protein displays: goat (Capra hircus) IGKV.
    Protein displays: goat (Capra hircus) IGKJ.
    Protein displays: goat (Capra hircus) IGKC.
    Colliers de Perles: goat (Capra hircus) IGKV.
    Colliers de Perles: goat (Capra hircus) IGKC.
    Locus representation: goat (Capra hircus) IGK.
    Potential germline repertoire: goat (Capra hircus) IGKV and IGKJ genes on chromosome 11.
    Locus description: goat (Capra hircus) IGK.
    Locus gene order: goat (Capra hircus) IGK.
    Locus in genome assembly: goat (Capra hircus) IGK.
    [CDR1-IMGT.CDR2-IMGT.CDR3-IMGT] lengths: goat (Capra hircus) IGKV.

    13 February 2018 - CREATION 2018: Zebrafish (Danio rerio) TRA/TRD in IMGT/GENE-DB, IMGT/LIGM-DB and IMGT Web resources

    Creation of the zebrafish (Danio rerio) TRA/TRD reference directory (IMGT/GENE-DB data updates).
    Addition in IMGT/GENE-DB of:
    152 zebrafish (Danio rerio) TRAV genes corresponding to 289 allelic sequences.
    123 zebrafish (Danio rerio) TRAJ genes corresponding to 136 allelic sequences.
    1 zebrafish (Danio rerio) TRAC genes corresponding to 2 allelic sequences.
    6 zebrafish (Danio rerio) TRDD genes corresponding to 6 allelic sequences.
    2 zebrafish (Danio rerio) TRDJ genes corresponding to 2 allelic sequences.
    1 zebrafish (Danio rerio) TRDC genes corresponding to 1 allelic sequences.

    Addition of TRA/TRD locus annotation of IMGT locus reference sequence NW_003334160 in IMGT/LIGM-DB.

    Creation of 31 web pages in IMGT Repertoire (IG and TR):
    Gene table: zebrafish (Danio rerio) TRAV.
    Gene table: zebrafish (Danio rerio) TRAJ.
    Gene table: zebrafish (Danio rerio) TRAC.
    Gene table: zebrafish (Danio rerio) TRDD.
    Gene table: zebrafish (Danio rerio) TRDJ.
    Gene table: zebrafish (Danio rerio) TRDC.
    Alignment of alleles: zebrafish (Danio rerio) TRAV.
    Alignment of alleles: zebrafish (Danio rerio) TRAJ.
    Alignment of alleles: zebrafish (Danio rerio) TRAC.
    Alignment of alleles: zebrafish (Danio rerio) TRDD.
    Alignment of alleles: zebrafish (Danio rerio) TRDJ.
    Alignment of alleles: zebrafish (Danio rerio) TRDC.
    Protein displays: zebrafish (Danio rerio) TRAV.
    Protein displays: zebrafish (Danio rerio) TRAJ.
    Protein displays: zebrafish (Danio rerio) TRAC.
    Protein displays: zebrafish (Danio rerio) TRDJ.
    Protein displays: zebrafish (Danio rerio) TRDC.
    Colliers de Perles: zebrafish (Danio rerio) TRAV.
    Colliers de Perles: zebrafish (Danio rerio) TRAC.
    Colliers de Perles: zebrafish (Danio rerio) TRDC.
    Locus representation: zebrafish (Danio rerio) TRA.
    Locus representation: zebrafish (Danio rerio) TRD.
    Potential germline repertoire: zebrafish (Danio rerio) TRAV.
    Potential germline repertoire: zebrafish (Danio rerio) TRDV.
    Locus gene order: zebrafish (Danio rerio) TRA.
    Locus gene order: zebrafish (Danio rerio) TRD.
    Locus in genome assembly: zebrafish (Danio rerio) TRA.
    Locus in genome assembly: zebrafish (Danio rerio) TRD.
    [CDR1-IMGT.CDR2-IMGT.CDR3-IMGT] lengths: zebrafish (Danio rerio) TRAV.
    Locus description: zebrafish (Danio rerio) TRA.
    Locus description: zebrafish (Danio rerio) TRD.

    2017

    18 December 2017 - CREATION 2017: Bovine (Bos taurus) IGH in IMGT/GENE-DB, IMGT/LIGM-DB and IMGT Web resources

    Creation of the bovine (Bos taurus) IGH reference directory (IMGT/GENE-DB data updates).
    Addition in IMGT/GENE-DB of:
    49 bovine (Bos taurus) IGHV genes corresponding to 74 allelic sequences.
    23 bovine (Bos taurus) IGHD genes corresponding to 24 allelic sequences.
    12 bovine (Bos taurus) IGHJ genes corresponding to 18 allelic sequences.
    12 bovine (Bos taurus) IGHC genes corresponding to 27 allelic sequences.

    Addition of IGH annotation of IMGT locus reference sequence KT723008 in IMGT/LIGM-DB.

    Creation of 21 web pages in IMGT Repertoire (IG and TR):
    Gene table: bovine (Bos taurus) IGHV.
    Gene table: bovine (Bos taurus) IGHD.
    Gene table: bovine (Bos taurus) IGHJ.
    Alignment of alleles: bovine (Bos taurus) IGHV.
    Alignment of alleles: bovine (Bos taurus) IGHD.
    Alignment of alleles: bovine (Bos taurus) IGHJ.
    Alignment of alleles: bovine (Bos taurus) IGHC.
    Protein displays: bovine (Bos taurus) IGHV.
    Protein displays: bovine (Bos taurus) IGHJ.
    Colliers de Perles: bovine (Bos taurus) IGHV.
    Locus representation: bovine (Bos taurus) IGH.
    Potential germline repertoire: bovine (Bos taurus) IGHV, IGHD and IGHJ genes on chromosome 21 at 21q24.
    Locus description: bovine (Bos taurus) IGH.
    Locus gene order: bovine (Bos taurus) IGH.
    Locus in genome assembly: bovine (Bos taurus) IGH.
    [CDR1-IMGT.CDR2-IMGT.CDR3-IMGT] lengths: bovine (Bos taurus) IGHV.
    Correspondence between nomenclatures: bovine (Bos taurus) IGHV.
    Correspondence between nomenclatures: bovine (Bos taurus) IGHD.
    Correspondence between nomenclatures: bovine (Bos taurus) IGHJ.
    Correspondence between nomenclatures: bovine (Bos taurus) IGHC.
    Correspondence between species: Bos taurus (cattle) and Homo sapiens (human) IGHV.

    Update of 3 web pages in IMGT Repertoire (IG and TR):
    Gene table: bovine (Bos taurus) IGHC.
    Protein displays: bovine (Bos taurus) IGHC.
    Colliers de Perles: bovine (Bos taurus) IGHC.

    05 December 2017 - CREATION 2017: Dog (Canis lupus familiaris) IGK in IMGT/GENE-DB, IMGT/LIGM-DB and IMGT Web resources

    Creation of the dog (Canis lupus familiaris) IGK reference directory (IMGT/GENE-DB data updates).
    Addition in IMGT/GENE-DB of:
    21 dog (Canis lupus familiaris) IGKV genes corresponding to 21 allelic sequences.
    5 dog (Canis lupus familiaris) IGKJ genes corresponding to 5 allelic sequences.
    1 dog (Canis lupus familiaris) IGKC genes corresponding to 1 allelic sequences.

    Addition of IGK annotation of IMGT locus reference sequence IMGT000002 in IMGT/LIGM-DB.

    Creation of 16 web pages in IMGT Repertoire (IG and TR):
    Gene table: dog (Canis lupus familiaris) IGKV.
    Gene table: dog (Canis lupus familiaris) IGKJ.
    Gene table: dog (Canis lupus familiaris) IGKC.
    Alignment of alleles: dog (Canis lupus familiaris) IGKV.
    Alignment of alleles: dog (Canis lupus familiaris) IGKJ.
    Alignment of alleles: dog (Canis lupus familiaris) IGKC.
    Protein displays: dog (Canis lupus familiaris) IGKV.
    Protein displays: dog (Canis lupus familiaris) IGKJ.
    Protein displays: dog (Canis lupus familiaris) IGKC.
    Colliers de Perles: dog (Canis lupus familiaris) IGKV.
    Colliers de Perles: dog (Canis lupus familiaris) IGKC.
    Locus representation: dog (Canis lupus familiaris) IGK.
    Potential germline repertoire: dog (Canis lupus familiaris) IGKV.
    Locus gene order: dog (Canis lupus familiaris) IGK.
    Locus in genome assembly: dog (Canis lupus familiaris) IGK.
    [CDR1-IMGT.CDR2-IMGT.CDR3-IMGT] lengths: dog (Canis lupus familiaris) IGKV.

    22 November 2017 - CREATION 2017: Dog (Canis lupus familiaris) TRA/TRD in IMGT/GENE-DB, IMGT/LIGM-DB and IMGT Web resources

    Creation of the dog (Canis lupus familiaris) TRA/TRD reference directory (IMGT/GENE-DB data updates).
    Addition in IMGT/GENE-DB of:
    56 dog (Canis lupus familiaris) TRAV genes corresponding to 54 allelic sequences.
    59 dog (Canis lupus familiaris) TRAJ genes corresponding to 59 allelic sequences.
    1 dog (Canis lupus familiaris) TRAC genes corresponding to 1 allelic sequences.
    5 dog (Canis lupus familiaris) TRDV genes corresponding to 5 allelic sequences.
    2 dog (Canis lupus familiaris) TRDD genes corresponding to 2 allelic sequences.
    4 dog (Canis lupus familiaris) TRDJ genes corresponding to 4 allelic sequences.
    1 dog (Canis lupus familiaris) TRDC genes corresponding to 1 allelic sequences.

    Addition of TRA/TRD annotation of IMGT locus reference sequence IMGT000004 in IMGT/LIGM-DB.

    Creation of 34 web pages in IMGT Repertoire (IG and TR):
    Gene table: dog (Canis lupus familiaris) TRAV.
    Gene table: dog (Canis lupus familiaris) TRAJ.
    Gene table: dog (Canis lupus familiaris) TRAC.
    Gene table: dog (Canis lupus familiaris) TRDV.
    Gene table: dog (Canis lupus familiaris) TRDD.
    Gene table: dog (Canis lupus familiaris) TRDJ.
    Gene table: dog (Canis lupus familiaris) TRDC.
    Alignment of alleles: dog (Canis lupus familiaris) TRAV.
    Alignment of alleles: dog (Canis lupus familiaris) TRAJ.
    Alignment of alleles: dog (Canis lupus familiaris) TRAC.
    Alignment of alleles: dog (Canis lupus familiaris) TRDV.
    Alignment of alleles: dog (Canis lupus familiaris) TRDD.
    Alignment of alleles: dog (Canis lupus familiaris) TRDJ.
    Alignment of alleles: dog (Canis lupus familiaris) TRDC.
    Protein displays: dog (Canis lupus familiaris) TRAV.
    Protein displays: dog (Canis lupus familiaris) TRAJ.
    Protein displays: dog (Canis lupus familiaris) TRAC.
    Protein displays: dog (Canis lupus familiaris) TRDV.
    Protein displays: dog (Canis lupus familiaris) TRDJ.
    Protein displays: dog (Canis lupus familiaris) TRDC.
    Colliers de Perles: dog (Canis lupus familiaris) TRAV.
    Colliers de Perles: dog (Canis lupus familiaris) TRAC.
    Colliers de Perles: dog (Canis lupus familiaris) TRDV.
    Colliers de Perles: dog (Canis lupus familiaris) TRDC.
    Locus representation: dog (Canis lupus familiaris) TRA.
    Locus representation: dog (Canis lupus familiaris) TRD.
    Potential germline repertoire: dog (Canis lupus familiaris) TRAV.
    Potential germline repertoire: dog (Canis lupus familiaris) TRDV.
    Locus gene order: dog (Canis lupus familiaris) TRA.
    Locus gene order: dog (Canis lupus familiaris) TRD.
    Locus in genome assembly: dog (Canis lupus familiaris) TRA.
    Locus in genome assembly: dog (Canis lupus familiaris) TRD.
    [CDR1-IMGT.CDR2-IMGT.CDR3-IMGT] lengths: dog (Canis lupus familiaris) TRAV.
    [CDR1-IMGT.CDR2-IMGT.CDR3-IMGT] lengths: dog (Canis lupus familiaris) TRDV.

    13 November 2017 - UPDATE 2017: Dog (Canis lupus familiaris) TRB in IMGT/GENE-DB, IMGT/LIGM-DB and IMGT Web resources

    Creation of the dog (Canis lupus familiaris) TRB reference directory (IMGT/GENE-DB data updates).
    Addition in IMGT/GENE-DB of:
    36 dog (Canis lupus familiaris) TRBV genes corresponding to 36 allelic sequences.
    1 dog (Canis lupus familiaris) TRBD genes corresponding to 1 allelic sequences.
    6 dog (Canis lupus familiaris) TRBJ genes corresponding to 6 allelic sequences.
    1 dog (Canis lupus familiaris) TRBC genes corresponding to 1 allelic sequences.

    Addition of TRB annotation of IMGT locus reference sequence IMGT000005 in IMGT/LIGM-DB.

    Creation of 5 web pages in IMGT Repertoire (IG and TR):
    Alignment of alleles: dog (Canis lupus familiaris) TRBV.
    Potential germline repertoire: dog (Canis lupus familiaris) TRBV, TRBD and TRBJ genes on chromosome 16.
    Locus description: dog (Canis lupus familiaris) TRB.
    Locus in genome assembly: dog (Canis lupus familiaris) TRB.
    [CDR1-IMGT.CDR2-IMGT.CDR3-IMGT] lengths: dog (Canis lupus familiaris) TRBV.

    Update of 14 web pages in IMGT Repertoire (IG and TR):
    Gene table: dog (Canis lupus familiaris) TRBV.
    Gene table: dog (Canis lupus familiaris) TRBD.
    Gene table: dog (Canis lupus familiaris) TRBJ.
    Gene table: dog (Canis lupus familiaris) TRBC.
    Alignment of alleles: dog (Canis lupus familiaris) TRBD.
    Alignment of alleles: dog (Canis lupus familiaris) TRBJ.
    Alignment of alleles: dog (Canis lupus familiaris) TRBC.
    Protein displays: dog (Canis lupus familiaris) TRBV.
    Protein displays: dog (Canis lupus familiaris) TRBJ.
    Protein displays: dog (Canis lupus familiaris) TRBC.
    Colliers de Perles: dog (Canis lupus familiaris) TRBV.
    Colliers de Perles: dog (Canis lupus familiaris) TRBC.
    Locus representation: dog (Canis lupus familiaris) TRB.
    Locus gene order: dog (Canis lupus familiaris) TRB.

    03 February 2017 - CREATION 2017: Crab-eating macaque (Macaca fascicularis) IGH in IMGT/GENE-DB, IMGT/LIGM-DB and IMGT Web resources

    Creation of the crab-eating macaque (Macaca fascicularis) IGH reference directory (IMGT/GENE-DB data updates).
    Addition in IMGT/GENE-DB of:
    149 crab-eating macaque (Macaca fascicularis) IGHV genes corresponding to 149 allelic sequences.
    40 crab-eating macaque (Macaca fascicularis) IGHD genes corresponding to 40 allelic sequences.
    8 crab-eating macaque (Macaca fascicularis) IGHJ genes corresponding to 8 allelic sequences.
    3 crab-eating macaque (Macaca fascicularis) IGHC genes corresponding to 3 allelic sequences.

    Addition of IGH complete annotation in IMGT/LIGM-DB.

    Creation of 9 web pages in IMGT Repertoire (IG and TR):
    Gene table: crab-eating macaque (Macaca fascicularis) IGHV.
    Gene table: crab-eating macaque (Macaca fascicularis) IGHD.
    Gene table: crab-eating macaque (Macaca fascicularis) IGHJ.
    Alignment of alleles: crab-eating macaque (Macaca fascicularis) IGHV.
    Alignment of alleles: crab-eating macaque (Macaca fascicularis) IGHD.
    Alignment of alleles: crab-eating macaque (Macaca fascicularis) IGHJ.
    Protein displays: crab-eating macaque (Macaca fascicularis) IGHV.
    Protein displays: crab-eating macaque (Macaca fascicularis) IGHJ.
    Colliers de Perles: crab-eating macaque (Macaca fascicularis) IGHV.

    Update of 3 web pages in IMGT Repertoire (IG and TR):
    Gene table: crab-eating macaque (Macaca fascicularis) IGHC.
    Alignment of alleles: crab-eating macaque (Macaca fascicularis) IGHC.
    Protein displays: crab-eating macaque (Macaca fascicularis) IGHC.
    Colliers de Perles: crab-eating macaque (Macaca fascicularis) IGHC.

    2015

    13 November 2015 - UPDATE: Mouse (Mus musculus) IGHV in IMGT/GENE-DB, IMGT/LIGM-DB and IMGT Web resources

    • Addition of 1 IGHV gene in IMGT/GENE-DB, corresponding to 1 allelic sequence: IGHV1-87*01
    • Addition of 1 IGHV gene in IMGT/LIGM-DB, corresponding to 1 allelic sequence: IGHV1-87*01

    27 July 2015 - UPDATE: Human (Homo sapiens) IGHV in IMGT/GENE-DB, IMGT/LIGM-DB and IMGT Web resources

    • Addition of 14 IGHV genes in IMGT/GENE-DB, corresponding to 23 allelic sequences

    27 May 2015 - CREATION: Dog (Canis lupus familiaris) IGHC in IMGT/GENE-DB, IMGT/LIGM-DB and IMGT Web resources

    • Addition of 7 IGHC genes in IMGT/GENE-DB, corresponding to 10 allelic sequences

    03 April 2015 - UPDATE: Human (Homo sapiens) IGKV in IMGT/LIGM-DB, IMGT/GENE-DB and IMGT Web resources

    • Update of IMGT gene name in IMGT/LIGM-DB, IMGT/GENE-DB and IMGT Web resources of 5 IGKV genes :
      • The IMGT reference sequence L19271 previously designated as IGKV3-NL4, have been now assigned to the IMGT allele of IGHV3D-11*03
      • The IMGT reference sequence L19272 previously designated as IGKV3-NL5, have been now assigned to the IMGT allele of IGHV3D-20*02 which is ORF
      • The IMGT reference sequence L37728, L37727 and L37730 previously designated as IGKV3-NL1, IGKV3-NL2 and IGKV3-NL3 respectively, have been now deleted because sequences are partial and unmapped, and their genomic origin could not be ascertained.

    06 March 2015 - CREATION: Platypus (Ornithorhynchus anatinus) IGH in IMGT/GENE-DB, IMGT/LIGM-DB and IMGT Web resources

    • Addition of 69 IGHV genes in IMGT/GENE-DB, corresponding to 69 allelic sequences
    • Addition of 3 IGHD genes in IMGT/GENE-DB, corresponding to 3 allelic sequences
    • Addition of 11 IGHJ genes in IMGT/GENE-DB, corresponding to 11 allelic sequences
    • Addition of 8 IGHC genes in IMGT/GENE-DB, corresponding to 14 allelic sequences

    16 February 2015 - UPDATE: Human (Homo sapiens) IGKV in IMGT/GENE-DB, IMGT/LIGM-DB and IMGT Web resources

    • Addition of 11 IGKV genes in IMGT/GENE-DB, corresponding to 11 allelic sequences : IGKV1-6*02, IGKV1-17*03, IGKV1D-8*02, IGKV1D-8*03, IGKV1D-13*02, IGKV1D-42*02, IGKV2D-26*03, IGKV3D-11*02, IGKV3D-15*03, IGKV6-21*02 and IGKV6D-21*02

    09 February 2015 - UPDATE: Human (Homo sapiens) IGL in IMGT/GENE-DB, IMGT/LIGM-DB and IMGT Web resources

    • Addition of 4 IGLV genes in IMGT/GENE-DB, corresponding to 4 allelic sequences : IGLV5-45*04, IGLV5-48*02, IGLV6-57*02 and IGLV11-55*02
    • Addition of 1 IGLC gene in IMGT/GENE-DB, corresponding to 1 allelic sequence : IGLC7*03

    2014

    19 December 2014 - CREATION: Pig (Sus scrofa) IGH in IMGT/GENE-DB, IMGT/LIGM-DB and IMGT Web resources

    • Addition of 21 IGHV genes in IMGT/GENE-DB, corresponding to 23 allelic sequences
    • Addition of 4 IGHD genes in IMGT/GENE-DB, corresponding to 5 allelic sequences
    • Addition of 5 IGHJ genes in IMGT/GENE-DB, corresponding to 6 allelic sequences
    • Addition of 12 IGHC genes in IMGT/GENE-DB, corresponding to 31 allelic sequences

    11 December 2014 - UPDATE: Mouse (Mus musculus) IGHV in IMGT/LIGM-DB, IMGT/GENE-DB and IMGT Web resources

    • Update of IMGT gene name in IMGT/LIGM-DB, IMGT/GENE-DB and IMGT Web resources of 3 IGHV genes :
      • The IMGT reference sequence AJ851868 (Strain: 129/Sv) previously designated as IGHV2-9-1, have been now assigned to the IMGT reference sequence of IGHV2-9-2
      • The IMGT sequence from the literature AC160985 (Strain: C57BL/6) have been now assigned to the IMGT reference sequence of IGHV2-9-1
      • The IMGT sequence from the literature U53526 (Strain: BALB/c) previously designated as IGHV2-9-1 have been now assigned to the sequence from the literature of IGHV2-9*02

    21 November 2014 - CREATION: Rhesus monkey (Macaca mulatta) IGL in IMGT/GENE-DB, IMGT/LIGM-DB and IMGT Web resources

    • Addition of 151 IGLV genes in IMGT/GENE-DB, corresponding to 161 allelic sequences
    • Addition of 6 IGLJ genes in IMGT/GENE-DB, corresponding to 6 allelic sequences
    • Addition of 9 IGLC genes in IMGT/GENE-DB, corresponding to 9 allelic sequences

    29 September 2014 - CREATION: Rhesus monkey (Macaca mulatta) IGK in IMGT/GENE-DB, IMGT/LIGM-DB and IMGT Web resources

    • Addition of 118 IGKV genes in IMGT/GENE-DB, corresponding to 118 allelic sequences
    • Addition of 5 IGKJ genes in IMGT/GENE-DB, corresponding to 5 allelic sequences
    • Addition of 1 IGKC gene in IMGT/GENE-DB, corresponding to 1 allelic sequence

    04 February 2014 - CREATION: Human (Homo sapiens) IGHV in IMGT/GENE-DB

    1. Addition of IGHV3-23D*01 in IMGT/GENE-DB

    27 January 2014 - UPDATE: Human (Homo sapiens) IGHV in IMGT/GENE-DB

    1. Update of IMGT gene name in IMGT/GENE-DB : The sequences previously designated as IGHV5-a have been assigned to the definitive IMGT gene name IGHV5-10-1

    2013

    28 November 2013 - UPDATE: Human (Homo sapiens) IGHV in IMGT/GENE-DB

    1. Update of IMGT gene name in IMGT/GENE-DB of 3 IGHV genes : The sequences previously designated as IGHV1-c, IGHV1-f and IGHV3-d have been assigned to the definitive IMGT gene names IGHV1-38-4, IGHV1-69-2 and IGHV3-38-3, respectively

    23 October 2013 - UPDATE: Human (Homo sapiens) IGHV and IGKV in IMGT/GENE-DB

    1. Update of IMGT gene name in IMGT/GENE-DB of 2 IGHV genes : The sequences previously designated as IGHV3-h and IGHV4-b have been assigned to the definitive IMGT gene names IGHV3-69-1 and IGHV4-38-2, respectively
    2. Update of IMGT gene name in IMGT/GENE-DB of an IGKV orphon gene : The sequences previously designated as IGKV1/OR-1 have been assigned to the definitive IMGT gene name IGKV1/OR2-1

    17 September 2013 - CREATION: Human (Homo sapiens) TRBV in IMGT/GENE-DB

    1. Addition of a new TRBV gene in IMGT/GENE-DB : TRBVC

    13 September 2013 - CREATION: Human (Homo sapiens) IGKV orphons in IMGT/GENE-DB

    1. Addition of IGKV1/OR9-1*01 in IMGT/GENE-DB

    24 May 2013 - CREATION: Human (Homo sapiens) IGHV in IMGT/GENE-DB

    1. Addition of 4 IGHV genes in IMGT/GENE-DB, corresponding to 5 allelic sequences : IGHV1-69D*01, IGHV2-70D*04, IGHV2-70D*14, IGHV3-43D*01, IGHV3-64D*06

    13 March 2013 - CREATION: Human (Homo sapiens) IGKV orphons in IMGT/GENE-DB

    1. Addition of IGKV1/OR10-1*01 in IMGT/GENE-DB

    2012

    27 September 2012 - CREATION: Alignments of alleles: Rabbit (Oryctolagus cuniculus) IGL in IMGT Repertoire (IG and TR)

    1. Creation of Alignments of alleles: Rabbit (Oryctolagus cuniculus) IGLV
    2. Creation of Alignments of alleles: Rabbit (Oryctolagus cuniculus) IGLJ
    3. Creation of Alignments of alleles: Rabbit (Oryctolagus cuniculus) IGLC

    24 September 2012 - CREATION: Gene table: Rabbit (Oryctolagus cuniculus) IGLV in IMGT Repertoire (IG and TR)

    1. Addition of the new genes IGLV, localized on chromosome 21 in the Gene table: Rabbit (Oryctolagus cuniculus) IGLV.

    12 September 2012 - CREATION: Rabbit (Oryctolagus cuniculus) IGL in IMGT/GENE-DB

    1. Addition of 43 IGLV genes in IMGT/GENE-DB, corresponding to 43 allelic sequences
    2. Addition of 4 IGLJ genes in IMGT/GENE-DB, corresponding to 4 allelic sequences
    3. Addition of 6 IGLC genes in IMGT/GENE-DB, corresponding to 8 allelic sequences.

    12 September 2012 - UPDATE of IMGT/V-QUEST (Version 3.2.29)

    1. Addition of 43 IGLV genes in IMGT/GENE-DB, corresponding to 43 allelic sequences
    2. Addition of 4 IGLJ genes in IMGT/GENE-DB, corresponding to 4 allelic sequences
    3. Addition of 6 IGLC genes in IMGT/GENE-DB, corresponding to 8 allelic sequences.

    10 September 2012 - UPDATE: Gene table: Rabbit (Oryctolagus cuniculus) IGLJ and IGLC in IMGT Repertoire (IG and TR)

    1. Addition of the genes IGLJ, localized on chromosome 21 in the Gene table: Rabbit (Oryctolagus cuniculus) IGLJ
    2. Addition of the genes IGLC, localized on chromosome 21 in the Gene table: Rabbit (Oryctolagus cuniculus) IGLC

    23 February 2012 - CREATION: Rhesus Monkey (Macaca Mulatta) TRB in IMGT/GENE-DB

    1. Addition of 72 TRBV genes in IMGT/GENE-DB, corresponding to 72 allelic sequences
    2. Addition of 2 TRBD genes in IMGT/GENE-DB, corresponding to 2 allelic sequences
    3. Addition of 14 TRBJ genes in IMGT/GENE-DB, corresponding to 17 allelic sequences
    4. Addition of 2 TRBC genes in IMGT/GENE-DB, corresponding to 2 allelic sequences.

    23 February 2012 - UPDATE of IMGT/V-QUEST (Version 3.2.24)

    1. Addition of 72 Rhesus Monkey (Macaca Mulatta) TRBV genes in IMGT/V-QUEST, corresponding to 72 allelic sequences
    2. Addition of 2 Rhesus Monkey (Macaca Mulatta) TRBD genes in IMGT/V-QUEST, corresponding to 2 allelic sequences
    3. Addition of 14 Rhesus Monkey (Macaca Mulatta) TRBJ genes in IMGT/V-QUEST, corresponding to 17 allelic sequences

    2011

    22 December 2011 - UPDATE of IMGT/CLL-DB (Version 1.2.0)

    1. Update of the annotations of the IMGT/CLL-DB sequences with the last version of IMGT/V-QUEST (IMGT/V-QUEST programme version: 3.2.22; IMGT/V-QUEST reference directory release: 201148-5).

    26 April 2011 - CREATION: Gene exon/intron organization: Norway rat (Rattus norvegicus) IGHC, in IMGT Repertoire (IG and TR)

    1. Creation of Gene exon/intron organization: Norway rat (Rattus norvegicus) immunoglobulin constant genes.

    14 April 2011 - UPDATE: Locus representation: House mouse (Mus musculus) TRA/TRD

    1. Insertion of 300 kb between TRAV15D-3 and TRAV7-2 in Locus representation: House mouse (Mus musculus) TRA/TRD, that corresponds to a triplication of part of the TRAV genes for strain C57BL/6J.

    23 February 2011 - UPDATE: Colliers de Perles: House mouse (Mus musculus) TRAV

    1. Creation of Colliers de Perles of 34 triplicated genes in the Colliers de Perles: House mouse (Mus musculus) TRAV for strain C57BL/6J.

    03 February 2011 - UPDATE: Gene table: House mouse (Mus musculus) TRAV in IMGT Repertoire (IG and TR)

    1. Addition of 34 triplicated genes in the Gene table: House mouse (Mus musculus) TRAV for strain C57BL/6J.

    14 January 2011 - IMGT/CLL-DB is on-line

    1. IMGT/CLL-DB Query page (bylaws) is on-line in IMGT sequence databases

    10 January 2011 - UPDATE of IMGT/GeneFrequency (Version 1.1.0)

    1. Improvement of IMGT/GeneFrequency Search page
    2. IMGT/GeneFrequency smaller, faster and more user-friendly:
      • Use of AJAX (Asynchronous JavaScript and XML) to create interactive web application and to generate drop-down lists dynamically, without interfering with the display and behavior of the existing page.

    2010

    01 December 2010 - UPDATE of IMGT/GeneFrequency (Version 1.0.1)

    1. Improvement of IMGT/GeneFrequency Search page
    2. Addition of a summary in the result page
      • Results summary (Number of sequences per locus and per gene) is available for all IMGT/LIGM-DB rearranged sequences.
        For each locus, Group and gene, the number of IMGT/LIGM-DB sequences with rearranged Gene is indicated.

    22 November 2010 - IMGT/HighV-QUEST is on line

    1. IMGT/HighV-QUEST is on line for batches of up to 150 000 IG and TR nucleotide sequences per run
    2. User support sections (Help, FAQ and Documentation) are online and accessible from IMGT/HighV-QUEST page

    22 September 2010 - CREATION: Alignments of alleles: Rabbit (Oryctolagus cuniculus) IGH in IMGT Repertoire (IG and TR)

    1. Creation of Alignments of alleles: Rabbit (Oryctolagus cuniculus) IGH V-REGION
    2. Creation of Alignments of alleles: Rabbit (Oryctolagus cuniculus) IGH D-REGION
    3. Creation of Alignments of alleles: Rabbit (Oryctolagus cuniculus) IGH J-REGION
    4. Creation of Alignments of alleles: Rabbit (Oryctolagus cuniculus) IGH C-REGION

    15 July 2010 - CREATION: Protein displays: Rabbit (Oryctolagus cuniculus) IGH in IMGT Repertoire (IG and TR)

    1. Creation of Protein displays: Rabbit (Oryctolagus cuniculus) IGH V-REGION
    2. Creation of Protein displays: Rabbit (Oryctolagus cuniculus) IGH D-REGION
    3. Creation of Protein displays: Rabbit (Oryctolagus cuniculus) IGH J-REGION
    4. Creation of Protein displays: Rabbit (Oryctolagus cuniculus) IGH C-REGION

    29 June 2010 - UPDATE: Gene table: Human (Homo sapiens) IGHV orphons in IMGT Repertoire (IG and TR)

    1. Addition of a new orphon gene IGHV1/OR21-1, localized on chromosome 21 in the Gene table: Human (Homo sapiens) IGHV orphons.

    28 May 2010 - UPDATE: Human (Homo sapiens) IGH orphon in IMGT/GENE-DB

    1. Addition of a new Chromosomal orphon set: IGHV/OR21, localized on chromosome 21 in IMGT/GENE-DB
    2. Addition of a new orphon gene: IGHV1/OR21-1 in IMGT/GENE-DB

    7-11 May 2010 - CREATION: Alignments of alleles: Rabbit (Oryctolagus cuniculus) IGK in IMGT Repertoire (IG and TR)

    1. Creation of Alignments of alleles: Rabbit (Oryctolagus cuniculus) IGK V-REGION
    2. Creation of Alignments of alleles: Rabbit (Oryctolagus cuniculus) IGK J-REGION
    3. Creation of Alignments of alleles: Rabbit (Oryctolagus cuniculus) IGK C-REGION

    22 April 2010 - CREATION: IMGT-ONTOLOGY at the NCBO BioPortal

    1. IMGT-ONTOLOGY formalized in OWL at NCBO BioPortal (IDENTIFICATION axiom)

    15 April 2010 - UPDATE: Rabbit (Oryctolagus cuniculus) IGKC1 in IMGT/GENE-DB

    1. Creation of a new allele : IGKC1*09 (K01359) in IMGT/GENE-DB
    2. UPDATE of functionality of IGKC1*05 (X03050): initially F, now is ORF in IMGT/GENE-DB

    12 April 2010 - CREATION: Sequences from Kabat in IMGT/2Dstructure-DB

    1. Addition of 146 Human (Homo sapiens) sequences from Kabat in IMGT/2Dstructure-DB
    2. Addition of 184 Mouse (Mus musculus) sequences from Kabat in IMGT/2Dstructure-DB
    3. Addition of 15 Rabbit (Oryctolagus cuniculus) sequences from Kabat in IMGT/2Dstructure-DB

    12 April 2010 - UPDATE: Gene table: Rabbit (Oryctolagus cuniculus) IGKC

    1. Addition of 1 new allele IGKC1*09 (K01359) in Gene table: Rabbit (Oryctolagus cuniculus) IGKC
    2. UPDATE of functionality of IGKC1*05 (X03050): initially F, now is ORF.

    16 February 2010 - CREATION: Gene Table: Rabbit (Oryctolagus cuniculus) IGH in IMGT Repertoire (IG and TR)

    1. Creation of Gene Table: Rabbit (Oryctolagus cuniculus) IGH V-REGION
    2. Creation of Gene Table: Rabbit (Oryctolagus cuniculus) IGH D-REGION
    3. Creation of Gene Table: Rabbit (Oryctolagus cuniculus) IGH J-REGION
    4. Creation of Gene Table: Rabbit (Oryctolagus cuniculus) IGH C-REGION

    16 Fevrier 2010 - Creation: Rabbit (Oryctolagus cuniculus) IGH in IMGT/GENE-DB

    1. Addition of 65 IGHV genes in IMGT/GENE-DB, corresponding to 65 allelic sequences
    2. Addition of 11 IGHD genes in IMGT/GENE-DB, corresponding to 11 allelic sequences
    3. Addition of 06 IGHJ genes in IMGT/GENE-DB, corresponding to 11 allelic sequences
    4. Addition of 16 IGHC genes in IMGT/GENE-DB, corresponding to 27 allelic sequences

    15 February 2010 - CREATION: Protein displays: Rabbit (Oryctolagus cuniculus) IGKJ and IGKC in IMGT Repertoire (IG and TR)

    1. Creation of Protein display: Rabbit (Oryctolagus cuniculus) IGK J-REGIONs in IMGT repertoire
    2. Creation of Protein display: Rabbit (Oryctolagus cuniculus) IGK C-REGIONs in IMGT repertoire

    05 February 2010 - UPDATE: Protein display: Rabbit (Oryctolagus cuniculus) IGKV in IMGT Repertoire (IG and TR)

    1. Addition of the new Protein display rules in the Protein display: Rabbit (Oryctolagus cuniculus) IGK V-REGIONs

    01 February 2010 - UPDATE: Gene Table: Rabbit (Oryctolagus cuniculus) IGKV in IMGT Repertoire (IG and TR)

    1. Addition of "Allele name", "Strain", "Clone names", "Position in the sequence" columns in Gene table: Rabbit (Oryctolagus cuniculus) IGKV in IMGT Repertoire

    29 January 2010 - UPDATE: Rabbit (Oryctolagus cuniculus) IGKV in IMGT/GENE-DB

    1. Addition of 68 IGKV genes in IMGT/GENE-DB, corresponding to 70 allelic sequences

    2009

    23 December 2009 - CREATION: Alignments of alleles: Dog Canis lupus familiaris TRGC in IMGT Repertoire (IG and TR)

    1. Creation of Alignments of alleles: Dog Canis lupus familiaris TRG C-REGIONs

    15 December 2009 - CREATION: Alignments of alleles: Dog Canis lupus familiaris TRGV in IMGT Repertoire (IG and TR)

    1. Creation of Alignments of alleles: Dog Canis lupus familiaris TRG V-REGIONs

    11 December 2009 - CREATION: Alignments of alleles: Dog Canis lupus familiaris TRGJ in IMGT Repertoire (IG and TR)

    1. Creation of Alignments of alleles: Dog Canis lupus familiaris TRG J-REGIONs

    04 December 2009 - IMGT/mAb-DB is on-line

    1. IMGT/mAb-DB Query page is on-line in IMGT monoclonal antibodies database
    2. IMGT/mAb-DB Documentation is on-line in IMGT monoclonal antibodies database

    30 November 2009 - UPDATE: Protein display: Norway rat (Rattus norvegicus) IGHC in IMGT Repertoire (IG and TR)

    1. Addition of amino acids resulting from the splicing in the Protein display: Norway rat (Rattus norvegicus) IGH C-REGIONs in IMGT Repertoire

    25 November 2009 - CREATION: Protein displays: Dog (Canis lupus familiaris) TRGJ and TRGC in IMGT Repertoire (IG and TR)

    1. Creation of Protein display: Dog (Canis lupus familiaris) TRG J-REGIONs in IMGT Repertoire
    2. Creation of Protein display: Dog (Canis lupus familiaris) TRG C-REGIONs in IMGT Repertoire

    02 November 2009 - UPDATE of IMGT/3Dstructure-DB (Version 4.0.0) and Related other IMGT® resources

    1. Update of Web interfaces for IMGT/3Dstructure-DB database and IMGT/DomainDisplay, IMGT/DomainGapAlign, IMGT/Collier-de-Perles and IMGT/StructuralQuery tools.
      • Improvements of the web interfaces (5 types of search, linked lists, ...)
      • Improvement of Sequence in IMGT format in the IMGT/3Dstructure-DB card, 'Chain sequence' section:
        • Plain (FASTA format)
        • With regions and domains
        • With FR-IMGT and CDR-IMGT
        • With cysteins involved in disulfide bridges and with N-glycosylation sites (INN entries)
        • With N-glycosylation sites (PDB entries)
      • Update of the IMGT domain reference directory from the IMGT/GENE-DB database. Addition of 163 Rattus norvegicus IGKV genes and alleles (136 functional, 6 ORF and 21 pseudogenes).
      • Update of IMGT/DomainGapAlign tool:
        • Improvement of the Web interface and the display of results
        • Highlight of the amino acids changes between the closest germline V-REGION (for 'V') or C-DOMAIN (for 'C) and the sequences submitted by users
        • IMGT mutation and AA change description (see IMGT amino acid classes)
        • Results summary (corresponding to the closest genes and alleles) with: CDR-IMGT lengths, Number of different AA in CDR-IMGT (CDR3 not included), FR-IMGT lengths, Number of different AA in FR-IMGT, Number of AA class changes and List of AA class changes.
      • Update of 3D visualization with Jmol:
        • The whole chain sequences are displayed in a box, indicating th chain ID, the IMGT Receptor description and the lenght of the chain. Users just have to click on a residue in sequences to visualize it in the Jmol applet (wireframe by default)
        • The interface is now composed of 5 sub-menus: Selection, View, coloration, IMGT and Paratope/epitope
        • Go to 3D visualization with Jmol for more details.

    20 November 2009 - CREATION: Gene tables: Dog (Canis lupus familiaris) TRGJ and TRGC in IMGT Repertoire (IG and TR)

    1. Creation of the Gene table: Dog (Canis lupus familiaris) TRGJ in IMGT Repertoire
    2. Creation of the Gene table: Dog (Canis lupus familiaris) TRGC in IMGT Repertoire

    21 October 2009 - UPDATE: Norway rat (Rattus norvegicus) IGKV, J and C in IMGT/GENE-DB

    1. Addition of 163 IGKV gapped sequences IMGT/GENE-DB
    2. Addition of 7 IGKJ sequences IMGT/GENE-DB
    3. Addition of 2 IGKC gapped sequences IMGT/GENE-DB

    17 July 2009 - UPDATE: Dog (Canis lupus familiaris) TRGC in IMGT/GENE-DB

    1. Addition of artificially spliced exon(s) for functional and ORF TRGC genes in IMGT/GENE-DB

    02 June 2009 - UPDATE of IMGT/Education

    1. Creation new pages IMGT Education Tutorials MHC

    13 May 2009 - UPDATE: Norway rat (Rattus norvegicus) IGHC in IMGT/GENE-DB

    1. Addition of artificially spliced exon(s) for functional and ORF IGHC genes in IMGT/GENE-DB

    07 May 2009 - Update of IMGT Repertoire (MH) and IMGT Repertoire (RPI)

    1. IMGT Repertoire MHC: addition of Oncorhynchus mykiss (rainbow trout) MHC-I and MHC-II genes.
    2. IMGT Repertoire RPI: update of MICA alleles, update of RPI entries.

    29 April 2009 - CREATION: Protein display: Dog (Canis lupus familiaris) TRG V-REGIONs in IMGT Repertoire (IG and TR)

    1. Creation of the Protein display: Dog (Canis lupus familiaris) TRG V-REGIONs in IMGT Repertoire

    27 April 2009 - UPDATE of IMGT/V-QUEST (Version 3.2.0)

    1. Addition of "Export in Excel file output : the "Detailed view" results are recorded in 11 sheets.
    2. Query Page : the option "2. Alignment for D-GENE" of "A. Detailed view" is no more selected by default.
    3. A. Detailed view results:
      • In "Result summary", D-GENE(s) and allele(s) are shown only if identified by IMGT/JunctionAnalysis"
      • In "4. Results of IMGT/JunctionAnalysis"
        • In case of unmutated IGK or IGL V-GENE (no mutations in FR1-IMGT, CDR1-IMGT, FR2-IMGT, CDR2-IMGT and FR3-IMGT), the number of allowed mutations in 3'V-REGION and 5'J-REGION has been set to 2.
        • The number of accepted D-GENE in the junction is indicated
      • In "10. V-REGION mutation statistics": update of the presentation of the amino acid table
      • In "11. V-REGION mutation hot spots": the tables are displayed as follow: (a/t)a, t(a/t), (a/g)g(c/t)(a/t), (a/t)(a/g)c(c/t)
      • In "13. Sequences of V-, V-J- or V-D-J- REGION ('nt' and 'AA') with gaps in FASTA": the V-J- or V-D-J- REGION amino acid sequences are shown in red for unproductive sequences with an out-of-frame junction.
    4. "Export in text" output : elimination of HTML tags (except for option "5. V-REGION protein display with colored AA according to the AA IMGT Classes" of Synthesis View).
    5. "B. Synthesis view results": in "7. V-REGION most frequently occurring AA per position and per FR-IMGT and CDR-IMGT", a message is added when, at a given position, 100% of the analyzed sequences have the same AA change.
    6. Update of IMGT gap positions in Homo sapiens IGHV3-72*02.

    2008

    5 December 2008 - UPDATE: IMGT/GENE-DB

    1. Sequences in FASTA format :update of the header: The FASTA header contains 15 fields separated by '|':
      • IMGT/LIGM-DB accession number(s)
      • gene and allele name
      • species
      • functionality
      • exon(s), region name(s), or extracted label(s)
      • start and end positions in the IMGT/LIGM-DB accession number(s)
      • number of nucleotides in the IMGT/LIGM-DB accession number(s)
      • codon start, or 'NR' (not relevant) for non coding labels
      • +n: number of nucleotides (nt) from an upstream donor exon, added in 5' of an exon, to obtain a complete first codon (for C-GENE exons if splicing frame 1 or 2)
      • -n: number of nucleotides (nt) deleted in 3' of an exon, to obtain a complete last codon (for C-GENE exons if splicing frame 1 or 2)
      • +n, -n, and/or nS: number of added, deleted, and/or substituted nucleotides to correct sequencing errors, or 'not corrected' if non corrected sequencing errors
      • number of amino acids (AA): this field indicates that the sequence is in amino acids
      • number of characters in the sequence: nt (or AA)+IMGT gaps=total
      • partial (if it is)
      • reverse complementary (if it is)
    2. Update of the IMGT/GENE-DB Direct links page.
    3. Update of the IMGT/GENE-DB entry.

    3 to 5 December 2008 - CREATION: Gene tables: Norway rat (Rattus norvegicus) IGLV, IGLJ and IGLC in IMGT Repertoire (IG and TR)

    1. Creation of Gene table: Norway rat (Rattus norvegicus) IGLV in IMGT Repertoire
    2. Creation of Gene table: Norway rat (Rattus norvegicus) IGLC in IMGT Repertoire
    3. Creation of Gene table: Norway rat (Rattus norvegicus) IGLJ in IMGT Repertoire

    28 November 2008 - UPDATE: Norway rat (Rattus norvegicus) IGLC in IMGT/GENE-DB

    1. Addition of IGLC4 gene sequence and update of IGLC reference sequences in IMGT/GENE-DB

    24 November 2008 - UPDATE: Norway rat (Rattus norvegicus) IGLJ in IMGT/GENE-DB

    1. Addition of IGLJ4 gene sequence and update of IGLJ reference sequences in IMGT/GENE-DB

    18 November 2008 - CREATION: IMGT/2Dstructure-DB

    IMGT/2Dstructure-DB, a database of monoclonal antibodies and -cept. The data source is the International Nonproprietary Names (INN) programme of the World Health Organization (WHO).

    1. Integration of 39 INN entries ( 34 monoclonal antibodies and 5 -cept) in IMGT/2Dstructure-DB.
    2. The IMGT/2Dstructure-DB INN card can be obtained searching by INN number and contains IMGT chain and domain details, renumbered IMGT file and INN definitions and properties.

    1 October 2008 - UPDATE: Gene table: Rabbit (Oryctolagus cuniculus) IGKC in IMGT Repertoire (IG and TR)

    1. Addition of "Allele name", "Strain", "Clone names", "Position in the sequence" columns in Gene table: Rabbit (Oryctolagus cuniculus) IGKC in IMGT Repertoire

    1 October 2008 - UPDATE: Rabbit (Oryctolagus cuniculus) IGKJ and IGKC genes in IMGT/GENE-DB

    1. Addition of 2 Rabbit (Oryctolagus cuniculus) IGKC genes in IMGT/GENE-DB, corresponding to 12 allelic sequences
    2. Addition of 8 Rabbit (Oryctolagus cuniculus) IGKJ genes in IMGT/GENE-DB, corresponding to 19 allelic sequences

    30 September 2008 - UPDATE: Gene table: Rabbit (Oryctolagus cuniculus) IGKJ in IMGT Repertoire (IG and TR)

    1. Addition of "Allele name", "Strain", "Clone names", "Position in the sequence" columns in Gene table: Rabbit (Oryctolagus cuniculus) IGKJ in IMGT Repertoire

    16 September 2008 - UPDATE: IMGT Aide-Memoire of Splicing sites in IMGT Web resources

    1. Update the Splicing sites table in IMGT Aide-mémoire
    2. Modification of the "Splicing frame" and "IMGT notes" paragraphes in IMGT Aide-mémoire

    5 September 2008 - CREATION: FR-IMGT lengths for comparison of humanized antibodies in IMGT Repertoire (IG and TR)

    1. Creation of FR-IMGT lengths for comparison of humanized antibodies in IMGT Repertoire

    22 August 2008 - CREATION: Protein displays: Rabbit (Oryctolagus cuniculus) IGLJ and IGLC in IMGT Repertoire (IG and TR)

    1. Creation of Protein display: Rabbit (Oryctolagus cuniculus) IGL J-REGIONs in IMGT Repertoire
    2. Creation of Protein display: Rabbit (Oryctolagus cuniculus) IGL C-REGIONs in IMGT Repertoire

    21 August 2008 - CREATION: Protein displays: Norway rat (Rattus norvegicus) IGHC in IMGT Repertoire (IG and TR)

    1. Creation of Protein display: Norway rat (Rattus norvegicus) IGH C-REGIONs in IMGT Repertoire

    12 August 2008 - UPDATE: Norway rat (Rattus norvegicus) IGHC in IMGT/GENE-DB

    1. Addition of IGHC gapped sequences in IMGT/GENE-DB

    12 August 2008 - CREATION: Gene tables: Rabbit (Oryctolagus cuniculus) IGLJ and IGLC in IMGT Repertoire (IG and TR)

    1. Creation of Gene table: Rabbit (Oryctolagus cuniculus) IGLJ in IMGT Repertoire
    2. Creation of Gene table: Rabbit (Oryctolagus cuniculus) IGLC in IMGT Repertoire

    12 August 2008 - UPDATE: Rabbit (Oryctolagus cuniculus) IGLJ and IGLC in IMGT/GENE-DB

    1. Addition of 2 IGLJ sequences in IMGT/GENE-DB
    2. Addition of 6 IGLC gapped sequences in IMGT/GENE-DB

    8 August 2008 - CREATION: Correspondence between numberings for CDR of different lengths (horizontal display per locus) in IMGT Scientific chart

    1. Creation of Correspondence between numberings for CDR of different lengths (horizontal display per locus)

    30 July 2008 - CREATION: Gene table: Black rat (Rattus rattus) IGHC in IMGT Repertoire (IG and TR)

    1. Creation of Germline gene table: Black rat (Rattus rattus) IGHC in IMGT Repertoire

    28 July 2008 - CREATION: Gene table: Norway rat (Rattus norvegicus) IGHC in IMGT Repertoire (IG and TR)

    1. Creation of Germline gene table: Norway rat (Rattus norvegicus) IGHC in IMGT Repertoire

    24 July 2008 - UPDATE: Gene table: Norway rat (Rattus norvegicus) IGHV in IMGT Repertoire (IG and TR)

    1. Update of IMGT notes of the Germline gene table: Norway rat (Rattus norvegicus) IGHV in IMGT Repertoire

    18 June 2008 - CREATION: Alignments of alleles: Norway rat (Rattus norvegicus) IGHV in IMGT Repertoire (IG and TR)

    1. Creation of Alignments of alleles: Norway rat (Rattus norvegicus) IGHV in IMGT Repertoire

    4 June 2008 - CREATION: Alignments of alleles: Norway rat (Rattus norvegicus) IGHJ in IMGT Repertoire (IG and TR)

    1. Creation of Alignments of alleles: Norway rat (Rattus norvegicus) IGHJ in IMGT Repertoire

    3 June 2008 - CREATION: Germline gene table: Norway rat (Rattus norvegicus) IGHJ in IMGT Repertoire (IG and TR)

    1. Creation of Germline gene table: Norway rat (Rattus norvegicus) IGHJ in IMGT Repertoire

    3 June 2008 - CREATION: Protein displays: Norway rat (Rattus norvegicus) IGHJ in IMGT Repertoire (IG and TR)

    1. Creation of Protein display: Norway rat (Rattus norvegicus) IGH J-REGIONs in IMGT Repertoire

    31 March 2008 - UPDATE: Norway rat (Rattus norvegicus) IGL locus in IMGT/GENE-DB

    1. Addition of 3 IGLJ sequences IMGT/GENE-DB
    2. Addition of 3 IGLC sequences IMGT/GENE-DB

    6 March 2008 - CREATION: Protein displays: Norway rat (Rattus norvegicus) IGHV in IMGT Repertoire (IG and TR)

    1. Creation of Protein display: Norway rat (Rattus norvegicus) IGH V-REGIONs in IMGT Repertoire

    6 March 2008 - ENHANCEMENT of IMGT/GENE-DB

    1. Addition of table of annotated IMGT/3Dstructure-DB structures for each IMGT/GENE-DB gene

    27 February 2008 - CREATION: Protein displays and Alignment of alleles: Norway rat (Rattus norvegicus) IGHD in IMGT Repertoire (IG and TR)

    1. Creation of Alignment of alleles: Norway rat (Rattus norvegicus) IGHD (overview) in IMGT Repertoire

    26 February 2008 - CREATION: Protein displays: Norway rat (Rattus norvegicus) IGLV in IMGT Repertoire (IG and TR)

    1. Creation of Protein display: Norway rat (Rattus norvegicus) IGL V-REGIONs in IMGT Repertoire

    25 February 2008 - UPDATE: Norway rat (Rattus norvegicus) IGLV in IMGT/GENE-DB

    1. Addition of 7 IGLV gapped sequences IMGT/GENE-DB

    19 February 2008 - ENHANCEMENT of IMGT/V-QUEST (Version 3.0.0)

    1. From this release, gaps in CDR1-IMGT and CDR2-IMGT are placed at the top of the loops

    19 February 2008 - CREATION: Germline gene table: Norway rat (Rattus norvegicus) IGHD in IMGT Repertoire (IG and TR)

    1. Creation of Germline gene table: Norway rat (Rattus norvegicus) IGHD in IMGT Repertoire

    8 February 2008 - UPDATE of IMGT/V-QUEST (Version 2.5.1)

    1. Addition of Human (Homo sapiens) IGHV3-49*04 IGHV3-49*05 IGHV4-39*07 alleles

    29 January 2008 - ENHANCEMENT of IMGT/V-QUEST (Version 2.5.0)

    1. Addition of an option in Advanced parameters: "Search for insertions and deletions"
    2. Update of Norway rat (Rattus norvegicus) IGHV reference directory
    3. Update of Mouse (Mus musculus) IGHV reference directory

    25 January 2008 - CREATION: Germline gene table: Norway rat (Rattus norvegicus) IGHV in IMGT Repertoire (IG and TR)

    1. Creation of Germline gene table: Norway rat (Rattus norvegicus) IGHV in IMGT Repertoire

    10 January 2008 - ENHANCEMENT of IMGT/GENE-DB

    1. Addition of table of annotated IMGT/LIGM-DB rearranged genomic DNA sequences for each IMGT/GENE-DB gene

    2007

    15 November 2007 - UPDATE: Norway rat (Rattus norvegicus) IGHV in IMGT/GENE-DB

    1. Addition of 161 Norway rat (Rattus norvegicus) IGHV genes in IMGT/GENE-DB

    3 October 2007 - UPDATE: Norway rat (Rattus norvegicus) IGHV and IGHC in IMGT/GENE-DB

    1. Addition of 94 Norway rat (Rattus norvegicus) IGHV genes in IMGT/GENE-DB
    2. Addition of 8 Norway rat (Rattus norvegicus) IGHC genes in IMGT/GENE-DB

    31 July 2007 - UPDATE: Mouse (Mus musculus) IGHV in IMGT Repertoire (IG and TR)

    1. Addition of genes: IGHV1-70 to IGHV1-86, IGHV8-15 and IGHV8-16 in Gene table: Mouse (Mus musculus) IGHV
    2. Addition of genes: IGHV1-70 to IGHV1-86, IGHV8-15 and IGHV8-16 in Locus representation: Mouse (Mus musculus) IGH

    26 July 2007 - UPDATE: a new species Norway rat (Rattus norvegicus) in IMGT/V-QUEST

    1. Addition of a new species: Norway rat (Rattus norvegicus) IGH in IMGT/V-QUEST
      • 83 IGHV (belonging to IGHV2 and IGHV5 subgroups)
      • 19 IGHD
      • 4 IGHJ

    20 July 2007 - ENHANCEMENT of IMGT/V-QUEST (Version 2.4.0)

    1. Addition of a new species: Norway rat (Rattus norvegicus) IGH in IMGT/V-QUEST
      • 83 IGHV (test for IGHV2 and IGHV5 subgroups)
      • 19 IGHD
      • 4 IGHJ
    2. Addition of 17 Mouse (Mus musculus) IGHV genes
      • IGHV1-70*01, IGHV1-71*01, IGHV1-72*01, IGHV8-13*01, IGHV1-74*01, IGHV8-14*01, IGHV1-75*01, IGHV1-76*01, IGHV1-77*01, IGHV1-78*01, IGHV1-79*01, IGHV1-80*01, IGHV1-81*01, IGHV1-82*01, IGHV1-83*01, IGHV1-84*01, IGHV1-85*01

    16 July 2007 - CREATION: RPI entries from gene to protein in IMGT Repertoire (RPI)

    1. Creation of IgSF other than IG or TR entries for Human B7, CD2, CD3, CD79, CEACAM1, DSCAM, KIR2DL2, MOG, VPREB, VSIG4
    2. Creation of IgSF other than IG or TR entries for Mouse B7, CD2, CD3, CD4, CD8, CD79, VSIG4
    3. Creation of IgSF other than IG or TR entries for Drosophila melanogaster DSCAM

    6 July 2007 - ENHANCEMENT of IMGT/V-QUEST (Version 2.3.0)

    1. IMGT/V-QUEST has been upgraded with a summary of the IMGT/V-QUEST results, provided in both "Detailed view" and "Synthesis view", at the top of the results.
    2. The "Advanced parameters" section has been added in the query page.
    3. In frame pseudogenes have been added in the IMGT/V-QUEST reference directory sets.

    For more information on the IMGT/V-QUEST Version 2.3.0 improvements, see IMGT/V-QUEST Documentation.

    18 June 2007 - CREATION: Germline gene table: Axolotl (Ambystoma mexicanum) TRAV in IMGT Repertoire (IG and TR)

    1. Creation of Germline gene table: Axolotl (Ambystoma mexicanum) TRAV in IMGT Repertoire

    18 June 2007 - CREATION: Gene Positions

    1. Creation of Gene Positions in IMGT Repertoire

    19 April 2007 - CREATION: Leader sequence logos of the mouse IG and TR V genes

    1. Creation of V-REGION sequence logos of the mouse IG and TR in IMGT Repertoire

    18 April 2007 - CREATION: V-REGION sequence logos of the mouse IG and TR

    Creation of V-REGION sequence logos of the mouse IG and TR in IMGT Repertoire

    1. V-REGION sequence logos
    2. V-REGION sequence logos for the seven loci
    3. Number of sequences for generating the V-REGION sequence logos for the seven loci

    10 April 2007 - ENHANCEMENT of IMGT/V-QUEST (Version 2.2.0)

    1. IMGT/V-QUEST has been upgraded for the Results of IMGT/JunctionAnalysis.
    2. The IMGT/V-QUEST reference directory has been updated.

    For more information on the IMGT/V-QUEST Version 2.2.0 improvements, see IMGT/V-QUEST Documentation.

    25 March 2007 - UPDATE: IMGT/PRIMER-DB with new functionality : Comparison sequence

    IMGT/PRIMER-DB allows to compare sequences against the IMGT/PRIMER-DB Database. For more information, see IMGT/PRIMER-DB Primer Sequence Comparison in IMGT/PRIMER-DB Documentation.

    15 February 2007 - UPDATE: IMGT/DomainSuperimpose

    1. Possibility of choosing a coordinate file ID in a list

    19 January 2007 - CREATION: V-REGION sequence logos of the human IG and TR

    Creation of V-REGION sequence logos of the human IG and TR in IMGT Repertoire

    1. V-REGION sequence logos
    2. V-REGION sequence logos for the seven loci
    3. Number of sequences for generating the V-REGION sequence logos for the seven loci

    16 January 2007 - CREATION: Recombination signal sequences and logos of the Mouse (Mus musculus) IG and TR V, D and J genes

    Creation of Recombination signals of the Mouse (Mus musculus) IG and TR V, D and J genes in IMGT Repertoire

    1. Recombination signal sequences
    2. Recombination signal sequence logos
    3. Recombination signal sequence logo for the seven loci
    4. Number of sequences for generating the recombination signal sequence logo for the seven loci

    11 January 2007 - UPDATE: Additional levels of classification in OC (Organism Classification) lines of IMGT/LIGM-DB

    1. Additional levels of classification have been added in the OC (Organism Classification) lines of IMGT/LIGM-DB, to follow closely all the levels of the NCBI (National Center for Biotechnology Information) Taxonomy.

    9 January 2007 - CREATION: RFLP alleles and frequencies: Human IGHV

    1. Creation of RFLP alleles and frequencies for Human IGHV1-69 gene in IMGT Repertoire (IG and TR)

    2006

    8 December 2006 - CREATION: Correspondence between the different Mouse (Mus musculus) TRAV subgroup nomenclatures in Correspondence between nomenclatures: Mouse (Mus musculus) TRAV

    1. Creation of Correspondence between the different subgroup nomenclatures, in Correspondence between nomenclatures: Mouse (Mus musculus) TRAV in IMGT Repertoire (IG and TR)

    17 November 2006 - CREATION: Assignment of rearranged cDNAs and gDNAs to germline Mouse (Mus musculus) TRAJ genes

    1. Creation of Assignment of rearranged cDNAs and gDNAs to germline genes: Mouse (Mus musculus) TRAJ in IMGT Repertoire (IG and TR)

    15 November 2006 - ENHANCEMENTof IMGT/V-QUEST (Version 2.1.0)

    IMGT/V-QUEST has been upgraded to provide a Synthesis view of results. For more information on the IMGT/V-QUEST Version 2.1.0 improvements, see IMGT/V-QUEST Documentation.

    07 November 2006 - CREATION: IMGT/DomainGapAlign Documentation

    1. Creation of IMGT/DomainGapAlign Documentation in IMGT structure tools

    31 October 2006 - UPDATE: New IMGT/Phylogene upgraded for multiple sequences and with modified interface

    1. For more information, see improvements in IMGT/Phylogene documentation
    2. Update of the interface
    3. Update of the IG and TR sequences to analyse
    4. Use of PHYLIP 3.66 package

    19 October 2006 - CREATION: Sheep (Ovis aries) TRG

    1. Creation of Chromosomal localization: Sheep (Ovis aries) TRG in IMGT Repertoire (IG and TR)
    2. Creation of Locus representation: Sheep (Ovis aries) TRG in IMGT Repertoire (IG and TR)
    3. Creation of Gene table: Sheep (Ovis aries) TRGJ in IMGT Repertoire (IG and TR)

    28 September 2006 - CREATION: IMGT/DomainSuperimpose

    1. Creation of IMGT/DomainSuperimpose in IMGT structure tools

    28 September 2006 - CREATION: IMGT/Collier-de-Perles

    1. Creation of IMGT/Collier-de-Perles in IMGT structure tools

    28 September 2006 - CREATION: IMGT/DomainGapAlign

    1. Creation of IMGT/DomainGapAlign in IMGT structure tools

    28 September 2006 - CREATION: IMGT/DomainDisplay

    1. Creation of IMGT/DomainDisplay in IMGT sequence tools

    27 September 2006 - CREATION: Leader sequence logos of the human IG and TR V genes

    1. Creation of V-REGION sequence logos of the human IG and TR in IMGT Repertoire

    19 September 2006 - CREATION: IMGT/GeneFrequency

    1. Creation of IMGT/GeneFrequency in IMGT genome tools

    28 July 2006 - UPDATE: Monoclonal antibodies with clinical indications

    Monoclonal antibodies with clinical indications

    1. Murine monoclonal antibodies
    2. Chimeric monoclonal antibodies
    3. Humanized monoclonal antibodies
    4. Human monoclonal antibodies
    5. Immunotoxins
    6. Other monoclonal antibodies

    15 June 2006 - CREATION: Recombination signal sequences and logos (Homo sapiens) IG and TR V, D and J genes

    Creation of Recombination signals of the human (Homo sapiens) IG and TR V, D and J genes in IMGT Repertoire

    1. Recombination signal sequences
    2. Recombination signal sequence logos
    3. Recombination signal sequence logo for the seven loci
    4. Number of sequences for generating the recombination signal sequence logo for the seven loci

    11 May 2006 - ENHANCEMENT: New IMGT/V-QUEST upgraded for multiple sequences and with new functionalities (v2.0.0)

    IMGT/V-QUEST has been upgraded for multiple sequences and with new functionalities. For more information on the IMGT/V-QUEST Version 2.0.0 improvements, see IMGT/V-QUEST Documentation.

    2 March 2006 - UPDATE: Definitive nomenclature for the mouse (Mus musculus) IGHV genes

    Definitive nomenclature. Update of Gene table: Mouse (Mus musculus) IGHV, with data for strains other than C57BL6/J.

    2005

    5 November 2005 - CREATION: Definitive gene name nomenclature for mouse (Mus musculus)

    Gene table: Mouse (Mus musculus) IGHV. This new gene table provides the definitive nomenclature for the mouse (Mus musculus) IGHV genes and thus completes the nomenclature for the seven mouse IG and TR loci. The temporary nomenclature table remains available as an archive.

    1. Creation of Locus representation with the definitive IGHV nomenclature
    2. Creation of Gene table: Mouse (Mus musculus) IGHV, with data for the C57BL6/J strain.

    28 October 2005 - CREATION: IMGT Genes (DAS server) on the Ensembl Genome Browser

    The links below give access to the human IG and TR loci in Ensembl
    To see "IMGT Genes", go to the "Detailed View" section, click on the rolling menu "DAS Sources" and select "IMGT Genes".

    Once "IMGT Genes" are displayed, clicking on an individual IMGT Gene opens a small window with a direct link to IMGT/GENE-DB.

    1. Homo sapiens IGH locus at 14q32.33:
    2. Homo sapiens IGK locus at 2p11.2:
    3. Homo sapiens IGL locus at 22q11.2:
    4. Homo sapiens TRA/TRD locus at 14q11.2:
    5. Homo sapiens TRB locus at 7q34:
    6. Homo sapiens TRG locus at 7p14:

    01 August 2005 - CREATION: Primer Localization in IMGT/PRIMER-DB

    1. Creation of IMGT/PRIMER-DB Primer Localization in IMGT/PRIMER-DB
    2. Creation of IMGT/PRIMER-DB Primer Localization with graphical prototype gene representation (for V, D and J genes) in

    Click on the button "Primer Localization", at the bottom of the IMGT/PRIMER-DB Primer cards.

    20 July 2005 - CREATION: BLAST on IMGT/GENE-DB reference sequences

    1. Creation of BLAST at CINES on IMGT/LIGM-DB and on IMGT/GENE-DB reference sequences

    12 May 2005 - CREATION: IMGT domain directory

    1. Creation of IMGT domain directory

    2004

    4 November 2004 - ENHANCEMENT: IMGT/JunctionAnalysis

    1. Enhancement of the IMGT/JunctionAnalysis: Possibility to select up to 7 mutations in the 3'V-REGION and 5'J-REGION. This option is useful for the analysis of highly mutated IGK and IGL 3'V-REGIONs.

    13 September 2004 - CREATION: IMGT pMHC contact sites in IMGT/3Dstructure-DB

    1. Definition and characterization of eleven standardized IMGT pMHC contact sites in IMGT/3Dstructure-DB

    13 September 2004 - CREATION: IMGT Colliers de Perles for G-DOMAIN in IMGT/3Dstructure-DB

    1. Creation of IMGT Colliers de Perles for G-DOMAINs in IMGT/3Dstructure-DB. The IMGT Colliers de Perles for G-DOMAIN are based on the IMGT unique numbering for G-DOMAIN and G-LIKE-DOMAIN

    05 July 2004 - CREATION: IMGT/GENE-DB Statistics

    1. Creation of IMGT/GENE-DB Statistics in IMGT/GENE-DE Query page

    28 June 2004 - CREATION: IMGT/GENE-DB Direct links

    1. Creation of IMGT/GENE-DB Direct links in IMGT/GENE-DE Query page

    28 June 2004 - ENHANCEMENT: IMGT/3Dstructure-DB

    1. Enhancement of the IMGT/3Dstructure-DB Colliers de Perles in the IMGT/3Dstructure-DB results: The "IMGT/3Dstructure-DB residue information" card of each residue of the IMGT Colliers de Perles on one layer or two layers can directly be obtained by clicking on the residue in the IMGT Colliers de Perles.

    23 June 2004 - ENHANCEMENT: IMGT/V-QUEST enhancement with the integration of IMGT/JunctionAnalysis

    1. Enhancement of IMGT/V-QUEST with the integration of IMGT/JunctionAnalysis, in IMGT tools.

    22 June 2004 - CREATION: IMGT Medical page

    1. Creation of IMGT Medical page.

    22 June 2004 - CREATION: IMGT Veterinary page

    1. Creation of IMGT Veterinary page.

    22 June 2004 - CREATION: IMGT Biotechnology page

    1. Creation of IMGT Biotechnology page.

    25 May 2004 - CREATION: IMGT Lexique

    1. Creation of IMGT Lexique in IMGT Education.

    10 May 2004 - ENHANCEMENT: IMGT/V-QUEST

    1. Enhancement of IMGT/V-QUEST in IMGT tools: IMGT/V-QUEST output enhancement with the addition of the nucleotide sequence and deduced amino translation of the closest germline V gene in the 'Translation of the input sequence' section of IMGT/V-QUEST results.

    5 March 2004 - CREATION: IMGT/PRIMER-DB select bibliographic references

    1. Creation of IMGT/PRIMER-DB select bibliographic references in IMGT/PRIMER-DB Query page

    15 January 2004 - CREATION: IMGT/GeneInfo

    1. Creation of IMGT/GeneInfo in IMGT Tools

    2003

    25 November 2003 - UPDATE: IMGT/GeneSearch, IMGT/GeneView and IMGT/LocusView: mouse TRB

    1. Update of IMGT/GeneSearch in IMGT Genome and Structure databases: Addition of the mouse TRB genes
    2. Update of IMGT/GeneView in IMGT Genome and Structure databases: Addition of the mouse TRB genes
    3. Update of IMGT/LocusView in IMGT Genome and Structure databases: Addition of the mouse TRB locus

    13 October 2003 - CREATION: Three spined stickleback (Gasterosteus aculeatus) IGIC

    1. Creation of Gene and allele table: Three spined stickleback (Gasterosteus aculeatus) IGIC in IMGT Repertoire
    2. Creation of Alignments of alleles: Three spined stickleback (Gasterosteus aculeatus) IGI C-REGION in IMGT Repertoire
    3. Creation of Protein display: Three spined stickleback (Gasterosteus aculeatus) IGI C-REGIONs in IMGT Repertoire
    4. Creation of Strand and loop lengths (C-DOMAIN): Three spined stickleback (Gasterosteus aculeatus) IGI in IMGT Repertoire
    5. Creation of Colliers de Perles: Three spined stickleback (Gasterosteus aculeatus) IGI C-REGIONs in IMGT Repertoire

    02 October 2003 - CREATION: Chinese perch (Siniperca chuatsi) IGIC

    1. Creation of Gene and allele table: Chinese perch (Siniperca chuatsi) IGIC in IMGT Repertoire
    2. Creation of Alignments of alleles: Chinese perch (Siniperca chuatsi) IGI C-REGION in IMGT Repertoire
    3. Creation of Protein display: Chinese perch (Siniperca chuatsi) IGI C-REGIONs in IMGT Repertoire
    4. Creation of Strand and loop lengths (C-DOMAIN): Chinese perch (Siniperca chuatsi) IGI in IMGT Repertoire
    5. Creation of Colliers de Perles: Chinese perch (Siniperca chuatsi) IGI C-REGIONs in IMGT Repertoire

    02 October 2003 - CREATION: Chinese perch (Siniperca chuatsi) IGIJ

    1. Creation of Germline gene table: Chinese perch (Siniperca chuatsi) IGIJ in IMGT Repertoire
    2. Creation of Table of alleles: Chinese perch (Siniperca chuatsi) IGIJ in IMGT Repertoire
    3. Creation of Alignments of alleles: Chinese perch (Siniperca chuatsi) IGI J-REGION in IMGT Repertoire
    4. Creation of Protein display: Chinese perch (Siniperca chuatsi) IGI J-REGIONs in IMGT Repertoire

    02 October 2003 - CREATION: Chinese perch (Siniperca chuatsi) IGIV

    1. Creation of Germline gene table: Chinese perch (Siniperca chuatsi) IGIV in IMGT Repertoire
    2. Creation of Table of alleles: Chinese perch (Siniperca chuatsi) IGIV in IMGT Repertoire
    3. Creation of Alignments of alleles: Chinese perch (Siniperca chuatsi) IGI V-REGION in IMGT Repertoire
    4. Creation of Protein display: Chinese perch (Siniperca chuatsi) IGI V-REGIONs in IMGT Repertoire
    5. Creation of FR-IMGT and CDR-IMGT lengths: Chinese perch (Siniperca chuatsi) IGIV in IMGT Repertoire
    6. Creation of Colliers de Perles: Chinese perch (Siniperca chuatsi) IGI V-REGIONs in IMGT Repertoire

    25 September 2003 - CREATION: Nurse shark (Ginglymostoma cirratum) IGIV

    1. Creation of Germline gene table: Nurse shark (Ginglymostoma cirratum) IGIV in IMGT Repertoire
    2. Creation of Table of alleles: Nurse shark (Ginglymostoma cirratum) IGIV in IMGT Repertoire
    3. Creation of Alignments of alleles: Nurse shark (Ginglymostoma cirratum) IGI V-REGION in IMGT Repertoire
    4. Creation of Protein display: Nurse shark (Ginglymostoma cirratum) IGI V-REGIONs in IMGT Repertoire
    5. Creation of FR-IMGT and CDR-IMGT lengths: Nurse shark (Ginglymostoma cirratum) IGIV in IMGT Repertoire
    6. Creation of Colliers de Perles: Nurse shark (Ginglymostoma cirratum) IGI V-REGIONs in IMGT Repertoire

    25 September 2003 - CREATION: Nurse shark (Ginglymostoma cirratum) IGIJ

    1. Creation of Germline gene table: Nurse shark (Ginglymostoma cirratum) IGIJ in IMGT Repertoire
    2. Creation of Table of alleles: Nurse shark (Ginglymostoma cirratum) IGIJ in IMGT Repertoire
    3. Creation of Alignments of alleles: Nurse shark (Ginglymostoma cirratum) IGI J-REGION in IMGT Repertoire
    4. Creation of Protein display: Nurse shark (Ginglymostoma cirratum) IGI J-REGIONs in IMGT Repertoire

    12 September 2003 - UPDATE: IMGT/GeneSearch, IMGT/GeneView and IMGT/LocusView: human IGK

    1. Update of IMGT/GeneSearch in IMGT Genome and Structure databases: Addition of the human IGK genes
    2. Update of IMGT/GeneView in IMGT Genome and Structure databases: Addition of the human IGK genes
    3. Update of IMGT/LocusView in IMGT Genome and Structure databases: Addition of the human IGK locus

    12 September 2003 - CREATION: Gene exon/intron organization: Mouse (Mus musculus) T cell receptor constant genes TRAC, TRBC, TRGC, TRDC

    1. Creation of Gene exon/intron organization: Mouse (Mus musculus) T cell receptor constant genes TRAC, TRBC, TRGC, TRDC in IMGT Repertoire

    12 September 2003 - CREATION: Gene exon/intron organization: Mouse (Mus musculus) immunoglobulin constant genes IGHC

    1. Creation of Gene exon/intron organization: Mouse (Mus musculus) immunoglobulin constant genes IGHC in IMGT Repertoire

    12 September 2003 - CREATION: Gene exon/intron organization: Human T cell receptor constant genes TRAC, TRBC, TRGC, TRDC

    1. Creation of Gene exon/intron organization: Human T cell receptor constant genes TRAC, TRBC, TRGC, TRDC in IMGT Repertoire

    09 September 2003 - CREATION: Pig (Sus scrofa) TRDJ

    1. Creation of Germline gene table: Pig (Sus scrofa) TRDJ in IMGT Repertoire
    2. Creation of Table of alleles: Pig (Sus scrofa) TRDJ in IMGT Repertoire
    3. Creation of Alignments of alleles: Pig (Sus scrofa) TRD J-REGION in IMGT Repertoire
    4. Creation of Protein display: Pig (Sus scrofa) TRD J-REGIONs in IMGT Repertoire

    09 September 2003 - CREATION: Pig (Sus scrofa) TRAJ

    1. Creation of Germline gene table: Pig (Sus scrofa) TRAJ in IMGT Repertoire
    2. Creation of Table of alleles: Pig (Sus scrofa) TRAJ in IMGT Repertoire
    3. Creation of Alignments of alleles: Pig (Sus scrofa) TRA J-REGION in IMGT Repertoire
    4. Creation of Protein display: Pig (Sus scrofa) TRA J-REGIONs in IMGT Repertoire

    03 September 2003 - CREATION: Sandbar shark (Carcharhinus plumbeus) IGIJ

    1. Creation of Germline gene table: Sandbar shark (Carcharhinus plumbeus) IGIJ in IMGT Repertoire
    2. Creation of Table of alleles: Sandbar shark (Carcharhinus plumbeus) IGIJ in IMGT Repertoire
    3. Creation of Alignments of alleles: Sandbar shark (Carcharhinus plumbeus) IGI J-REGION in IMGT Repertoire
    4. Creation of Protein display: Sandbar shark (Carcharhinus plumbeus) IGI J-REGIONs in IMGT Repertoire

    03 September 2003 - CREATION: Sandbar shark (Carcharhinus plumbeus) IGIV

    1. Creation of Germline gene table: Sandbar shark (Carcharhinus plumbeus) IGIV in IMGT Repertoire
    2. Creation of Table of alleles: Sandbar shark (Carcharhinus plumbeus) IGIV in IMGT Repertoire
    3. Creation of Alignments of alleles: Sandbar shark (Carcharhinus plumbeus) IGI V-REGION in IMGT Repertoire
    4. Creation of Protein display: Sandbar shark (Carcharhinus plumbeus) IGI V-REGIONs in IMGT Repertoire
    5. Creation of FR-IMGT and CDR-IMGT lengths: Sandbar shark (Carcharhinus plumbeus) IGIV in IMGT Repertoire
    6. Creation of Colliers de Perles: Sandbar shark (Carcharhinus plumbeus) IGI V-REGIONs in IMGT Repertoire

    20 August 2003 - CREATION: Pig (Sus scrofa) IGHV

    1. Creation of Table of alleles: Pig (Sus scrofa) IGHV in IMGT Repertoire
    2. Creation of Alignments of alleles: Pig (Sus scrofa) IGH V-REGION in IMGT Repertoire
    3. Creation of Protein display: Pig (Sus scrofa) IGH V-REGIONs in IMGT Repertoire
    4. Creation of Colliers de Perles: Pig (Sus scrofa) IGH V-REGION in IMGT Repertoire
    5. Creation of FR-IMGT and CDR-IMGT lengths: Pig (Sus scrofa) IGHV in IMGT Repertoire

    19 August 2003 - CREATION: Gene exon/intron splicing sites: Human immunoglobulin constant genes IGHC

    1. Creation of Gene exon/intron splicing sites: Human immunoglobulin constant genes IGHC in IMGT Repertoire

    19 August 2003 - CREATION: Gene exon/intron splicing sites: Human T cell receptor constant genes TRAC, TRBC, TRGC, TRDC

    1. Creation of Gene exon/intron splicing sites: Human T cell receptor constant genes TRAC, TRBC, TRGC, TRDC in IMGT Repertoire

    19 August 2003 - CREATION: Gene exon/intron splicing sites: Mouse (Mus musculus) T cell receptor constant genes TRAC, TRBC, TRGC, TRDC

    1. Creation of Gene exon/intron splicing sites: Mouse (Mus musculus) T cell receptor constant genes TRAC, TRBC, TRGC, TRDC in IMGT Repertoire

    18 August 2003 - CREATION: African clawed frog (Xenopus laevis) IGHV

    1. Creation of Germline gene table: African clawed frog (Xenopus laevis) IGHV in IMGT Repertoire
    2. Creation of Table of alleles: African clawed frog (Xenopus laevis) IGHV in IMGT Repertoire
    3. Creation of Alignments of alleles: African clawed frog (Xenopus laevis) IGH V-REGION in IMGT Repertoire
    4. Creation of Protein display: African clawed frog (Xenopus laevis) IGH V-REGIONs in IMGT Repertoire
    5. Creation of Colliers de Perles: African clawed frog (Xenopus laevis) IGH V-REGION in IMGT Repertoire
    6. Creation of FR-IMGT and CDR-IMGT lengths: African clawed frog (Xenopus laevis) IGHV in IMGT Repertoire

    13 August 2003 - CREATION: Gene exon/intron splicing sites: Mouse (Mus musculus) immunoglobulin constant genes IGHC

    1. Creation of Gene exon/intron splicing sites: Mouse (Mus musculus) immunoglobulin constant genes IGHC in IMGT Repertoire

    05 August 2003 - CREATION: Pig (Sus scrofa) IGHD

    1. Creation of Germline gene table: Pig (Sus scrofa) IGHD in IMGT Repertoire
    2. Creation of Table of alleles: Pig (Sus scrofa) IGHD in IMGT Repertoire
    3. Creation of Alignments of alleles: Pig (Sus scrofa) IGH D-REGION in IMGT Repertoire

    05 August 2003 - CREATION: Pig (Sus scrofa) IGHJ

    1. Creation of Germline gene table: Pig (Sus scrofa) IGHJ in IMGT Repertoire
    2. Creation of Table of alleles: Pig (Sus scrofa) IGHJ in IMGT Repertoire
    3. Creation of Alignments of alleles: Pig (Sus scrofa) IGH J-REGION in IMGT Repertoire
    4. Creation of Protein display: Pig (Sus scrofa) IGH J-REGIONs in IMGT Repertoire

    30 July 2003 - CREATION: Gene exon/intron organization: Human immunoglobulin constant genes IGHC

    1. Creation of Gene exon/intron organization: Human immunoglobulin constant genes IGHC in IMGT Repertoire

    29 July 2003 - CREATION: African lungfish (Protopterus aethiopicus) IGHC

    1. Creation of Germline gene table: Marbled lungfish (Protopterus aethiopicus) IGHC in IMGT Repertoire
    2. Creation of Table of alleles: African lungfish (Protopterus aethiopicus) IGHC in IMGT Repertoire
    3. Creation of Alignments of alleles: African lungfish (Protopterus aethiopicus) IGH C-REGION in IMGT Repertoire
    4. Creation of Protein display: African lungfish (Protopterus aethiopicus) IGH C-REGIONs in IMGT Repertoire
    5. Creation of Colliers de Perles: African lungfish (Protopterus aethiopicus) IGH C-REGION in IMGT Repertoire
    6. Creation of Strand and loop lengths: African lungfish (Protopterus aethiopicus) IGHC in IMGT Repertoire

    29 July 2003 - CREATION: African lungfish (Protopterus aethiopicus) IGHV

    1. Creation of Germline gene table: Marbled lungfish (Protopterus aethiopicus) IGHV in IMGT Repertoire
    2. Creation of Table of alleles: African lungfish (Protopterus aethiopicus) IGHV in IMGT Repertoire
    3. Creation of Alignments of alleles: African lungfish (Protopterus aethiopicus) IGH V-REGION in IMGT Repertoire
    4. Creation of Protein display: African lungfish (Protopterus aethiopicus) IGH V-REGIONs in IMGT Repertoire
    5. Creation of Colliers de Perles: African lungfish (Protopterus aethiopicus) IGH V-REGION in IMGT Repertoire
    6. Creation of FR-IMGT and CDR-IMGT lengths: African lungfish (Protopterus aethiopicus) IGHV in IMGT Repertoire

    29 July 2003 - CREATION: IMGT Livre d'Or

    1. Creation of IMGT Livre d'Or

    29 July 2003 - CREATION: IMGT/MHC-DB

    1. Creation of IMGT/MHC-DB in IMGT Index

    29 July 2003 - CREATION: IMGT Scientific Committee

    1. Creation of IMGT Scientific Committee in IMGT Index

    29 July 2003 - CREATION: Allotypes: Human IGHC

    1. Creation of the Allotypes: Human IGHC A2m allotypes in IMGT Repertoire

    24 July 2003 - UPDATE: IMGT/V-QUEST

    1. Update of IMGT/V-QUEST in IMGT Tools: T cell receptor genes (TRAV, TRAJ, TRBV, TRBJ, TRGV, TRGJ, TRDV, TRDD, TRDJ) from non-human primates Ma's night monkey (Aotus nancymaae) have been added

    24 July 2003 - UPDATE: IMGT/V-QUEST

    1. Update of IMGT/V-QUEST in IMGT Tools: Immunoglobulin iota variable (IGIV) genes from teleostei have been added

    24 July 2003 - UPDATE: IMGT/V-QUEST

    1. Update of IMGT/V-QUEST in IMGT Tools: Update of Chondrichthyes IG Set (IGHV, IGHD, IGHJ)

    24 July 2003 - UPDATE: IMGT/JunctionAnalysis

    1. Update of IMGT/JunctionAnalysis in IMGT Tools: Addition of parameters for accepted mutations in the V-REGION, J-REGION, and in the D-REGION

    06 June 2003 - CREATION: Atlantic cod (Gadus morhua) IGIV

    1. Creation of Germline gene table: Atlantic cod (Gadus morhua) IGIV in IMGT Repertoire
    2. Creation of Table of alleles: Atlantic cod (Gadus morhua) IGIV in IMGT Repertoire
    3. Creation of Alignments of alleles: Atlantic cod (Gadus morhua) IGI V-REGION in IMGT Repertoire
    4. Creation of Protein display: Atlantic cod (Gadus morhua) IGIV in IMGT Repertoire
    5. Creation of Colliers de Perles: Atlantic cod (Gadus morhua) IGI V-REGIONs in IMGT Repertoire
    6. Creation of FR-IMGT and CDR-IMGT lengths: Atlantic cod (Gadus morhua) IGIV in IMGT Repertoire

    05 June 2003 - CREATION: Table of alleles: Mouse (Mus musculus) TRGC

    1. Creation of Table of alleles: Mouse (Mus musculus) TRGC in IMGT Repertoire

    05 June 2003 - CREATION: Mouse (Mus musculus) TRDC

    1. Creation of Table of alleles: Mouse (Mus musculus) TRDC in IMGT Repertoire
    2. Creation of Colliers de Perles: Mouse (Mus musculus) TRD C-DOMAIN in IMGT Repertoire

    05 June 2003 - CREATION: Mouse (Mus musculus) TRBC

    1. Creation of Table of alleles: Mouse (Mus musculus) TRBC in IMGT Repertoire
    2. Creation of Colliers de Perles: Mouse (Mus musculus) TRB C-DOMAIN in IMGT Repertoire

    05 June 2003 - CREATION: Table of alleles: Mouse (Mus musculus) TRAC

    1. Creation of Table of alleles: Mouse (Mus musculus) TRAC in IMGT Repertoire

    04 June 2003 - CREATION: Ma's night monkey (Aotus nancymaae) TRAV

    1. Creation of Germline gene table: Ma's night monkey (Aotus nancymaae) TRAV in IMGT Repertoire
    2. Creation of Table of alleles: Ma's night monkey (Aotus nancymaae) TRAV in IMGT Repertoire
    3. Creation of Alignments of alleles: Ma's night monkey (Aotus nancymaae) TRA V-REGION in IMGT Repertoire
    4. Creation of Protein display: Ma's night monkey (Aotus nancymaae) TRAV-REGIONs in IMGT Repertoire
    5. Creation of Colliers de Perles: Ma's night monkey (Aotus nancymaae) TRA V-REGION in IMGT Repertoire
    6. Creation of FR-IMGT and CDR-IMGT lengths: Ma's night monkey (Aotus nancymaae) TRAV in IMGT Repertoire

    02 June 2003 - CREATION: Mouse (Mus musculus) IGLL

    1. Creation of Gene and allele table: Mouse (Mus musculus) IGLL in IMGT Repertoire (RPI)
    2. Creation of Protein displays: Mouse (Mus musculus) IGLL in IMGT Repertoire (RPI)
    3. Creation of Alignment of alleles: Mouse (Mus musculus) IGLL1 in IMGT Repertoire (RPI)

    02 June 2003 - CREATION: Human IGLL

    1. Creation of Gene and allele table: Human IGLL in IMGT Repertoire (RPI)
    2. Creation of Protein displays: Human IGLL in IMGT Repertoire (RPI)
    3. Creation of Alignment of alleles: Human IGLL in IMGT Repertoire (RPI)

    02 June 2003 - CREATION: Mouse (Mus musculus) VPREB

    1. Creation of Gene and allele table: Mouse (Mus musculus) VPREB in IMGT Repertoire (RPI)
    2. Creation of Protein displays: Mouse (Mus musculus) VPREB in IMGT Repertoire (RPI)
    3. Creation of Alignment of alleles: Mouse (Mus musculus) VPREB in IMGT Repertoire (RPI)

    02 June 2003 - CREATION: Human VPREB

    1. Creation of Gene and allele table: Human VPREB in IMGT Repertoire (RPI)
    2. Creation of Protein displays: Human VPREB in IMGT Repertoire (RPI)
    3. Creation of Alignment of alleles: Human VPREB1 in IMGT Repertoire (RPI)

    02 June 2003 - CREATION: Mouse (Mus musculus) PRETA

    1. Creation of Gene and allele table: Mouse (Mus musculus) PRETA in IMGT Repertoire (RPI)
    2. Creation of Protein displays: Mouse (Mus musculus) PRETA in IMGT Repertoire (RPI)
    3. Creation of Alignment of alleles: Mouse (Mus musculus) PRETA1 in IMGT Repertoire (RPI)

    02 June 2003 - CREATION: Human PRETA

    1. Creation of Gene and allele table: Human PRETA in IMGT Repertoire (RPI)
    2. Creation of Protein displays: Human PRETA in IMGT Repertoire (RPI)
    3. Creation of Alignment of alleles: Human PRETA1 in IMGT Repertoire (RPI)

    23 May 2003 - CREATION: Spotted wolffish (Anarhichas minor) IGH V-REGION

    1. Creation of Colliers de perles: Spotted wolffish (Anarhichas minor) IGH V-REGION in IMGT Repertoire
    2. Creation of Alignments of alleles: Spotted wolffish (Anarhichas minor) IGH V-REGION in IMGT Repertoire

    15 May 2003 - CREATION: European sea bass (Dicentrarchus labrax) IGIC

    1. Creation of Gene and allele table: European sea bass (Dicentrarchus labrax) IGIC in IMGT Repertoire
    2. Creation of Alignments of alleles: European sea bass (Dicentrarchus labrax) IGI C-REGION in IMGT Repertoire
    3. Creation of Protein display: European sea bass (Dicentrarchus labrax) IGIC in IMGT Repertoire
    4. Creation of Colliers de Perles: European sea bass (Dicentrarchus labrax) IGI C-REGION in IMGT Repertoire
    5. Creation of Strand and loop lengths (C-DOMAIN): European sea bass (Dicentrarchus labrax) IGI in IMGT Repertoire

    15 May 2003 - CREATION: European sea bass (Dicentrarchus labrax) IGIV

    1. Creation of Germline gene table: European sea bass (Dicentrarchus labrax) IGIV in IMGT Repertoire
    2. Creation of Table of alleles: European sea bass (Dicentrarchus labrax) IGIV in IMGT Repertoire
    3. Creation of Alignments of alleles: European sea bass (Dicentrarchus labrax) IGI V-REGION in IMGT Repertoire
    4. Creation of Protein display: European sea bass (Dicentrarchus labrax) IGIV in IMGT Repertoire
    5. Creation of Colliers de Perles: European sea bass (Dicentrarchus labrax) IGI V-REGION in IMGT Repertoire
    6. Creation of FR-IMGT and CDR-IMGT lengths: European sea bass (Dicentrarchus labrax) IGIV in IMGT Repertoire

    14 May 2003 - CREATION: IG and TR number of genes: Human

    1. Creation of IG and TR number of genes: Human in IMGT Repertoire

    14 May 2003 - CREATION: Five-ray yellowtail (Seriola quinqueradiata) IGIC

    1. Creation of Gene and allele table: Five-ray yellowtail (Seriola quinqueradiata) IGIC in IMGT Repertoire
    2. Creation of Alignments of alleles: Five-ray yellowtail (Seriola quinqueradiata) IGI C-REGION in IMGT Repertoire
    3. Creation of Protein display: Five-ray yellowtail (Seriola quinqueradiata) IGIC in IMGT Repertoire
    4. Creation of Colliers de Perles: Five-ray yellowtail (Seriola quinqueradiata) IGI C-REGION in IMGT Repertoire
    5. Creation of Strand and loop lengths (C-DOMAIN): Five-ray yellowtail (Seriola quinqueradiata) IGI in IMGT Repertoire

    14 May 2003 - CREATION: Five-ray yellowtail (Seriola quinqueradiata) IGIV

    1. Creation of Germline gene table: Five-ray yellowtail (Seriola quinqueradiata) IGIV in IMGT Repertoire
    2. Creation of Table of alleles: Five-ray yellowtail (Seriola quinqueradiata) IGIV in IMGT Repertoire
    3. Creation of Alignments of alleles: Five-ray yellowtail (Seriola quinqueradiata) IGI V-REGION in IMGT Repertoire
    4. Creation of Protein display: Five-ray yellowtail (Seriola quinqueradiata) IGIV in IMGT Repertoire
    5. Creation of Colliers de Perles: Five-ray yellowtail (Seriola quinqueradiata) IGI V-REGION in IMGT Repertoire
    6. Creation of FR-IMGT and CDR-IMGT lengths: Five-ray yellowtail (Seriola quinqueradiata) IGIV in IMGT Repertoire

    13 May 2003 - CREATION: Allotypes: Human IGKC

    1. Creation of Allotypes: Human IGKC in IMGT Repertoire

    13 May 2003 - CREATION: Human HLB-DMB domain 2 (C-LIKE-DOMAIN)

    1. Creation of Collier de Perles: Human HLB-DMA domain 2 (C-LIKE-DOMAIN) in IMGT Repertoire (RPI)
    2. Creation of 3D representation: Human HLB-DMA domain 2 (C-LIKE-DOMAIN )(PDB: 1hdm_B) in IMGT Repertoire (RPI)

    13 May 2003 - CREATION: Human HLA-DMA domain 2 (C-LIKE-DOMAIN)

    1. Creation of Collier de Perles: Human HLA-DMA domain 2 (C-LIKE-DOMAIN) in IMGT Repertoire (RPI)
    2. Creation of 3D representation: Human HLA-DMA domain 2 (C-LIKE-DOMAIN )(PDB: 1hdm_A) in IMGT Repertoire (RPI)

    13 May 2003 - CREATION: IMGTrepertoire RPI

    1. Creation of IMGT Repertoire (RPI) in IMGT Repertoire

    09 May 2003 - CREATION: IMGT EC FP5 project (European Commission Fifth Framework programme)

    1. Creation of IMGT EC FP5 project (European Commission Fifth Framework programme) in IMGT Information

    07 May 2003 - CREATION: Examples of C-DOMAINs: Strand and loop lengths of IG-Light C-DOMAINs: Human and Mouse IGL and IGK and Teleostei IGI C-DOMAINs

    1. Creation of Examples of C-DOMAINs: Strand and loop lengths of IG-Light C-DOMAINs: Human and Mouse IGL and IGK and Teleostei IGI C-DOMAINs in IMGT Repertoire

    07 May 2003 - CREATION: Examples of C-DOMAINs: Protein displays of IG-Light C-DOMAINs: Human and mouse IGL and IGK and Teleostei IGI C-DOMAINs

    1. Creation of Examples of C-DOMAINs: Protein displays of IG-Light C-DOMAINs: Human and mouse IGL and IGK and Teleostei IGI C-DOMAINs in IMGT Repertoire

    07 May 2003 - CREATION: Examples of C-DOMAINs: Protein displays of TR C-DOMAINs: Human and mouse TRA, TRB, TRG and TRD C-DOMAINs

    1. Creation of Examples of C-DOMAINs: Protein displays of TR C-DOMAINs: Human and mouse TRA, TRB, TRG and TRD C-DOMAINs in IMGT Repertoire

    07 May 2003 - CREATION: Mouse (Mus musculus, Mus spretus) IGKC

    1. Creation of Table of alleles: Table of alleles: Mouse (Mus musculus, Mus spretus) IGKC in IMGT Repertoire
    2. Creation of Alignments of alleles: Mouse (Mus musculus, Mus spretus) IGK C-REGION in IMGT Repertoire

    06 May 2003 - CREATION: DATABASE: NetWatch of Science "Blueprints of Immunity"

    1. Creation of NetWatch of Science "Blueprints of Immunity" in IMGT Information

    06 May 2003 - CREATION: Reviews on IMGT

    1. Creation of Reviews on IMGT in IMGT Information

    05 May 2003 - CREATION: Human IGHC

    1. Creation of Table of alleles: Human IGHC in IMGT Repertoire
    2. Creation of Alignments of alleles: Human IGH C-REGION in IMGT Repertoire

    30 April 2003 - UPDATE: Mouse (Mus musculus) TRAV

    1. Update of Mouse (Mus musculus) TRAV in IMGT Repertoire

    30 April 2003 - CREATION: Zebrafish (Danio rerio) IGIV

    1. Creation of Germline gene table: Zebrafish (Danio rerio) IGIV in IMGT Repertoire
    2. Creation of Table of alleles: Zebrafish (Danio rerio) IGIV in IMGT Repertoire
    3. Creation of Alignments of alleles: Zebrafish (Danio rerio) IGI V-REGION in IMGT Repertoire
    4. Creation of Protein display: Zebrafish (Danio rerio) IGIV in IMGT Repertoire
    5. Creation of Colliers de Perles: Zebrafish (Danio rerio) IGI V-REGION in IMGT Repertoire
    6. Creation of FR-IMGT and CDR-IMGT lengths: Zebrafish (Danio rerio) IGIV in IMGT Repertoire

    30 April 2003 - CREATION: Zebrafish (Danio rerio) IGIJ

    1. Creation of Germline gene table: Zebrafish (Danio rerio) IGIJ in IMGT Repertoire
    2. Creation of Table of alleles: Zebrafish (Danio rerio) IGIJ in IMGT Repertoire
    3. Creation of Alignments of alleles: Zebrafish (Danio rerio) IGI J-REGION in IMGT Repertoire
    4. Creation of Protein display: Zebrafish (Danio rerio) IGIJ in IMGT Repertoire

    30 April 2003 - CREATION: Zebrafish (Danio rerio) IGIC

    1. Creation of Gene and allele table: Zebrafish (Danio rerio) IGIC in IMGT Repertoire
    2. Creation of Alignments of alleles: Zebrafish (Danio rerio) IGI C-REGION in IMGT Repertoire
    3. Creation of Protein display: Zebrafish (Danio rerio) IGIC in IMGT Repertoire
    4. Creation of Colliers de Perles: Zebrafish (Danio rerio) IGI C-REGIONs in IMGT Repertoire
    5. Creation of Strand and loop lengths (C-DOMAIN): Zebrafish (Danio rerio) IGI in IMGT Repertoire

    24 April 2003 - CREATION: Common carp (Cyprinus carpio) IGIC

    1. Creation of Gene and allele table: Common carp (Cyprinus carpio) IGIC in IMGT Repertoire
    2. Creation of Alignments of alleles: Common carp (Cyprinus carpio) IGI C-REGION in IMGT Repertoire
    3. Creation of Protein display: Common carp (Cyprinus carpio) IGI C-REGIONs in IMGT Repertoire
    4. Creation of Colliers de Perles: Common carp (Cyprinus carpio) IGI C-REGIONs in IMGT Repertoire
    5. Creation of Strand and loop lengths (C-DOMAIN): Common carp (Cyprinus carpio) IGI in IMGT Repertoire

    24 April 2003 - CREATION: Common carp (Cyprinus carpio) IGIV

    1. Creation of Germline gene table: Common carp (Cyprinus carpio) IGIV in IMGT Repertoire
    2. Creation of Table of alleles: Common carp (Cyprinus carpio) IGIV in IMGT Repertoire
    3. Creation of Alignments of alleles: Common carp (Cyprinus carpio) IGI V-REGION in IMGT Repertoire
    4. Creation of Protein display: Common carp (Cyprinus carpio) IGI V-REGIONs in IMGT Repertoire
    5. Creation of Colliers de Perles: Common carp (Cyprinus carpio) IGI V-REGIONs in IMGT Repertoire
    6. Creation of FR-IMGT and CDR-IMGT lengths: Common carp (Cyprinus carpio) IGIV in IMGT Repertoire

    23 April 2003 - CREATION: IMGT/PROTEIN-DB (in development)

    1. Creation of IMGT/PROTEIN-DB (in development) in IMGT Index

    23 April 2003 - CREATION: Tools

    1. Creation of Tools in IMGT Index

    23 April 2003 - CREATION: IMGT/StructuralQuery

    1. Creation of IMGT/StructuralQuery in IMGT Index

    23 April 2003 - CREATION: Documentation

    1. Creation of Documentation in IMGT Index

    23 April 2003 - CREATION: Databases

    1. Creation of Databases in IMGT Index

    18 April 2003 - CREATION: Links

    1. Creation of Links in IMGT Index

    17 April 2003 - CREATION: Exemples de questions d'examen (DEUG SV mention concours) 2002 - 2003

    1. Creation of Exemples de questions d'examen (DEUG SV mention concours) 2002 - 2003 in IMGT Education

    17 April 2003 - CREATION: Métabolisme hépatique des glucides

    1. Creation of Métabolisme hépatique des glucides in IMGT Education

    17 April 2003 - CREATION: DEUG Sciences et Technologie Mention: Sciences de la Vie - Option concours 2002 - 2003

    1. Creation of DEUG Sciences et Technologie Mention: Sciences de la Vie - Option concours 2002 - 2003 in IMGT Education

    16 April 2003 - CREATION: IMGT, système d'information spécialisé en immunogénétique

    1. Creation of IMGT, système d'information spécialisé en immunogénétique in IMGT Education

    16 April 2003 - CREATION: Rainbow trout (Oncorhynchus mykiss) IGIC

    1. Creation of Germline gene table: Rainbow trout (Oncorhynchus mykiss) IGIC in IMGT Repertoire
    2. Creation of Alignments of alleles: Rainbow trout (Oncorhynchus mykiss) IGI C-REGION in IMGT Repertoire
    3. Creation of Protein display: Rainbow trout (Oncorhynchus mykiss) IGI C-REGIONs in IMGT Repertoire
    4. Creation of Colliers de Perles: Rainbow trout (Oncorhynchus mykiss) IGI C-REGIONs in IMGT Repertoire
    5. Creation of FR-IMGT and CDR-IMGT lengths: Rainbow trout (Oncorhynchus mykiss) IGIC in IMGT Repertoire

    16 April 2003 - CREATION: Rainbow trout (Oncorhynchus mykiss) IGIJ

    1. Creation of Germline gene table: Rainbow trout (Oncorhynchus mykiss) IGIJ in IMGT Repertoire
    2. Creation of Table of alleles: Rainbow trout (Oncorhynchus mykiss) IGIj in IMGT Repertoire
    3. Creation of Alignments of alleles: Rainbow trout (Oncorhynchus mykiss) IGI J-REGION in IMGT Repertoire
    4. Creation of Protein display: Rainbow trout (Oncorhynchus mykiss) IGI J-REGIONs in IMGT Repertoire

    16 April 2003 - CREATION: Rainbow trout (Oncorhynchus mykiss) IGIV

    1. Creation of Germline gene table: Rainbow trout (Oncorhynchus mykiss) IGIV in IMGT Repertoire
    2. Creation of Table of alleles: Rainbow trout (Oncorhynchus mykiss) IGIV in IMGT Repertoire
    3. Creation of Alignments of alleles: Rainbow trout (Oncorhynchus mykiss) IGI V-REGION in IMGT Repertoire
    4. Creation of Protein display: Rainbow trout (Oncorhynchus mykiss) IGI V-REGIONs in IMGT Repertoire
    5. Creation of Colliers de Perles: Rainbow trout (Oncorhynchus mykiss) IGI V-REGIONs in IMGT Repertoire
    6. Creation of FR-IMGT and CDR-IMGT lengths: Rainbow trout (Oncorhynchus mykiss) IGIV in IMGT Repertoire

    15 April 2003 - CREATION: IMGT/MHC-NHP (or IMGT/NHP)

    1. Creation of IMGT/MHC-NHP (or IMGT/NHP) in IMGT Index

    15 April 2003 - CREATION: IMGT

    1. Creation of IMGT in IMGT Index

    15 April 2003 - CREATION: Correspondence between the IMGT-ONTOLOGY concepts and the IMGT Scientific chart rules

    1. Creation of Correspondence between the IMGT-ONTOLOGY concepts and the IMGT Scientific chart rules in IMGT Scientific chart

    04 April 2003 - CREATION: Ma's night monkey (Aotus nancymaae) TRBJ

    1. Creation of Germline gene table: Ma's night monkey (Aotus nancymaae) TRBJ in IMGT Repertoire
    2. Creation of Table of alleles: Ma's night monkey (Aotus nancymaae) TRBJ in IMGT Repertoire
    3. Creation of Alignments of alleles: Ma's night monkey (Aotus nancymaae) TRB J-REGION in IMGT Repertoire
    4. Creation of Protein display: Ma's night monkey (Aotus nancymaae) TRB J-REGIONs in IMGT Repertoire

    04 April 2003 - CREATION: Présentation à la surface de phages filamenteux: les multiples applications du phage display

    1. Creation of Présentation à la surface de phages filamenteux: les multiples applications du phage display in IMGT Education

    04 April 2003 - CREATION: Channel catfish (Ictalurus punctatus) IGIC

    1. Creation of Germline gene table: Channel catfish (Ictalurus punctatus) IGIC in IMGT Repertoire
    2. Creation of Alignments of alleles: Channel catfish (Ictalurus punctatus) IGI C-REGION in IMGT Repertoire
    3. Creation of Protein display: Channel catfish (Ictalurus punctatus) IGI C-REGIONs in IMGT Repertoire
    4. Creation of Colliers de Perles: Channel catfish (Ictalurus punctatus) IGI C-REGIONs in IMGT Repertoire
    5. Creation of Strand and loop lengths (C-DOMAIN): Channel catfish (Ictalurus punctatus) IGI C-DOMAIN in IMGT Repertoire

    04 April 2003 - CREATION: Channel catfish (Ictalurus punctatus) IGIJ

    1. Creation of Germline gene table: Channel catfish (Ictalurus punctatus) IGIJ in IMGT Repertoire
    2. Creation of Table of alleles: Channel catfish (Ictalurus punctatus) IGIJ in IMGT Repertoire
    3. Creation of Alignments of alleles: Channel catfish (Ictalurus punctatus) IGI J-REGION in IMGT Repertoire
    4. Creation of Protein display: Channel catfish (Ictalurus punctatus) IGI J-REGIONs in IMGT Repertoire

    04 April 2003 - CREATION: Channel catfish (Ictalurus punctatus) IGIV

    1. Creation of Germline gene table: Channel catfish (Ictalurus punctatus) IGIV in IMGT Repertoire
    2. Creation of Table of alleles: Channel catfish (Ictalurus punctatus) IGIV in IMGT Repertoire
    3. Creation of Alignments of alleles: Channel catfish (Ictalurus punctatus) IGI V-REGION in IMGT Repertoire
    4. Creation of Protein display: Channel catfish (Ictalurus punctatus) IGI V-REGIONs in IMGT Repertoire
    5. Creation of Colliers de Perles: Channel catfish (Ictalurus punctatus) IGI V-REGIONs in IMGT Repertoire
    6. Creation of FR-IMGT and CDR-IMGT lengths: Channel catfish (Ictalurus punctatus) IGIV in IMGT Repertoire

    04 April 2003 - CREATION: Ma's night monkey (Aotus nancymaae) TRBV

    1. Creation of Germline gene table: Ma's night monkey (Aotus nancymaae) TRBV in IMGT Repertoire
    2. Creation of Table of alleles: Ma's night monkey (Aotus nancymaae) TRBV in IMGT Repertoire
    3. Creation of Alignments of alleles: Ma's night monkey (Aotus nancymaae) TRB V-REGION in IMGT Repertoire
    4. Creation of Protein display: Ma's night monkey (Aotus nancymaae) TRB V-REGIONs in IMGT Repertoire
    5. Creation of Colliers de Perles: Ma's night monkey (Aotus nancymaae) TRB V-REGIONs in IMGT Repertoire
    6. Creation of FR-IMGT and CDR-IMGT lengths: Ma's night monkey (Aotus nancymaae) TRBV in IMGT Repertoire

    24 March 2003 - CREATION: African clawed frog (Xenopus laevis) TRBV

    1. Creation of Germline gene table: African clawed frog (Xenopus laevis) TRBV in IMGT Repertoire
    2. Creation of Table of alleles: African clawed frog (Xenopus laevis) TRBV in IMGT Repertoire
    3. Creation of Alignments of alleles: African clawed frog (Xenopus laevis) TRB V-REGION in IMGT Repertoire
    4. Creation of Protein display: African clawed frog (Xenopus laevis) TRB V-REGIONs in IMGT Repertoire
    5. Creation of Colliers de Perles: African clawed frog (Xenopus laevis) TRB V-REGIONs in IMGT Repertoire
    6. Creation of FR-IMGT and CDR-IMGT lengths: African clawed frog (Xenopus laevis) TRBV in IMGT Repertoire

    24 March 2003 - CREATION: Correspondence between labels for IG and TR domains in IMGT/3Dstructure-DB and IMGT/LIGM-DB

    1. Creation of Correspondence between labels for IG and TR domains in IMGT/3Dstructure-DB and IMGT/LIGM-DB in IMGT Scientific chart

    20 March 2003 - CREATION: Colliers de Perles: Spotted wobbegong shark (Orectolobus maculatus) IGH V-REGION

    1. Creation of Colliers de Perles: Spotted wobbegong shark (Orectolobus maculatus) IGH V-REGION in IMGT Repertoire

    20 March 2003 - CREATION: Colliers de Perles: Nurse shark (Ginglymostoma cirratum) IGH V-REGION

    1. Creation of Colliers de Perles: Nurse shark (Ginglymostoma cirratum) IGH V-REGION in IMGT Repertoire

    03 March 2003 - CREATION: Spotted wolffish (Anarhichas minor) IGIC

    1. Creation of Gene and allele table: Spotted wolffish (Anarhichas minor) IGIC in IMGT Repertoire
    2. Creation of Alignments of alleles: Spotted wolffish (Anarhichas minor) IGI C-REGION in IMGT Repertoire
    3. Creation of Protein display: Spotted wolffish (Anarhichas minor) IGIC in IMGT Repertoire
    4. Creation of Colliers de Perles: Spotted wolffish (Anarhichas minor) IGI C-REGIONs in IMGT Repertoire
    5. Creation of Strand and loop lengths (C-DOMAIN): Spotted wolffish (Anarhichas minor) IGI in IMGT Repertoire

    03 March 2003 - CREATION: Spotted wolffish (Anarhichas minor) IGIV

    1. Creation of Germline gene table: Spotted wolffish (Anarhichas minor) IGIV in IMGT Repertoire
    2. Creation of Table of alleles: Spotted wolffish (Anarhichas minor) IGIV in IMGT Repertoire
    3. Creation of Alignments of alleles: Spotted wolffish (Anarhichas minor) IGI V-REGION in IMGT Repertoire
    4. Creation of Protein display: Spotted wolffish (Anarhichas minor) IGIV in IMGT Repertoire
    5. Creation of Colliers de Perles: Spotted wolffish (Anarhichas minor) IGI V-REGIONs in IMGT Repertoire
    6. Creation of FR-IMGT and CDR-IMGT lengths: Spotted wolffish (Anarhichas minor) IGIV in IMGT Repertoire

    27 February 2003 - CREATION: IMGT/3Dstructure-DB

    1. Creation of IMGT/3Dstructure-DB in IMGT Index

    26 February 2003 - CREATION: African clawed frog (Xenopus laevis) TRBD

    1. Creation of Germline gene table: African clawed frog (Xenopus laevis) TRBD in IMGT Repertoire

    25 February 2003 - CREATION: IMGT Interface Committee

    1. Creation of IMGT Interface Committee in IMGT Index

    25 February 2003 - CREATION: IMGT Nomenclature Committee (IMGT-NC)

    1. Creation of IMGT Nomenclature Committee (IMGT-NC) in IMGT Index

    25 February 2003 - CREATION: IMGT Milestones

    1. Creation of IMGT Milestones in IMGT Index

    25 February 2003 - CREATION: IMGT Annotation Committee

    1. Creation of IMGT Annotation Committee in IMGT Index

    25 February 2003 - CREATION: IMGT Informatics Committee

    1. Creation of IMGT Informatics Committee in IMGT Index

    25 February 2003 - CREATION: IMGT/PRIMER-DB

    1. Creation of IMGT/PRIMER-DB in IMGT Index

    25 February 2003 - CREATION: IMGT/GENE-DB

    1. Creation of IMGT/GENE-DB in IMGT Index

    25 February 2003 - CREATION: Alignments of alleles

    1. Creation of Alignments of alleles in IMGT Index

    25 February 2003 - CREATION: NUMEROTATION

    1. Creation of NUMEROTATION in IMGT Index

    21 February 2003 - CREATION: African clawed frog (Xenopus laevis) TRBJ

    1. Creation of Germline gene table: African clawed frog (Xenopus laevis) TRBJ in IMGT Repertoire
    2. Creation of Protein display: African clawed frog (Xenopus laevis) TRB J-REGIONs in IMGT Repertoire

    17 February 2003 - CREATION: Table of alleles: Human TRGC

    1. Creation of Table of alleles: Human TRGC in IMGT Repertoire

    17 February 2003 - CREATION: Table of alleles: Human TRDC

    1. Creation of Table of alleles: Human TRDC in IMGT Repertoire

    17 February 2003 - CREATION: Table of alleles: Human TRBC

    1. Creation of Table of alleles: Human TRBC in IMGT Repertoire

    07 February 2003 - CREATION: IMGT/GENE-DB

    1. Creation of IMGT/GENE-DB Query page in IMGT Genome and Structure databases
    2. Creation of IMGT/GENE-DB Documentation in IMGT Genome and Structure databases

    05 February 2003 - CREATION: Sterile transcript

    1. Creation of Sterile transcript in IMGT Index

    03 February 2003 - CREATION: Liens externes

    1. Creation of Liens externes in IMGT Education

    31 January 2003 - CREATION: IMGT/Phylogene

    1. Creation of IMGT/Phylogene in IMGT Index

    31 January 2003 - CREATION: IMGT/JunctionAnalysis

    1. Creation of IMGT/JunctionAnalysis in IMGT Index

    31 January 2003 - CREATION: IMGT/Allele-Align

    1. Creation of IMGT/Allele-Align in IMGT Index

    28 January 2003 - CREATION: Strand and loop lengths: Mouse (Mus musculus) MHC-II-Beta

    1. Creation of Strand and loop lengths: Mouse (Mus musculus) MHC-II-Beta in IMGT Repertoire

    28 January 2003 - CREATION: Strand and loop lengths: Mouse (Mus musculus) MHC-II-Alpha

    1. Creation of Strand and loop lengths: Mouse (Mus musculus) MHC-II-Alpha in IMGT Repertoire

    28 January 2003 - CREATION: Strand and loop lengths: Mouse (Mus musculus) Beta2-Microglobulin

    1. Creation of Strand and loop lengths: Mouse (Mus musculus) Beta2-Microglobulin in IMGT Repertoire

    28 January 2003 - CREATION: Strand and loop lengths: Mouse (Mus musculus) MHC-I-Alpha

    1. Creation of Strand and loop lengths: Mouse (Mus musculus) MHC-I-Alpha in IMGT Repertoire

    28 January 2003 - CREATION: Strand and loop lengths: Human (Homo sapiens) MHC-I-Alpha

    1. Creation of Strand and loop lengths: Human (Homo sapiens) MHC-Ib-Alpha in IMGT Repertoire

    28 January 2003 - CREATION: Strand and loop lengths: Human (Homo sapiens) MHC-II-Beta

    1. Creation of Strand and loop lengths: Human (Homo sapiens) MHC-II-Beta in IMGT Repertoire

    28 January 2003 - CREATION: Strand and loop lengths: Human (Homo sapiens) MHC-II-Alpha

    1. Creation of Strand and loop lengths: Human (Homo sapiens) MHC-II-Alpha in IMGT Repertoire

    28 January 2003 - CREATION: Strand and loop lengths: Human (Homo sapiens) Beta2-Microglobulin

    1. Creation of Strand and loop lengths: Human (Homo sapiens) Beta2-Microglobulin in IMGT Repertoire

    28 January 2003 - CREATION: Strand and loop lengths: Human (Homo sapiens) MHC-I-Alpha

    1. Creation of Strand and loop lengths: Human (Homo sapiens) MHC-I-Alpha in IMGT Repertoire

    20 January 2003 - CREATION: Colliers de Perles: Rabbit (Oryctolagus cuniculus) IGH C-REGION

    1. Creation of Colliers de Perles: Rabbit (Oryctolagus cuniculus) IGH C-REGION in IMGT Repertoire

    13 January 2003 - CREATION: Colliers de Perles: Sheep (Ovis aries) IGH C-REGION

    1. Creation of Colliers de Perles: Sheep (Ovis aries) IGH C-REGION in IMGT Repertoire

    13 January 2003 - CREATION: Colliers de Perles: Bovine (Bos taurus) IGH C-REGION

    1. Creation of Colliers de Perles: Bovine (Bos taurus) IGH C-REGION in IMGT Repertoire

    13 January 2003 - CREATION: Colliers de Perles: Arabian camel (Camelus dromedarius) IGH C-REGION

    1. Creation of Colliers de Perles: Arabian camel (Camelus dromedarius) IGH C-REGION in IMGT Repertoire

    13 January 2003 - CREATION: Colliers de Perles: South American short-tailed grey opossum (Monodelphis domestica) IGH C-REGION

    1. Creation of Colliers de Perles: South American short-tailed grey opossum (Monodelphis domestica) IGH C-REGION in IMGT Repertoire

    13 January 2003 - CREATION: Colliers de Perles: Silver-gray brushtail possum (Trichosurus vulpecula) IGH C-REGION

    1. Creation of Colliers de Perles: Silver-gray brushtail possum (Trichosurus vulpecula) IGH C-REGION in IMGT Repertoire

    2002

    24 December 2002 - CREATION: Brown trout (Salmo trutta) IGHC

    1. Creation of Gene and allele table: Brown trout (Salmo trutta) IGHC in IMGT Repertoire
    2. Creation of Alignments of alleles: Brown trout (Salmo trutta) IGH C-REGIONs in IMGT Repertoire

    16 December 2002 - CREATION: Strand and loop lengths (C-DOMAIN): Macaques (Macaca fascicularis, Macaca mulatta) IGH

    1. Creation of Strand and loop lengths (C-DOMAIN): Macaques (Macaca fascicularis, Macaca mulatta) IGH in IMGT Repertoire

    16 December 2002 - CREATION: Strand and loop lengths (C-DOMAIN): Chimpanzee (Pan troglodytes) IGH

    1. Creation of Strand and loop lengths (C-DOMAIN): Chimpanzee (Pan troglodytes) IGH in IMGT Repertoire

    16 December 2002 - CREATION: Strand and loop lengths (C-DOMAIN): Common gibbon (Hylobates lar) IGH

    1. Creation of Strand and loop lengths (C-DOMAIN): Common gibbon (Hylobates lar) IGH in IMGT Repertoire

    16 December 2002 - CREATION: Strand and loop lengths (C-DOMAIN): Gorilla (Gorilla gorilla) IGH

    1. Creation of Strand and loop lengths (C-DOMAIN): Gorilla (Gorilla gorilla) IGH in IMGT Repertoire

    16 December 2002 - CREATION: Strand and loop lengths (C-DOMAIN): Orangutan (Pongo pygmaeus) IGH

    1. Creation of Strand and loop lengths (C-DOMAIN): Orangutan (Pongo pygmaeus) IGH in IMGT Repertoire

    17 December 2002 - CREATION: Strand and loop lengths (C-DOMAIN): Sheep (Ovis aries) IGH

    1. Creation of Strand and loop lengths (C-DOMAIN): Sheep (Ovis aries) IGH in IMGT Repertoire

    05 December 2002 - CREATION: Sheep (Ovis aries) IGHV

    1. Creation of Table of alleles: Sheep (Ovis aries) IGHV in IMGT Repertoire
    2. Creation of Alignments of alleles: Sheep (Ovis aries) IGH V-REGION in IMGT Repertoire
    3. Creation of Protein display: Sheep (Ovis aries) IGH V-REGIONs in IMGT Repertoire
    4. Creation of Colliers de Perles: Sheep (Ovis aries) IGH V-REGIONs in IMGT Repertoire
    5. Creation of FR-IMGT and CDR-IMGT lengths: Sheep (Ovis aries) IGHV in IMGT Repertoire

    05 December 2002 - CREATION: Updates

    1. Creation of Updates in IMGT Index

    02 December 2002 - CREATION: Protein display: Human IGH V-REGIONs

    1. Creation of Protein display: Human IGH V-REGIONs in IMGT Repertoire

    18 November 2002 - CREATION: Sheep (Ovis aries) IGHJ

    1. Creation of Germline gene table: Sheep (Ovis aries) IGHJ in IMGT Repertoire
    2. Creation of Table of alleles: Sheep (Ovis aries) IGHJ in IMGT Repertoire
    3. Creation of Alignments of alleles: Sheep (Ovis aries) IGH J-REGION in IMGT Repertoire
    4. Creation of Protein display: Sheep (Ovis aries) IGH J-REGIONs in IMGT Repertoire

    15 November 2002 - CREATION: Macaques (Macaca arctoides, Macaca assamensis, Macaca cyclopis, Macaca fascicularis, Macaca mulatta, Macaca nemestrina, Macaca silenus, Macaca thibetana) IGHC

    1. Creation of Germline gene table: Macaques (Macaca arctoides, Macaca assamensis, Macaca cyclopis, Macaca fascicularis, Macaca mulatta, Macaca nemestrina, Macaca silenus, Macaca thibetana) IGHC in IMGT Repertoire
    2. Creation of Table of alleles: Macaques (Macaca arctoides, Macaca assamensis, Macaca cyclopis, Macaca fascicularis, Macaca mulatta, Macaca nemestrina, Macaca silenus, Macaca thibetana) IGHC in IMGT Repertoire
    3. Creation of Alignments of alleles: Macaques (Macaca arctoides, Macaca assamensis, Macaca cyclopis, Macaca fascicularis, Macaca nemestrina, Macaca silenus, Macaca thibetana) IGH C-REGION in IMGT Repertoire
    4. Creation of Protein display: Macaques (Macaca arctoides, Macaca assamensis, Macaca cyclopis, Macaca fascicularis, Macaca mulatta, Macaca nemestrina, Macaca silenus, Macaca thibetana) IGH C-REGIONs in IMGT Repertoire
    5. Creation of Colliers de Perles: Macaques (Macaca arctoides, Macaca assamensis, Macaca cyclopis, Macaca fascicularis, Macaca mulatta, Macaca nemestrina, Macaca silenus, Macaca thibetana) IGH C-DOMAIN in IMGT Repertoire

    15 November 2002 - CREATION: Chimpanzee (Pan troglodytes) IGHC

    1. Creation of Germline gene table: Chimpanzee (Pan troglodytes) IGHC in IMGT Repertoire
    2. Creation of Table of alleles: Chimpanzee (Pan troglodytes) IGHC in IMGT Repertoire
    3. Creation of Alignments of alleles: Chimpanzee (Pan troglodytes) IGH C-REGION in IMGT Repertoire
    4. Creation of Protein display: Chimpanzee (Pan troglodytes) IGH C-REGIONs in IMGT Repertoire
    5. Creation of Colliers de Perles: Chimpanzee (Pan troglodytes) IGH C-DOMAIN in IMGT Repertoire

    15 November 2002 - CREATION: Gorilla (Gorilla gorilla) IGHC

    1. Creation of Germline gene table: Gorilla (Gorilla gorilla) IGHC in IMGT Repertoire
    2. Creation of Table of alleles: Gorilla (Gorilla gorilla) IGHC in IMGT Repertoire
    3. Creation of Alignments of alleles: Gorilla (Gorilla gorilla) IGH C-REGION in IMGT Repertoire
    4. Creation of Protein display: Gorilla (Gorilla gorilla) IGH C-REGIONs in IMGT Repertoire
    5. Creation of Colliers de Perles: Gorilla (Gorilla gorilla) IGH C-DOMAIN in IMGT Repertoire

    15 November 2002 - CREATION: Orangutan (Pongo pygmaeus) IGHC

    1. Creation of Germline gene table: Orangutan (Pongo pygmaeus) IGHC in IMGT Repertoire
    2. Creation of Table of alleles: Orangutan (Pongo pygmaeus) IGHC in IMGT Repertoire
    3. Creation of Alignments of alleles: Orangutan (Pongo pygmaeus) IGH C-REGION in IMGT Repertoire
    4. Creation of Protein display: Orangutan (Pongo pygmaeus) IGH C-REGIONs in IMGT Repertoire
    5. Creation of Colliers de Perles: Orangutan (Pongo pygmaeus) IGH C-DOMAIN in IMGT Repertoire

    14 November 2002 - CREATION: The IMGT Immunoinformatics page

    1. Creation of The IMGT Immunoinformatics page in IMGT Bloc-notes

    13 November 2002 - CREATION: Germline gene table: Sheep (Ovis aries) IGHV

    1. Creation of Germline gene table: Sheep (Ovis aries) IGHV in IMGT Repertoire

    12 November 2002 - CREATION: Common gibbon (Hylobates lar) IGHC

    1. Creation of Germline gene table: Common gibbon (Hylobates lar) IGHC in IMGT Repertoire
    2. Creation of Table of alleles: Common gibbon (Hylobates lar) IGHC in IMGT Repertoire
    3. Creation of Alignments of alleles: Common gibbon (Hylobates lar) IGH C-REGION in IMGT Repertoire
    4. Creation of Protein display: Common gibbon (Hylobates lar) IGH C-REGIONs in IMGT Repertoire
    5. Creation of Colliers de Perles: Common gibbon (Hylobates lar) IGH C-DOMAIN in IMGT Repertoire

    12 November 2002 - CREATION: Isotypes: Human IGLC

    1. Creation of Isotypes: Human IGLC in IMGT Repertoire

    06 November 2002 - CREATION: Strand and loop lengths (C-DOMAIN): Bovine (Bos taurus) IGH

    1. Creation of Strand and loop lengths (C-DOMAIN): (Bos taurus) IGH in IMGT Repertoire

    06 November 2002 - CREATION: Strand and loop lengths (C-DOMAIN): Camel (Camelus dromedarius) IGH

    1. Creation of Strand and loop lengths (C-DOMAIN): Camel (Camelus dromedarius) IGH in IMGT Repertoire

    06 November 2002 - CREATION: Strand and loop lengths (C-DOMAIN): Common brush-tailed possum (Trichosurus vulpecula) IGH

    1. Creation of Strand and loop lengths (C-DOMAIN): Common brush-tailed possum (Trichosurus vulpecula) IGH in IMGT Repertoire

    06 November 2002 - CREATION: Strand and loop lengths (C-DOMAIN): Rat (Rattus norvegicus, Rattus rattus) IGH

    1. Creation of Strand and loop lengths (C-DOMAIN): Rat (Rattus norvegicus, Rattus rattus) IGH in IMGT Repertoire

    06 November 2002 - CREATION: Strand and loop lengths (C-DOMAIN): South American short-tailed grey opossum (Monodelphis domestica) IGH

    1. Creation of Strand and loop lengths (C-DOMAIN): South American short-tailed grey opossum (Monodelphis domestica) IGH in IMGT Repertoire

    06 November 2002 - CREATION: Strand and loop lengths (C-DOMAIN): Dog (Canis lupus familiaris) IGH

    1. Creation of Strand and loop lengths (C-DOMAIN): Dog (Canis lupus familiaris) IGH in IMGT Repertoire

    06 November 2002 - CREATION: Strand and loop lengths (C-DOMAIN): Horse (Equus caballus) IGH

    1. Creation of Strand and loop lengths (C-DOMAIN): Horse (Equus caballus) IGH in IMGT Repertoire

    06 November 2002 - CREATION: Strand and loop lengths (C-DOMAIN): Rabbit (Oryctolagus cuniculus) IGH

    1. Creation of Strand and loop lengths (C-DOMAIN): Rabbit (Oryctolagus cuniculus) IGH in IMGT Repertoire

    05 November 2002 - CREATION: IMGT numbering of additional codons (or amino acids) and corresponding nucleotides

    1. Creation of IMGT numbering of additional codons (or amino acids) and corresponding nucleotides in IMGT Scientific chart

    23 October 2002 - CREATION: FASTA format

    1. Creation of FASTA format in IMGT Index

    23 October 2002 - CREATION: CLUSTAL format

    1. Creation of CLUSTAL format in IMGT Index

    23 October 2002 - CREATION: Rat (Rattus norvegicus, Rattus rattus) IGHC

    1. Creation of Germline gene table: Rat (Rattus norvegicus, Rattus rattus) IGHC in IMGT Repertoire
    2. Creation of Table of alleles: Rat (Rattus norvegicus, Rattus rattus) IGHC in IMGT Repertoire
    3. Creation of Alignments of alleles: Rat (Rattus norvegicus, Rattus rattus) IGH C-REGION in IMGT Repertoire
    4. Creation of Protein display: Rat ( Rattus norvegicus, Rattus rattus) IGH C-REGIONs in IMGT Repertoire
    5. Creation of Colliers de Perles: Rat (Rattus norvegicus, Rattus rattus) IGH C-DOMAIN in IMGT Repertoire

    22 October 2002 - CREATION: Dog (Canis lupus familiaris) IGHC

    1. Creation of Gene and allele table: Dog (Canis lupus familiaris) IGHC in IMGT Repertoire
    2. Creation of Alignments of alleles: Dog (Canis lupus familiaris) IGH C-REGION in IMGT Repertoire
    3. Creation of Protein display: Dog (Canis lupus familiaris) IGH C-REGIONs in IMGT Repertoire
    4. Creation of Colliers de Perles: Dog (Canis lupus familiaris) IGH C-DOMAIN in IMGT Repertoire

    04 September 2002 - CREATION: Access to IMGT from GenBank Entrez, using the new LinkOut feature at NCBI

    30 August 2002 - UPDATE: IMGT/GeneSearch, IMGT/GeneView and IMGT/LocusView: human TRA/TRD

    1. Update of IMGT/GeneSearch in IMGT Genome and Structure databases: Addition of the human TRA/TRD genes
    2. Update of IMGT/GeneView in IMGT Genome and Structure databases: Addition of the human TRA/TRD genes
    3. Update of IMGT/LocusView in IMGT Genome and Structure databases: Addition of the human TRA/TRD locus

    26 July 2002 - UPDATE: IMGT reference directory in FASTA format: Teleostei IGHV sets

    1. Update of IMGT reference directory: Teleostei IGHV set in IMGT reference directory in FASTA format (IMGT Repertoire) : Contains now IMGT reference sequences from 13 Teleostei species

    19 July 2002 - CREATION: Lists of Mouse (Mus musculus) IG and TR genes, groups and loci and links between IMGT, MGD and Entrez Gene

    1. Creation of the Lists of Mouse (Mus musculus) IG and TR genes, groups and loci and links between IMGT, MGD and Entrez Gene in IMGT Repertoire > Locus and genes

    16 July 2002 - CREATION: Collier de Perles: Bastard halibut (Paralichthys olivaceus) IGHV1S3

    1. Creation of Collier de Perles: Bastard halibut (Paralichthys olivaceus) IGHV1S3 in IMGT Repertoire

    10 July 2002 - UPDATE: IMGT/GeneSearch, IMGT/GeneView and IMGT/LocusView: human IGH

    1. Update of IMGT/GeneSearch in IMGT Genome and Structure databases: Addition of the human IGH genes
    2. Update of IMGT/GeneView in IMGT Genome and Structure databases: Addition of the human IGH genes
    3. Update of IMGT/LocusView in IMGT Genome and Structure databases: Addition of the human IGH locus

    01 July 2002 - UPDATE: Human IGHV

    1. Update of Germline gene table: Human IGHV in IMGT Repertoire
    2. Update of Correspondence between the different gene nomenclatures: Human IGHV in IMGT Repertoire
    3. Update of Table of alleles: Human IGHV in IMGT Repertoire
    4. Update of Alignments of alleles: Human IGH V-REGION in IMGT Repertoire
    5. Update of Protein display: Human IGH V-REGIONs in IMGT Repertoire
    6. Update of Colliers de Perles: Human IGH V-REGIONs in IMGT Repertoire

    21 June 2002 - CREATION: LIGM team images

    1. Creation of LIGM team images in IMGT Information

    20 June 2002 - CREATION: Spotted wolffish (Anarhichas minor) IGIV

    1. Creation of Table of alleles: Spotted wolffish (Anarhichas minor) IGL1V in IMGT Repertoire
    2. Creation of Alignments of alleles: Spotted wolffish (Anarhichas minor) IGL1 V-REGIONs in IMGT Repertoire
    3. Creation of Protein display: Spotted wolffish (Anarhichas minor) IGL1 V-REGIONs in IMGT Repertoire
    4. Creation of Collier of Perles: Spotted wolffish (Anarhichas minor) IGL1 V-REGION in IMGT Repertoire

    20 June 2002 - CREATION: Spotted wolffish (Anarhichas minor) IGIC

    1. Creation of Alignments of alleles: Spotted wolffish (Anarhichas minor) IGL1 C-REGIONs in IMGT Repertoire
    2. Creation of Protein display: Spotted wolffish (Anarhichas minor) IGL1 C-REGIONs in IMGT Repertoire

    20 June 2002 - CREATION: Horse (Equus caballus ) IGHC

    1. Creation of Gene and allele table: Horse (Equus caballus ) IGHC in IMGT Repertoire
    2. Creation of Alignments of alleles: Horse (Equus caballus ) IGH C-REGION in IMGT Repertoire
    3. Creation of Protein display: Horse (Equus caballus ) IGH C-REGIONs in IMGT Repertoire

    03 June 2002 - CREATION: IMGT/Allele-Align

    1. Creation of IMGT/Allele-Align in IMGT tools and other accesses

    23 May 2002 - UPDATE: Human TRAV

    1. Update of Table of alleles: Human TRAV in IMGT Repertoire
    2. Update of Alignments of alleles: Human TRA V-REGION in IMGT Repertoire
    3. Update of Colliers de Perles: Human TRA V-REGIONs in IMGT Repertoire

    17 May 2002 - CREATION: Les récepteurs à activité tyrosine kinase (TRKs) réarrangés dans les hémopathies malignes

    1. Creation of Les récepteurs à activité tyrosine kinase (TRKs) réarrangés dans les hémopathies malignes in IMGT Education

    17 May 2002 - CREATION: Dérégulation moléculaire et cancer : prolifération, survie et inhibition de l'apoptose

    1. Creation of Dérégulation moléculaire et cancer : prolifération, survie et inhibition de l'apoptose in IMGT Education

    17 May 2002 - CREATION: Translocations chromosomiques et cancers

    1. Creation of Translocations chromosomiques et cancers in IMGT Education

    17 May 2002 - CREATION: Spectacled caiman (Caiman crocodilus) IGHV

    1. Creation of Germline gene table: Spectacled caiman (Caiman crocodilus) IGHV in IMGT Repertoire
    2. Creation of Table of alleles: Spectacled caiman (Caiman crocodilus) IGHV in IMGT Repertoire
    3. Creation of Alignments of alleles: Spectacled caiman (Caiman crocodilus) IGH V-REGION in IMGT Repertoire
    4. Creation of Protein display: Spectacled caiman (Caiman crocodilus) IGH V-REGIONs in IMGT Repertoire
    5. Creation of FR-IMGT and CDR-IMGT lengths: Spectacled caiman (Caiman crocodilus) IGHV in IMGT Repertoire
    6. Creation of Collier of Perles: Spectacled caiman (Caiman crocodilus) IGH V-REGION in IMGT Repertoire

    14 May 2002 - CREATION: Protein display: Mouse TRA, TRB, TRG and TRD C-REGIONs

    1. Creation of Protein display: Mouse TRA, TRB, TRG and TRD C-REGIONs in IMGT Repertoire

    14 May 2002 - CREATION: Mouse IGKV

    1. Creation of Alignments of alleles: Mouse IGK V-REGION in IMGT Repertoire
    2. Creation of Colliers de Perles: Mouse IGK V-REGIONs in IMGT Repertoire

    07 May 2002 - CREATION: Table of alleles: Mouse (Mus musculus, Mus spretus) IGKV

    1. Creation of Table of alleles: Mouse (Mus musculus, Mus spretus) IGKV in IMGT Repertoire

    03 May 2002 - UPDATE: IMGT/GeneSearch, IMGT/GeneView and IMGT/LocusView: human MHC

    1. Update of IMGT/GeneSearch in IMGT Genome and Structure databases: Addition of the human MHC genes
    2. Update of IMGT/GeneView in IMGT Genome and Structure databases: Addition of the human MHC genes
    3. Update of IMGT/LocusView in IMGT Genome and Structure databases: Addition of the human MHC locus

    30 April 2002 - CREATION: Cancer

    1. Creation of Cancer in IMGT Education

    26 April 2002 - CREATION: Atlantic halibut (Hippoglossus hippoglossus) IGHC

    1. Creation of Gene and allele table: Atlantic halibut (Hippoglossus hippoglossus) IGHC in IMGT Repertoire
    2. Creation of Alignments of alleles: Atlantic halibut (Hippoglossus hippoglossus) IGH C-REGION in IMGT Repertoire

    26 April 2002 - CREATION: Llama (Lama glama) IGHJ

    1. Creation of Germline gene table: Llama (Lama glama) IGHJ in IMGT Repertoire
    2. Creation of Table of alleles: Llama (Lama glama) IGHJ in IMGT Repertoire
    3. Creation of Alignments of alleles: Llama (Lama glama) IGH J-REGION in IMGT Repertoire
    4. Creation of Protein display: Llama (Lama glama) IGHJ in IMGT Repertoire

    26 April 2002 - CREATION: Atlantic cod (Gadus morhua) IGIC

    1. Creation of Gene and allele table: Atlantic cod (Gadus morhua) IGL2C in IMGT Repertoire
    2. Creation of Alignments of alleles: Atlantic cod (Gadus morhua) IGI C-REGION in IMGT Repertoire
    3. Creation of Protein display: Atlantic cod (Gadus morhua) IGL2C in IMGT Repertoire

    08 April 2002 - CREATION: Chromosomal orphon set

    1. Creation of Chromosomal orphon set in IMGT Index

    08 April 2002 - CREATION: @ "arrobas"

    1. Creation of @ in IMGT Index

    08 April 2002 - UPDATE: Mouse (Mus musculus, Mus spretus) IGKV

    1. Update of Germline gene and allele table: Mouse (Mus musculus, Mus spretus) IGKV in IMGT Repertoire

    20 March 2002 - CREATION: Atlantic cod (Gadus morhua) IGIJ

    1. Creation of Germline gene table: Atlantic cod (Gadus morhua) IGIJ in IMGT Repertoire
    2. Creation of Table of alleles: Atlantic cod (Gadus morhua) IGIJ in IMGT Repertoire
    3. Creation of Alignments of alleles: Atlantic cod (Gadus morhua) IGI J-REGION in IMGT Repertoire
    4. Creation of Protein display: Atlantic cod (Gadus morhua) IGIJ in IMGT Repertoire

    19 March 2002 - CREATION: Spotted wolffish (Anarhichas minor) IGHV

    1. Creation of Protein display: Spotted wolffish (Anarhichas minor) IGH V-REGION in IMGT Repertoire

    19 March 2002 - CREATION: Goldfish (Carassius auratus) IGHV

    1. Creation of Protein display: Goldfish (Carassius auratus) IGH V-REGION in IMGT Repertoire
    2. Creation of Colliers de perles: Goldfish (Carassius auratus) IGH V-REGION in IMGT Repertoire

    19 March 2002 - CREATION: Torafugu (Takifugu rubripes) IGHV

    1. Creation of Protein display: Torafugu (Takifugu rubripes) IGH V-REGION in IMGT Repertoire
    2. Creation of Colliers de perles: Torafugu (Takifugu rubripes) IGH V-REGION in IMGT Repertoire

    19 March 2002 - CREATION: Emerald rockcod (Trematomus bernacchii) IGHV

    1. Creation of Table of alleles: Emerald rockcod (Trematomus bernacchii) IGHV in IMGT Repertoire
    2. Creation of Alignments of alleles: Emerald rockcod (Trematomus bernacchii) IGH V-REGION in IMGT Repertoire
    3. Creation of Protein display: Emerald rockcod (Trematomus bernacchii) IGH V-REGION in IMGT Repertoire
    4. Creation of Colliers de perles: Emerald rockcod (Trematomus bernacchii) IGH V-REGION in IMGT Repertoire

    04 March 2002 - CREATION: Arabian camel(Camelus dromedarius) IGHV

    1. Creation of Germline gene table: Arabian camel (Camelus dromedarius) IGHV in IMGT Repertoire
    2. Creation of Table of alleles: Arabian camel (Camelus dromedarius) IGHV in IMGT Repertoire
    3. Creation of Alignments of alleles: Arabian camel (Camelus dromedarius) IGH V-REGION in IMGT Repertoire
    4. Creation of Protein display: Arabian camel (Camelus dromedarius) IGH V-REGION in IMGT Repertoire
    5. Creation of Table of FR-IMGT and CDR-IMGT length: Arabian camel (Camelus dromedarius) IGHV in IMGT Repertoire
    6. Creation of Colliers de perles: Arabian camel (Camelus dromedarius) IGH V-REGION in IMGT Repertoire

    04 March 2002 - CREATION: Llama (Lama glama) IGHV

    1. Creation of Germline gene table: Llama (Lama glama) IGHV in IMGT Repertoire
    2. Creation of Table of alleles: Llama (Lama glama) IGHV in IMGT Repertoire
    3. Creation of Alignments of alleles: Llama (Lama glama) IGH V-REGION in IMGT Repertoire
    4. Creation of Protein display: Llama (Lama glama) IGH V-REGION in IMGT Repertoire
    5. Creation of Table of FR-IMGT and CDR-IMGT length: Llama (Lama glama) IGHV in IMGT Repertoire
    6. Creation of Colliers de perles: Llama (Lama glama) IGH V-REGION in IMGT Repertoire

    27 February 2002 - CREATION: IMGT/LIGM-DB Sequence submission

    1. Creation of IMGT/LIGM-DB Sequence submission in IMGT tools and other accesses

    14 February 2002 - CREATION: Antibodies (or Immunoglobulins)

    1. Creation of Antibodies (or Immunoglobulins) in IMGT Index

    14 February 2002 - CREATION: T cell receptors

    1. Creation of T cell receptors in IMGT Index

    14 February 2002 - CREATION: Reagents monoclonal antibodies: anti-human

    1. Creation of Reagents monoclonal antibodies: anti-human TRAV in IMGT Repertoire
    2. Creation of Reagents monoclonal antibodies: anti-human TRDV in IMGT Repertoire
    3. Creation of Reagents monoclonal antibodies: anti-human TRGV in IMGT Repertoire

    10 Fabruary 2002 - CREATION: IMGT/PhyloGene

    1. Creation of IMGT/PhyloGene in IMGT tools and other accesses
    2. Creation of IMGT/Documentation in IMGT tools and other accesses

    08 February 2002 - CREATION: Correspondence between G numberings for MHC G-DOMAIN

    1. Creation of Correspondence between G numberings for MHC G-DOMAIN in IMGT Scientific chart

    08 February 2002 - CREATION: Protein display: Bovine (Bos taurus) IGH C-REGIONs

    1. Creation of Protein display: Bovine (Bos taurus) IGH C-REGIONs in IMGT Repertoire

    08 February 2002 - CREATION: Sheep (Ovis aries) IGHC

    1. Creation of Alignments of alleles: Sheep (Ovis aries) IGH C-REGION in IMGT Repertoire
    2. Creation of Protein display: Sheep (Ovis aries) IGH C-REGIONs in IMGT Repertoire

    February 2002 - CREATION: IMGT/3Dstructure-DB

    1. IMGT News (English)
    2. IMGT News (French)

    31 January 2002 - CREATION: Spotted wobbegong shark (Orectolobus maculatus) IGH

    1. Creation of Gene and allele table: Spotted wobbegong shark (Orectolobus maculatus) IGHJ in IMGT Repertoire
    2. Creation of Gene and allele table: Spotted wobbegong shark (Orectolobus maculatus) IGHJ in IMGT Repertoire
    3. Creation of Gene and allele table: Spotted wobbegong shark (Orectolobus maculatus) IGHD in IMGT Repertoire
    4. Creation of Gene and allele table: Spotted wobbegong shark (Orectolobus maculatus) IGHC in IMGT Repertoire
    5. Creation of Alignments of alleles: Spotted wobbegong shark (Orectolobus maculatus) IGH V-REGION in IMGT Repertoire
    6. Creation of Alignments of alleles: Spotted wobbegong shark (Orectolobus maculatus) IGH J-REGION in IMGT Repertoire
    7. Creation of Alignments of alleles: Spotted wobbegong shark (Orectolobus maculatus) IGH D-REGION in IMGT Repertoire
    8. Creation of Alignments of alleles: Spotted wobbegong shark (Orectolobus maculatus) IGH C-REGION in IMGT Repertoire
    9. Creation of Protein display: Spotted wobbegong shark (Orectolobus maculatus) IGH V-REGIONs in IMGT Repertoire
    10. Creation of Protein display: Spotted wobbegong shark (Orectolobus maculatus) IGH J-REGIONs in IMGT Repertoire
    11. Creation of Protein display: Spotted wobbegong shark (Orectolobus maculatus) IGH C-REGIONs in IMGT Repertoire
    12. Creation of Table of FR-IMGT and CDR-IMGT length: Spotted wobbegong shark (Orectolobus maculatus) IGHV in IMGT Repertoire

    31 January 2002 - CREATION: Spotted ratfish (Hydrolagus colliei) IGH

    1. Creation of Cassette gene content: Spotted ratfish (Hydrolagus colliei) IGH in IMGT Repertoire
    2. Creation of Gene and allele table: Spotted ratfish (Hydrolagus colliei) IGHJ in IMGT Repertoire
    3. Creation of Gene and allele table: Spotted ratfish (Hydrolagus colliei) IGHD in IMGT Repertoire
    4. Creation of Gene and allele table: Spotted ratfish (Hydrolagus colliei) IGHC in IMGT Repertoire
    5. Creation of Alignments of alleles: Spotted ratfish (Hydrolagus colliei) IGH J-REGION in IMGT Repertoire
    6. Creation of Alignments of alleles: Spotted ratfish (Hydrolagus colliei) IGH D-REGION in IMGT Repertoire
    7. Creation of Alignments of alleles: Spotted ratfish (Hydrolagus colliei) IGH C-REGION in IMGT Repertoire
    8. Creation of Protein display: Spotted ratfish (Hydrolagus colliei) IGH J-REGIONs in IMGT Repertoire
    9. Creation of Protein display: Spotted ratfish (Hydrolagus colliei) IGH C-REGIONs in IMGT Repertoire

    31 January 2002 - UPDATE: Spotted ratfish (Hydrolagus colliei) IGHV

    1. Update of Gene and allele table: Spotted ratfish (Hydrolagus colliei) IGHV in IMGT Repertoire
    2. Update of Alignments of alleles: Spotted ratfish (Hydrolagus colliei) IGH V-REGION in IMGT Repertoire
    3. Update of Protein display: Spotted ratfish (Hydrolagus colliei) IGH V-REGIONs in IMGT Repertoire

    31 January 2002 - CREATION: Sandbar shark (Carcharhinus plumbeus) IGH

    1. Creation of Cassette gene content: Sandbar shark (Carcharhinus plumbeus) IGH in IMGT Repertoire
    2. Creation of Gene and allele table: Sandbar shark (Carcharhinus plumbeus) IGHJ in IMGT Repertoire
    3. Creation of Gene and allele table: Sandbar shark (Carcharhinus plumbeus) IGHD in IMGT Repertoire
    4. Creation of Gene and allele table: Sandbar shark (Carcharhinus plumbeus) IGHC in IMGT Repertoire
    5. Creation of Alignments of alleles: Sandbar shark (Carcharhinus plumbeus) IGH J-REGION in IMGT Repertoire
    6. Creation of Alignments of alleles: Sandbar shark (Carcharhinus plumbeus) IGH D-REGION in IMGT Repertoire
    7. Creation of Alignments of alleles: Sandbar shark (Carcharhinus plumbeus) IGH C-REGION in IMGT Repertoire
    8. Creation of Protein display: Sandbar shark (Carcharhinus plumbeus) IGH J-REGIONs in IMGT Repertoire
    9. Creation of Protein display: Sandbar shark (Carcharhinus plumbeus) IGH C-REGIONs in IMGT Repertoire

    31 January 2002 - UPDATE: Sandbar shark (Carcharhinus plumbeus) IGHV

    1. Update of Gene and allele table: Sandbar shark (Carcharhinus plumbeus) IGHV in IMGT Repertoire
    2. Update of Alignments of alleles: Sandbar shark (Carcharhinus plumbeus) IGH V-REGION in IMGT Repertoire
    3. Update of Protein display: Sandbar shark (Carcharhinus plumbeus) IGH V-REGIONs in IMGT Repertoire

    31 January 2002 - CREATION: Nurse shark (Ginglymostoma cirratum) IGH

    1. Creation of Cassette gene content: Nurse shark (Ginglymostoma cirratum) IGH in IMGT Repertoire
    2. Creation of Gene and allele table: Nurse shark (Ginglymostoma cirratum) IGHJ in IMGT Repertoire
    3. Creation of Gene and allele table: Nurse shark (Ginglymostoma cirratum) IGHD in IMGT Repertoire
    4. Creation of Gene and allele table: Nurse shark (Ginglymostoma cirratum) IGHC in IMGT Repertoire
    5. Creation of Alignments of alleles: Nurse shark (Ginglymostoma cirratum) IGH J-REGION in IMGT Repertoire
    6. Creation of Alignments of alleles: Nurse shark (Ginglymostoma cirratum) IGH D-REGION in IMGT Repertoire
    7. Creation of Alignments of alleles: Nurse shark (Ginglymostoma cirratum) IGH C-REGION in IMGT Repertoire
    8. Creation of Protein display: Nurse shark (Ginglymostoma cirratum) IGH J-REGIONs in IMGT Repertoire
    9. Creation of Protein display: Nurse shark (Ginglymostoma cirratum) IGH C-REGIONs in IMGT Repertoire
    10. Creation of Table of FR-IMGT and CDR-IMGT length: Nurse shark (Ginglymostoma cirratum) IGHV in IMGT Repertoire

    31 January 2002 - UPDATE: Nurse shark (Ginglymostoma cirratum) IGHV

    1. Update of Gene and allele table: Nurse shark (Ginglymostoma cirratum) IGHV in IMGT Repertoire
    2. Update of Alignments of alleles: Nurse shark (Ginglymostoma cirratum) IGH V-REGION in IMGT Repertoire
    3. Update of Protein display: Nurse shark (Ginglymostoma cirratum) IGH V-REGIONs in IMGT Repertoire

    31 January 2002 - CREATION: Little skate (Leucoraja erinacea) IGH

    1. Creation of Cassette gene content: Little skate (Leucoraja erinacea) IGH in IMGT Repertoire
    2. Creation of Gene and allele table: Little skate (Leucoraja erinacea) IGHJ in IMGT Repertoire
    3. Creation of Gene and allele table: Little skate (Leucoraja erinacea) IGHD in IMGT Repertoire
    4. Creation of Gene and allele table: Little skate (Leucoraja erinacea) IGHC in IMGT Repertoire
    5. Creation of Alignments of alleles: Little skate (Leucoraja erinacea) IGH J-REGION in IMGT Repertoire
    6. Creation of Alignments of alleles: Little skate (Leucoraja erinacea) IGH D-REGION in IMGT Repertoire
    7. Creation of Alignments of alleles: Little skate (Leucoraja erinacea) IGH C-REGION in IMGT Repertoire
    8. Creation of Protein display: Little skate (Leucoraja erinacea) IGH J-REGIONs in IMGT Repertoire
    9. Creation of Protein display: Little skate (Leucoraja erinacea) IGH C-REGIONs in IMGT Repertoire

    31 January 2002 - UPDATE: Little skate (Leucoraja erinacea) IGHV

    1. Update of Gene and allele table: Little skate (Leucoraja erinacea) IGHV in IMGT Repertoire
    2. Update of Alignments of alleles: Little skate (Leucoraja erinacea) IGH V-REGION in IMGT Repertoire
    3. Update of Protein display: Little skate (Leucoraja erinacea) IGH V-REGIONs in IMGT Repertoire

    31 January 2002 - CREATION: Horn shark (Heterodontus francisci) IGH

    1. Creation of Cassette gene content: Horn shark (Heterodontus francisci) IGH in IMGT Repertoire
    2. Creation of Gene and allele table: Horn shark (Heterodontus francisci) IGHJ in IMGT Repertoire
    3. Creation of Gene and allele table: Horn shark (Heterodontus francisci) IGHD in IMGT Repertoire
    4. Creation of Gene and allele table: Horn shark (Heterodontus francisci) IGHC in IMGT Repertoire
    5. Creation of Alignments of alleles: Horn shark (Heterodontus francisci) IGH J-REGION in IMGT Repertoire
    6. Creation of Alignments of alleles: Horn shark (Heterodontus francisci) IGH D-REGION in IMGT Repertoire
    7. Creation of Alignments of alleles: Horn shark (Heterodontus francisci) IGH C-REGION in IMGT Repertoire
    8. Creation of Protein display: Horn shark (Heterodontus francisci) IGH J-REGIONs in IMGT Repertoire
    9. Creation of Protein display: Horn shark (Heterodontus francisci) IGH C-REGIONs in IMGT Repertoire

    31 January 2002 - UPDATE: Horn shark (Heterodontus francisci) IGHV

    1. Update of Gene and allele table: Horn shark (Heterodontus francisci) IGHV in IMGT Repertoire
    2. Update of Alignments of alleles: Horn shark (Heterodontus francisci) IGH V-REGION in IMGT Repertoire
    3. Update of Protein display: Horn shark (Heterodontus francisci) IGH V-REGIONs in IMGT Repertoire

    31 January 2002 - CREATION: Clearnose skate (Raja eglantaria) IGH

    1. Creation of Cassette gene content: Clearnose skate (Raja eglantaria) IGH in IMGT Repertoire
    2. Creation of Gene and allele table: Clearnose skate (Raja eglantaria) IGHJ in IMGT Repertoire
    3. Creation of Gene and allele table: Clearnose skate (Raja eglantaria) IGHD in IMGT Repertoire
    4. Creation of Gene and allele table: Clearnose skate (Raja eglantaria) IGHC in IMGT Repertoire
    5. Creation of Alignments of alleles: Clearnose skate (Raja eglantaria) IGH J-REGION in IMGT Repertoire
    6. Creation of Alignments of alleles: Clearnose skate (Raja eglantaria) IGH D-REGION in IMGT Repertoire
    7. Creation of Alignments of alleles: Clearnose skate (Raja eglantaria) IGH C-REGION in IMGT Repertoire
    8. Creation of Protein display: Clearnose skate (Raja eglantaria) IGH J-REGIONs in IMGT Repertoire
    9. Creation of Protein display: Clearnose skate (Raja eglantaria) IGH C-REGIONs in IMGT Repertoire

    31 January 2002 - UPDATE: Clearnose skate (Raja eglantaria) IGHV

    1. Update of Gene and allele table: Clearnose skate (Raja eglantaria) IGHV in IMGT Repertoire
    2. Update of Alignments of alleles: Clearnose skate (Raja eglantaria) IGH V-REGION in IMGT Repertoire
    3. Update of Protein display: Clearnose skate (Raja eglantaria) IGH V-REGIONs in IMGT Repertoire

    31 January 2002 - CREATION: Bull shark (Carcharhinus leucas) IGH

    1. Creation of Cassette gene content: Bull shark (Carcharhinus leucas) IGH in IMGT Repertoire
    2. Creation of Gene and allele table: Bull shark (Carcharhinus leucas) IGHJ in IMGT Repertoire
    3. Creation of Gene and allele table: Bull shark (Carcharhinus leucas) IGHD in IMGT Repertoire
    4. Creation of Alignments of alleles: Bull shark (Carcharhinus leucas) IGH J-REGION in IMGT Repertoire
    5. Creation of Alignments of alleles: Bull shark (Carcharhinus leucas) IGH D-REGION in IMGT Repertoire
    6. Creation of Protein display: Bull shark (Carcharhinus leucas) IGH J-REGIONs in IMGT Repertoire

    31 January 2002 - UPDATE: Bull shark (Carcharhinus leucas) IGHV

    1. Update of Gene and allele table: Bull shark (Carcharhinus leucas) IGHV in IMGT Repertoire
    2. Update of Alignments of alleles: Bull shark (Carcharhinus leucas) IGH V-REGION in IMGT Repertoire
    3. Update of Protein display: Bull shark (Carcharhinus leucas) IGH V-REGIONs in IMGT Repertoire

    31 January 2002 - CREATION: Atlantic cod (Gadus morhua) IGHV

    1. Creation of Table of alleles: Atlantic cod (Gadus morhua) IGHV in IMGT Repertoire
    2. Creation of Alignments of alleles: Atlantic cod (Gadus morhua) IGH V-REGION in IMGT Repertoire

    31 January 2002 - CREATION: Correspondence between chain types and C genes : IG and TR (all vertebrate species)

    1. Creation of Correspondence between chain types and C genes : IG and TR (all vertebrate species) in IMGT Repertoire

    31 January 2002 - CREATION: Isotype

    1. Creation of Isotype in IMGT Index

    31 January 2002 - CREATION: Cassette

    1. Creation of Cassette in IMGT Index

    31 January 2002 - UPDATE: IMGT/3Dstructure-DB

    1. Update of IMGT/3Dstructure-DB Documentation in IMGT Genome and Structure databases

    28 January 2002 - UPDATE: IMGT/GeneSearch, IMGT/GeneView and IMGT/LocusView: mouse TRA/TRD

    1. Update of IMGT/GeneSearch in IMGT Genome and Structure databases: Addition of the mouse TRA/TRD genes
    2. Update of IMGT/GeneView in IMGT Genome and Structure databases: Addition of the mouse TRA/TRD genes
    3. Update of IMGT/LocusView in IMGT Genome and Structure databases: Addition of the mouse TRA/TRD locus

    08 January 2002 - CREATION: South American short-tailed grey opossum (Monodelphis domestica) IGHC

    1. Creation of Gene and allele table: Gray short-tailed opossum (Monodelphis domestica) IGHC in IMGT Repertoire
    2. Creation of Alignments of alleles: South American short-tailed grey opossum (Monodelphis domestica) IGH C-REGION in IMGT Repertoire
    3. Creation of Protein display: South American short-tailed grey opossum (Monodelphis domestica) IGH C-REGIONs in IMGT Repertoire

    08 January 2002 - CREATION: Sylver-gray brushtail possum (Trichosurus vulpecula) IGHC

    1. Creation of Gene and allele table: Sylver-gray brushtail possum (Trichosurus vulpecula) IGHC in IMGT Repertoire
    2. Creation of Alignments of alleles: Sylver-gray brushtail possum (Trichosurus vulpecula) IGH C-REGION in IMGT Repertoire
    3. Creation of Protein display: Sylver-gray brushtail possum (Trichosurus vulpecula) IGH C-REGIONs in IMGT Repertoire

    08 January 2002 - CREATION: Mouse (Mus musculus) IGHC

    1. Creation of Gene and allele table: Mouse (Mus musculus) IGHC in IMGT Repertoire
    2. Creation of Alignments of alleles: Mouse (Mus musculus) IGH C-REGION in IMGT Repertoire
    3. Creation of Protein display: Mouse (Mus musculus) IGH C-REGIONs in IMGT Repertoire

    04 January 2002 - CREATION: LIGM team images

    1. Creation of LIGM team images in IMGT Information

    2001

    11 December 2001 - CREATION: Atlantic salmon (Salmo salar) IGHV

    1. Creation of Table of alleles: Atlantic salmon (Salmo salar) IGHV in IMGT Repertoire
    2. Creation of Alignments of alleles: Atlantic salmon (Salmo salar) IGH V-REGION in IMGT Repertoire

    07 December 2001 - CREATION: Protein display: Rainbow trout (Oncorhynchus mykiss) IGH V-REGIONs

    1. Creation of Protein display: Rainbow trout (Oncorhynchus mykiss) IGH V-REGIONs in IMGT Repertoire

    06 December 2001 - CREATION: Bovine (Bos taurus) TRGJ

    1. Creation of Gene table: Bovine (Bos taurus) TRGJ in IMGT Repertoire
    2. Creation of Table of alleles: Bovine (Bos taurus) TRGJ in IMGT Repertoire
    3. Creation of Alignments of alleles: Bovine (Bos taurus) TRG J-REGION in IMGT Repertoire
    4. Creation of Protein display: Bovine (Bos taurus) TRG J-REGIONs in IMGT Repertoire

    05 December 2001 - CREATION: Collier de Perles: Human PIGR domain 1 (V-LIKE-DOMAIN)

    1. Creation of Collier de Perles: Human PIGR domain 1 (V-LIKE-DOMAIN) in IMGT Repertoire

    04 December 2001 - CREATION: CDR1-IMGT lengths: Human and Mouse (Mus musculus) Immunoglobulins

    1. Creation of CDR1-IMGT lengths: Human and Mouse (Mus musculus) Immunoglobulins in IMGT Repertoire

    04 December 2001 - CREATION: CDR1-IMGT lengths: Human and Mouse (Mus musculus) T cell receptors

    1. Creation of CDR1-IMGT lengths: Human and Mouse (Mus musculus) T cell receptors in IMGT Repertoire

    04 December 2001 - CREATION: CDR2-IMGT lengths: Human and Mouse (Mus musculus) Immunoglobulins

    1. Creation of CDR2-IMGT lengths: Human and Mouse (Mus musculus) Immunoglobulins in IMGT Repertoire

    04 December 2001 - CREATION: CDR2-IMGT lengths: Human and Mouse (Mus musculus) T cell receptors

    1. Creation of CDR2-IMGT lengths: Human and Mouse (Mus musculus) T cell receptors in IMGT Repertoire

    27 November 2001 - CREATION: Collier de Perles Turkey (Meleagris gallopavo) telokin (C-LIKE-DOMAIN)

    1. Creation of Collier de Perles Turkey (Meleagris gallopavo) telokin (C-LIKE-DOMAIN) in IMGT Repertoire

    27 November 2001 - CREATION: 3D representation Turkey (Meleagris gallopavo) telokin (C-LIKE-DOMAIN) (PDB: 1fhg_A)

    1. Creation of 3D representation Turkey (Meleagris gallopavo) telokin (C-LIKE-DOMAIN) (PDB: 1fhg_A) in IMGT Repertoire

    27 November 2001 - CREATION: 3D representation C-LIKE-DOMAIN

    1. Creation of 3D representation: Human B2M domain (C-LIKE-DOMAIN ) (PDB: 1a1m_B) in IMGT Repertoire
    2. Creation of 3D representation: Human HLA-DMA domain 2 (C-LIKE-DOMAIN ) (PDB: 1hdm_A) in IMGT Repertoire
    3. Creation of 3D representation: Human HLA-DMB domain 2 (C-LIKE-DOMAIN ) (PDB: 1hdm_B) in IMGT Repertoire

    27 November 2001 - CREATION: Colliers de Perles Human C-LIKE-DOMAIN

    1. Creation of Colliers de Perles Human C-LIKE-DOMAIN in IMGT Repertoire

    27 November 2001 - CREATION: Collier de Perles Mouse MOX2 (CD200, OX2) (V-LIKE-DOMAIN)

    1. Creation of Collier de Perles Mouse MOX2 (CD200, OX2) (V-LIKE-DOMAIN) in IMGT Repertoire

    27 November 2001 - CREATION: Collier de Perles Norway rat V-LIKE-DOMAIN

    1. Creation of Collier de Perles: Norway rat CD8A (V-LIKE-DOMAIN) in IMGT Repertoire
    2. Creation of Collier de Perles: Norway rat CD8B (V-LIKE-DOMAIN) in IMGT Repertoire
    3. Creation of Collier de Perles: Norway rat MPZ (V-LIKE-DOMAIN) in IMGT Repertoire

    27 November 2001 - CREATION: Collier de Perles Human V-LIKE-DOMAIN

    1. Creation of Collier de Perles: Human MOX2 (CD200, OX2) (V-LIKE-DOMAIN) in IMGT Repertoire
    2. Creation of Collier de Perles: Human THY1 (V-LIKE-DOMAIN) in IMGT Repertoire

    20 November 2001 - CREATION: Collier de Perles: Charr (Salvelinus alpinus) IGH V-REGION

    1. Creation of Collier de Perles: Charr (Salvelinus alpinus) IGH V-REGION in IMGT Repertoire

    16 November 2001 - CREATION: Colliers de Perles Human TRD C-DOMAIN

    1. Creation of Colliers de Perles: Human TRD C-DOMAIN in IMGT Repertoire

    16 November 2001 - CREATION: Colliers de Perles Human IGK C-DOMAIN

    1. Creation of Colliers de Perles: Human IGK C-DOMAIN in IMGT Repertoire

    16 November 2001 - CREATION: Colliers de Perles Human TRG C-DOMAIN

    1. Creation of Colliers de Perles: Human TRG C-DOMAIN in IMGT Repertoire

    15 November 2001 - CREATION: Turbot (Scophthalmus maximus) IGHV

    1. Creation of Germline gene table: Turbot (Scophthalmus maximus) IGHV in IMGT Repertoire
    2. Creation of Protein display: Turbot (Scophthalmus maximus) IGH V-REGIONs in IMGT Repertoire

    15 November 2001 - CREATION: Bastard halibut (Paralichthys olivaceus) IGHV

    1. Creation of Germline gene table: Bastard halibut (Paralichthys olivaceus) IGHV in IMGT Repertoire
    2. Creation of Protein display: Bastard halibut (Paralichthys olivaceus) IGH V-REGIONs in IMGT Repertoire
    3. Creation of Collier de Perles: Bastard halibut (Paralichthys olivaceus) IGH V-REGION in IMGT Repertoire
    4. Creation of Table of FR-IMGT and CDR-IMGT length: Bastard halibut (Paralichthys olivaceus) in IMGT Repertoire

    14 November 2001 - CREATION: Collier de Perles Human V-LIKE-DOMAIN

    1. Creation of Collier de Perles: Human CD8A (V-LIKE-DOMAIN) in IMGT Repertoire
    2. Creation of Collier de Perles: Human CD8B (V-LIKE-DOMAIN) in IMGT Repertoire

    13 November 2001 - CREATION: Collier de Perles Zebra danio (Danio rerio) IGH V-REGION

    1. Creation of Collier de Perles: Zebra danio (Danio rerio) IGH V-REGION in IMGT Repertoire

    12 November 2001 - CREATION: Colliers de Perles Mouse TRG C-REGIONs

    1. Creation of Colliers de Perles: Mouse TRG C-REGIONs in IMGT Repertoire

    12 November 2001 - CREATION: Bovine (Bos taurus) TRGV

    1. Creation of Gene table: Bovine (Bos taurus) TRGV in IMGT Repertoire
    2. Creation of Table of alleles: Bovine (Bos taurus) TRGV in IMGT Repertoire
    3. Creation of Alignments of alleles: Bovine (Bos taurus) TRG V-REGION in IMGT Repertoire
    4. Creation of Protein display: Bovine (Bos taurus) TRG V-REGIONs in IMGT Repertoire

    12 November 2001 - CREATION: Camel (Camelus dromedarius) IGHC

    1. Creation of Gene and allele table: Camel (Camelus dromedarius) IGHC in IMGT Repertoire
    2. Creation of Alignments of alleles: Camel (Camelus dromedarius) IGH C-REGION in IMGT Repertoire
    3. Creation of Protein display: Camel (Camelus dromedarius) IGH C-REGIONs in IMGT Repertoire

    12 November 2001 - CREATION: Pig (Sus scrofa) IGHC

    1. Creation of Gene and allele table: Pig (Sus scrofa) IGHC in IMGT Repertoire
    2. Creation of Alignments of alleles: Pig (Sus scrofa) IGH C-REGION in IMGT Repertoire
    3. Creation of Protein display: Pig (Sus scrofa) IGH C-REGIONs in IMGT Repertoire

    12 November 2001 - CREATION: Germline gene table Pig (Sus scrofa) IGHV

    1. Creation of Germline gene table: Pig (Sus scrofa) IGHV in IMGT Repertoire

    12 November 2001 - CREATION: IG and TR loci Positions on chromosomes

    1. Creation of IG and TR loci Positions on chromosomes in IMGT Repertoire

    12 November 2001 - CREATION: Zebra danio (Danio rerio) IGHV

    1. Creation of Germline gene table: Zebra danio (Danio rerio) IGHV in IMGT Repertoire
    2. Creation of Table of alleles: Zebra danio (Danio rerio) IGHV in IMGT Repertoire
    3. Creation of Alignments of alleles: Zebra danio (Danio rerio) IGH V-REGION in IMGT Repertoire
    4. Creation of Protein display: Zebra danio (Danio rerio) IGH V-REGIONs in IMGT Repertoire
    5. Creation of Table of FR-IMGT and CDR-IMGT length: Zebra danio (Danio rerio) in IMGT Repertoire
    6. Creation of Collier de Perles: Zebra danio (Danio rerio) IGH V-REGION in IMGT Repertoire

    12 November 2001 - CREATION: Zebra danio (Danio rerio) IGHC

    1. Creation of Gene and allele table: Zebra danio (Danio rerio) IGHC in IMGT Repertoire
    2. Creation of Alignments of alleles: Zebra danio (Danio rerio) IGH C-REGION in IMGT Repertoire

    12 November 2001 - CREATION: Bastard halibut (Paralichthys olivaceus) IGHC

    1. Creation of Gene and allele table: Bastard halibut (Paralichthys olivaceus) IGHC in IMGT Repertoire
    2. Creation of Alignments of alleles: Bastard halibut (Paralichthys olivaceus) IGH C-REGION in IMGT Repertoire

    25 October 2001 - CREATION: Colliers de Perles Human IGH C-DOMAIN

    1. Creation of Colliers de Perles: Human IGH C-DOMAIN in IMGT Repertoire

    24 October 2001 - CREATION: Protein display: C-DOMAINs (IG and TR) C-LIKE-DOMAINs (proteins other than IG or TR)

    1. Creation of Protein display: C-DOMAINs (IG and TR) C-LIKE-DOMAINs (proteins other than IG or TR) in IMGT Repertoire

    01 October 2001 - CREATION: IMGT/3Dstructure-DB

    1. Creation of IMGT/3Dstructure-DB Query page in IMGT Genome and Structure databases
    2. Creation of IMGT/3Dstructure-DB Documentation in IMGT Genome and Structure databases

    26 September 2001 - CREATION: Correspondence between the different gene nomenclatures: Human IGHV

    1. Creation of Correspondence between the different gene nomenclatures: Human IGHV in IMGT Repertoire

    21 September 2001 - CREATION: Locus description: Human

    1. Creation of Locus description: Human IGH in IMGT Repertoire
    2. Creation of Locus description: Human IGK in IMGT Repertoire
    3. Creation of Locus description: Human IGL in IMGT Repertoire

    14 September 2001 - CREATION: Protein display: Sheep (Ovis aries) TRGC

    1. Creation of Protein display: Sheep (Ovis aries) TRGC in IMGT Repertoire

    14 September 2001 - CREATION: Protein display: Human TRA, TRB, TRG and TRD C-REGIONs

    1. Creation of Protein display: Human TRA, TRB, TRG and TRD C-REGIONs in IMGT Repertoire

    10 September 2001 - CREATION: FactsBook

    1. Creation of FactsBook in IMGT Index

    07 September 2001 - CREATION: 3D representation Human T cell receptor αβ B7 (PDB: 1bd2)

    1. Creation of 3D representation: Human C-DOMAINs from TcR αβ B7 (PDB: 1bd2) in IMGT Repertoire
    2. Creation of 3D representation: Human V-DOMAINs and C-DOMAINs from TcR αβ B7 (PDB: 1bd2) in IMGT Repertoire
    3. Creation of 3D representation: Human TRAC C-DOMAIN from TcR αβ B7 (PDB: 1bd2_D) in IMGT Repertoire
    4. Creation of 3D representation: Human TRBC2 C-DOMAIN from TcR αβ B7 (PDB: 1bd2_E) in IMGT Repertoire

    05 September 2001 - CREATION: Assignment of rearranged cDNAs and gDNAs to germline genes: Mouse (Mus musculus) TRAV

    1. Creation of Assignment of rearranged cDNAs and gDNAs to germline genes: Mouse (Mus musculus) TRAV in IMGT Repertoire

    24 July 2001 - CREATION: 3D representation Human T cell receptor γδ G115 (PDB: 1hxm)

    1. Creation of 3D representation: Human C-DOMAINs from TcR γδ G115 (PDB: 1hxm) in IMGT Repertoire
    2. Creation of 3D representation: Human V-DOMAINs and C-DOMAINs from TcR γδ G115 (PDB: 1hxm) in IMGT Repertoire
    3. Creation of 3D representation: Human TRDC C-DOMAIN from TcR γδ G115 (PDB: 1hxm_A) in IMGT Repertoire
    4. Creation of 3D representation: Human TRGC1 C-DOMAIN from TcR γδ G115 (PDB: 1hxm_A) in IMGT Repertoire

    24 July 2001 - CREATION: 3D representation Mouse (Mus musculus) Immunoglobulin D1.3Fv (PDB: 1dvf_A and 1dvf_B)

    1. Creation of 3D representation: Mouse (Mus musculus) two associated V-DOMAINs from D1.3Fv (PDB: 1dvf_A and 1dvf_B) in IMGT Repertoire

    24 July 2001 - CREATION: Strand representation of V-DOMAIN and C-DOMAIN

    1. Creation of Strand representation of V-DOMAIN and C-DOMAIN in IMGT Education

    24 July 2001 - CREATION: 3D representation of V-DOMAIN and C-DOMAIN

    1. Creation of 3D representation of V-DOMAIN and C-DOMAIN in IMGT Education

    17 July 2001 - CREATION: Rabbit (Oryctolagus cuniculus) IGHC

    1. Creation of Gene and allele table: Rabbit (Oryctolagus cuniculus) IGHC in IMGT Repertoire
    2. Creation of Alignments of alleles: Rabbit (Oryctolagus cuniculus) IGHC in IMGT Repertoire
    3. Creation of Protein display: Rabbit (Oryctolagus cuniculus) IGHC in IMGT Repertoire

    16 July 2001 - CREATION: Rabbit (Oryctolagus cuniculus) IGHJ

    1. Creation of Germline gene table: Rabbit (Oryctolagus cuniculus) IGHJ in IMGT Repertoire
    2. Creation of Table of alleles: Rabbit (Oryctolagus cuniculus) IGHJ in IMGT Repertoire
    3. Creation of Alignments of alleles: Rabbit (Oryctolagus cuniculus) IGHJ in IMGT Repertoire

    16 July 2001 - CREATION: Mouse (Mus musculus) TRGV

    1. Creation of Number of germline genes and potential repertoire: Mouse (Mus musculus) TRGV in IMGT Repertoire
    2. Creation of Colliers de Perles: Mouse (Mus musculus) TRGV in IMGT Repertoire

    16 July 2001 - CREATION: Mouse (Mus musculus) TRAJ

    1. Creation of Table of alleles: Mouse (Mus musculus) TRAJ in IMGT Repertoire
    2. Creation of Alignments of alleles: Mouse (Mus musculus) TRAJ in IMGT Repertoire

    13 July 2001 - UPDATE: IMGT/GeneSearch, IMGT/GeneView and IMGT/LocusView: human TRB

    1. Update of IMGT/GeneSearch in IMGT Genome and Structure databases: Addition of the human TRB genes
    2. Update of IMGT/GeneView in IMGT Genome and Structure databases: Addition of the human TRB genes
    3. Update of IMGT/LocusView in IMGT Genome and Structure databases: Addition of the human TRB locus

    27 June 2001 - CREATION: IMGT orthographe

    1. Creation of IMGT orthographe in IMGT Scientific chart

    26 June 2001 - CREATION: Uncertain nucleotides

    1. Creation of Uncertain nucleotides in IMGT Scientific chart

    26 June 2001 - CREATION: IMGT annotation rules

    1. Creation of IMGT annotation rules in IMGT Scientific chart

    25 June 2001 - CREATION: Bovine (Bos taurus) TRGC

    1. Creation of Gene and allele table: Bovine (Bos taurus) TRGC in IMGT Repertoire
    2. Creation of Alignments of alleles: Bovine (Bos taurus) TRGC in IMGT Repertoire
    3. Creation of Protein display: Bovine (Bos taurus) TRGC in IMGT Repertoire

    25 June 2001 - CREATION: Rules for the gap positions in C-DOMAIN and C-LIKE-DOMAIN

    1. Creation of Rules for the gap positions in C-DOMAIN and C-LIKE-DOMAIN in IMGT Scientific chart

    17 June 2001 - CREATION: IMGT/JunctionAnalysis

    1. Creation of IMGT/JunctionAnalysis in IMGT tools and other accesses
    2. IMGT News

    15 June 2001 - CREATION: IMGT/GENE-DB (in development)

    1. Creation of IMGT/GENE-DB (in development) in IMGT Genome databases

    15 June 2001 - UPDATE: IMGT/GeneSearch, IMGT/GeneView and IMGT/LocusView: human TRG

    1. Update of IMGT/GeneSearch in IMGT Genome and Structure databases: Addition of the human TRG genes
    2. Update of IMGT/GeneView in IMGT Genome and Structure databases: Addition of the human TRG genes
    3. Update of IMGT/LocusView in IMGT Genome and Structure databases: Addition of the human TRG locus

    13 June 2001 - CREATION: IMGT Education

    1. Creation of IMGT Education in IMGT Web resources

    11 June 2001 - CREATION: An EBI mirror on ftp://ftp.cines.fr/IMGT to update the EBI ftp server daily automatically from IMGT ftp server at CINES

    1. Creation of an EBI mirror on ftp://ftp.cines.fr/IMGT to update the EBI ftp server daily automatically from IMGT ftp server at CINES

    11 June 2001 - CREATION: Sheep (Ovis aries) TRGC

    1. Creation of Gene and allele table: Sheep (Ovis aries) TRGC in IMGT Repertoire
    2. Creation of Alignments of alleles: Sheep (Ovis aries) in IMGT Repertoire
    3. Creation of Protein display: Sheep (Ovis aries) TRGC in IMGT Repertoire

    11 June 2001 - CREATION: Number of germline genes and potential repertoire: Mouse (Mus musculus) IGKV

    1. Creation of Number of germline genes and potential repertoire: Mouse (Mus musculus) IGKV in IMGT Repertoire

    08 June 2001 - CREATION: Humanized antibodies

    1. Creation of Humanized antibodies: CAMPATH-1H in IMGT Repertoire
    2. Creation of Humanized antibodies: K20 in IMGT Repertoire

    08 June 2001 - CREATION: Monoclonal antibodies with clinical indications

    1. Creation of Monoclonal antibodies with clinical indications in IMGT Repertoire

    07 June 2001 - CREATION: IMGT Posters and diaporama

    1. Creation of IMGT Posters

    31 May 2001 - CREATION: Correspondence between numberings for the CDR-IMGT lengths (horizontal display)

    1. Creation of Correspondence between numberings for the CDR-IMGT lengths (horizontal display) in IMGT Scientific chart

    30 May 2001 - UPDATE: IMGT/GeneSearch, IMGT/GeneView and IMGT/LocusView: human IGLJ and IGLC

    1. Update of IMGT/GeneSearch in IMGT Genome and Structure databases: Addition of the human IGLJ and IGLC genes
    2. Update of IMGT/GeneView in IMGT Genome and Structure databases: Addition of the human IGLJ and IGLC genes
    3. Update of IMGT/LocusView in IMGT Genome and Structure databases: Addition of the human IGLJ and IGLC genes

    23 May 2001 - CREATION: Collier de Perles: Human TRGC

    1. Creation of Collier de Perles: Human TRGC1 C-DOMAIN in IMGT Repertoire
    2. Creation of Collier de Perles: Human TRGC2 C-DOMAIN in IMGT Repertoire

    22 May 2001 - CREATION: Collier de Perles: Human IGLC

    1. Creation of Collier de Perles: Human IGLC1 C-DOMAIN in IMGT Repertoire

    22 May 2001 - CREATION: Collier de Perles: Human TRBC

    1. Creation of Collier de Perles: Human TRBC1 C-DOMAIN in IMGT Repertoire
    2. Creation of Collier de Perles: Human TRBC2 C-DOMAIN in IMGT Repertoire

    22 May 2001 - CREATION: Mouse (Mus musculus) TRAC

    1. Creation of Gene and allele table: Mouse (Mus musculus) TRAC in IMGT Repertoire
    2. Creation of Alignment of alleles: Mouse (Mus musculus) TRAC in IMGT Repertoire

    17 May 2001 - CREATION: Gene exon/intron organization: Ig superfamily genes

    1. Creation of Gene exon/intron organization in IMGT Repertoire

    17 May 2001 - CREATION: Promoters: Mouse (Mus musculus) IGKV

    1. Creation of Motifs of the V-GENE PROMOTERs: Mouse (Mus musculus) IGKV in IMGT Repertoire
    2. Creation of Organization of the V-GENE PROMOTERs: Mouse (Mus musculus) IGKV in IMGT Repertoire

    17 May 2001 - CREATION: Assignment of rearranged cDNAs and gDNAs to germline genes: Mouse (Mus musculus) IGKV

    1. Creation of Assignment of rearranged cDNAs and gDNAs to germline genes: Mouse (Mus musculus) IGKV in IMGT Repertoire

    17 May 2001 - CREATION: Chondrichthyes IGHV

    1. Creation of Germline gene tables: Chondrichthyes IGHV in IMGT Repertoire
    2. Creation of Alignment of alleles: Chondrichthyes IGHV in IMGT Repertoire
    3. Creation of Protein display: Chondrichthyes IGHV in IMGT Repertoire
    4. Creation of Table of FR-IMGT and CDR-IMGT length: Chondrichthyes IGHV in IMGT Repertoire
    5. Creation of Collier de Perles: Chondrichthyes IGHV in IMGT Repertoire

    18 April 2001 - CREATION: CDR-IMGT 3D structures: Human

    1. Creation of CDR-IMGT 3D structures: Human in IMGT Repertoire

    18 April 2001 - CREATION: Mouse (Mus musculus) TRAV

    1. Creation of Locus representation: Mouse (Mus musculus) TRA/TRD in IMGT Repertoire
    2. Creation of Germline gene table: Mouse (Mus musculus) TRAV in IMGT Repertoire
    3. Creation of Correspondence between the different gene nomenclatures: Mouse (Mus musculus) TRAV in IMGT Repertoire
    4. Creation of Number of germline genes and potential repertoire: Mouse (Mus musculus) TRAV in IMGT Repertoire
    5. Creation of Table of alleles: Mouse (Mus musculus) TRAV in IMGT Repertoire
    6. Creation of Alignments of alleles: Mouse (Mus musculus) TRAV in IMGT Repertoire
    7. Creation of Protein display: Mouse (Mus musculus) TRA V-REGIONs in IMGT Repertoire
    8. Creation of Table of FR-IMGT and CDR-IMGT length: Mouse (Mus musculus) TRAV in IMGT Repertoire

    18 April 2001 - CREATION: Locus representation: Mouse (Mus musculus) IGH

    1. Creation of Locus representation: Mouse (Mus musculus) IGH in IMGT Repertoire

    18 April 2001 - CREATION: Human IGKC

    1. Creation of Gene and allele table: Human IGKC in IMGT Repertoire
    2. Creation of Alignment of alleles: Human IGKC in IMGT Repertoire

    17 April 2001 - CREATION: IMGT/GeneSearch, IMGT/GeneView and IMGT/LocusView

    1. Creation of IMGT/GeneSearch in IMGT Genome and Structure databases. Available only for human IGLV
    2. Creation of IMGT/GeneView in IMGT Genome and Structure databases. Available only for human IGLV
    3. Creation of IMGT/LocusView in IMGT Genome and Structure databases. Available only for human IGLV

    12 April 2001 - UPDATE: Mouse (Mus musculus) TRDV

    1. Updates, in IMGT Repertoire, of:

    12 April 2001 - CREATION: Protein 3D structures

    1. Creation of Protein 3D structures of Immunoglobulin: Human in IMGT Repertoire

    12 April 2001 - CREATION: IMGT reference directory in FASTA format: Human TRAV and TRGV "L-PART1+L-PART2" (artificially spliced) sets

    1. Creation of Human TRAV and TRGV "L-PART1+L-PART2" (artificially spliced) sets in IMGT reference directory in FASTA format (IMGT Repertoire)

    10 April 2001 - CREATION: Colliers de Perles: Human

    1. Creation of Colliers de Perles: Human IGH C-REGIONs in IMGT Repertoire
    2. Creation of Colliers de Perles: Human TRA C-REGIONs in IMGT Repertoire
    3. Creation of Colliers de Perles: Human TRB C-REGIONs in IMGT Repertoire
    4. Creation of Colliers de Perles: Human TRD C-REGIONs in IMGT Repertoire

    10 April 2001 - CREATION: Colliers de Perles: Mouse

    1. Creation of Colliers de Perles: Mouse TRA C-REGIONs in IMGT Repertoire
    2. Creation of Colliers de Perles: Mouse TRB C-REGIONs in IMGT Repertoire

    10 April 2001 - CREATION: Colliers de Perles: Ig superfamily C-DOMAINs (other than Ig and TcR)

    1. Creation of Colliers de Perles: C-DOMAINs (other than Ig and TcR) in IMGT Repertoire (RPI)

    3 April 2001 - CREATION: Particularities in protein designations: Human immunoglobulins: New and Newm

    1. Creation of the Particularities in protein designations: Human immunoglobulins: New and Newm in IMGT Repertoire

    2 April 2001 - CREATION: Human IGLC

    1. Creation of Protein display: Human IGL C-REGIONs in IMGT Repertoire

    23 March 2001 - CREATION: IMGT unique numbering for Ig superfamily C-DOMAINs and V-DOMAINs

    1. Creation of IMGT unique numbering for Ig superfamily C-DOMAINs and V-DOMAINs in IMGT Scientific chart

    23 March 2001 - CREATION: Human IGHC

    1. Creation of Protein display: Human IGH C-REGIONs in IMGT Repertoire

    23 March 2001 - CREATION: Mouse (Mus musculus) IGHV

    1. Creation of Germline gene table: Mouse (Mus musculus) IGHV in IMGT Repertoire
    2. Creation of Protein display: Mouse (Mus musculus) IGH V-REGIONs in IMGT Repertoire
    3. Update of Table of FR-IMGT and CDR-IMGT length: Human IGHV in IMGT Repertoire

    23 March 2001 - CREATION: IMGT taxon abbreviations

    1. Creation of IMGT taxon abbreviations in IMGT Scientific chart

    1 March 2001 - CREATION: Mouse (Mus musculus) TRGJ

    1. Creation of Germline gene table: Mouse (Mus musculus) TRGJ in IMGT Repertoire
    2. Creation of Table of alleles: Mouse (Mus musculus) TRGJ in IMGT Repertoire
    3. Creation of Alignments of alleles: Mouse (Mus musculus) TRGJ in IMGT Repertoire
    4. Creation of Protein display: Mouse (Mus musculus) TRG J-REGIONs in IMGT Repertoire

    1 March 2001 - CREATION: Mouse (Mus musculus) TRGC

    1. Creation of Gene and allele table: Mouse (Mus musculus) TRGC in IMGT Repertoire
    2. Creation of Alignments of alleles: Mouse (Mus musculus) TRGC in IMGT Repertoire

    12 February 2001 - CREATION: IMGT reference sequence query: Human IG and TR

    1. The human immunoglobulin (IG) and T cell receptor (TR) IMGT reference sequences can be queried by selection of the "IMGT reference sequence" keyword in the IMGT/LIGM-DB "Keywords" module.

    30 January 2001 - CREATION: Human IGH orphons

    1. Creation of Locus representation: Human IGH orphons on chromosome 15 (15q11.2) in IMGT Repertoire
    2. Creation of Locus representation: Human IGH orphons on chromosome 16 (16p11.2) in IMGT Repertoire

    30 January 2001 - CREATION: Lists of human IG and TR genes, groups, loci and orphons and links between IMGT, HUGO, GDB, Entrez Gene and OMIM

    1. Creation of the Lists of human IG and TR genes, groups, loci and orphons and links between IMGT, HUGO, GDB, Entrez Gene and OMIM in IMGT Repertoire > Locus and genes

    15 January 2001 - CREATION: Reagents monoclonal antibodies: anti-human TRBV

    1. Creation of the Reagents monoclonal antibodies in IMGT Repertoire > Gene regulation and expression

    15 January 2001 - CREATION: Mouse (Mus musculus) TRB

    1. Creation of Locus representation: Mouse (Mus musculus) TRB in IMGT Repertoire

    4 January 2001 - UPDATE: List of general standardized IMGT/LIGM-DB keywords

    2000

    22 December 2000 - CREATION: Mouse (Mus musculus, Mus saxicola, Mus pahari, Mus minutoides, Mus cookii, Mus spretus) IGKC

    1. Creation of Gene and allele table: Mouse (Mus musculus, Mus saxicola, Mus pahari, Mus minutoides, Mus cookii, Mus spretus) IGKC in IMGT Repertoire
    2. Creation of Alignment of alleles: Mouse (Mus musculus, Mus saxicola, Mus pahari, Mus minutoides, Mus cookii, Mus spretus) IGKC in IMGT Repertoire
    3. Creation of Alignment of alleles: Mouse (Mus musculus, Mus saxicola, Mus pahari, Mus minutoides, Mus cookii, Mus spretus) IGKC (overview) in IMGT Repertoire

    15 December 2000 - CREATION: Allotypes: Human IGHC

    1. Creation of the Allotypes: Human IGHC in IMGT Repertoire

    23 November 2000 - CREATION: Translocations and inversions

    1. Creation of 7. Genes and Clinical entities in IMGT Repertoire
    2. Creation of Translocations and inversions in IMGT Repertoire > Genes and clinical entities

    1st November 2000 - UPDATE: Mouse (Mus musculus) IGKV

    Following the sequencing of the mouse IGKV genes by Zachau's group, the following documents have been created and updated.

    1. Creation of Locus representation: Mouse (Mus musculus) IGK in IMGT Repertoire
    2. Updates, in IMGT Repertoire, of:
    3. IMGT/V-QUEST: Update of the Mouse (Mus musculus) Ig set of the IMGT reference directory.

    1998

    October 1998 - UPDATE: IMGT Scientific Chart - IMGT Repertoire - New Interface

    1. IMGT News

    Universe

    2026

    KOSSIDA SofiaProfesseur Université de Montpellier, Faculté des SciencesIMGT® Director
    DUROUX PatriceIngénieur de Recherche CNRSComputer manager
    GIUDICELLI VéroniqueIngénieur de Recherche Université de MontpellierBioinformatics manager
    FOLCH GéraldineIngénieur d'Etude CNRSBiocurator manager, Communication
    MICHALOUD-JABADO JoumanaIngénieur d'Etude CNRSBiocurator manager, Quality Assurance Manager
    GRAND FrançoisIngénieur de Recherche (CDD CNRS)Informatics
    BATOOL ShamsaPost-doctoranteBiocurator
    SAMADOVA TurkanPost-doctoranteBiocurator
    SANOU GaoussouPost-doctorantBioinformatics
    CROZE MyriamIngénieur de Recherche (CDD CNRS)Bioinformatics
    EIDI MiladIngénieur de Recherche (CDD CNRS)Informatics
    MANSO TacianaIngénieur de Recherche (CDD CNRS)Bioinformatics
    JIANG LijuanIngénieur de Recherche (CDD CNRS)Informatics
    VAILLANT AxelIngénieur de Recherche (CDD CNRS)Informatics
    CHERKAOUI MiaIngénieur d'Etude (CDD CNRS)Biocurator
    GKOLFINOPOULOU RevekkaIngénieur d'Etude (CDD CNRS)Bioinformatics
    PETIT AmbreIngénieur d'Etude (CDD CNRS)Biocurator
    SIDERI IfigeneiaIngénieur d'Etude (CDD CNRS)Bioinformatics, Biocurator
    ZEITOUN GuilhemIngénieur d'Etude (CDD CNRS)Bioinformatics, Biocurator

    2025

    KOSSIDA SofiaProfesseur Université de Montpellier, Faculté des SciencesIMGT® Director
    DUROUX PatriceIngénieur de Recherche CNRSComputer manager
    GIUDICELLI VéroniqueIngénieur de Recherche Université de MontpellierBioinformatics manager
    FOLCH GéraldineIngénieur d'Etude CNRSBiocurator, Communication
    MICHALOUD-JABADO JoumanaIngénieur d'Etude CNRSBiocurator, Quality Assurance Manager
    GRAND FrançoisIngénieur de Recherche (CDD CNRS)Informatics
    KUSHWAHA AnjanaPost-doctoranteBioinformatics
    CROZE MyriamIngénieur de Recherche (CDD CNRS)Bioinformatics
    SANOU GaoussouPost-doctorantBioinformatics
    MANSO TacianaIngénieur de Recherche (CDD CNRS)Bioinformatics
    DEBBAGH ChahrazedIngénieur d'Etude (CDD CNRS)Biocurator
    GEORGA MariaIngénieur d'Etude (CDD CNRS)Bioinformatics, Biocurator
    PAPADAKI AriadniIngénieur d'Etude (CDD CNRS)Bioinformatics, Biocurator
    SIDERI IfigeneiaIngénieur d'Etude (CDD CNRS)Bioinformatics, Biocurator
    ZEITOUN GuilhemIngénieur d'Etude (CDD CNRS)Bioinformatics, Biocurator
    ALAKBAROVA ChilanaydoctoranteBiocurator
    BATOOL ShamsadoctoranteBiocurator
    SAMADOVA TurkandoctoranteBiocurator

    2024

    KOSSIDA SofiaProfesseur Université de Montpellier, Faculté des SciencesIMGT® Director
    DUROUX PatriceIngénieur de Recherche CNRSComputer manager
    GIUDICELLI VéroniqueIngénieur de Recherche Université de MontpellierBioinformatics manager
    FOLCH GéraldineIngénieur d'Etude CNRSBiocurator, Communication
    MICHALOUD-JABADO JoumanaIngénieur d'Etude CNRSBiocurator, Quality Assurance Manager
    GRAND FrançoisIngénieur de Recherche (CDD CNRS)Informatics
    KUSHWAHA AnjanaPost-doctoranteBioinformatics
    MANSO TacianaIngénieur de Recherche (CDD CNRS)Bioinformatics
    DEBBAGH ChahrazedIngénieur d'Etude (CDD CNRS)Biocurator
    FREZOULS ThéoIngénieur d'Etude (CDD CNRS)Bioinformatics
    GEORGA MariaIngénieur d'Etude (CDD CNRS)Bioinformatics, Biocurator
    PAPADAKI AriadniIngénieur d'Etude (CDD CNRS)Bioinformatics, Biocurator
    ZEITOUN GuilhemIngénieur d'Etude (CDD CNRS)Bioinformatics, Biocurator
    ALAKBAROVA ChilanaydoctoranteBiocurator
    BATOOL ShamsadoctoranteBiocurator
    KUSTRO-GARNICA TaismaradoctoranteBiocurator
    SAMADOVA TurkandoctoranteBiocurator
    SANOU GaoussoudoctorantBioinformatics

    2023

    KOSSIDA SofiaProfesseur Université de Montpellier, Faculté des SciencesIMGT® Director
    DUROUX PatriceIngénieur de Recherche CNRSComputer manager
    GIUDICELLI VéroniqueIngénieur de Recherche Université de MontpellierBioinformatics manager
    FOLCH GéraldineIngénieur d'Etude CNRSBiocurator, Communication
    MICHALOUD-JABADO JoumanaIngénieur d'Etude CNRSBiocurator, Quality Assurance Manager
    ABDOLLAHI NikaIngénieur de Recherche (CDD CNRS)Bioinformatics
    MANSO TacianaIngénieur de Recherche (CDD CNRS)Bioinformatics
    FREZOULS ThéoIngénieur d'Etude (CDD CNRS)Bioinformatics
    GEORGA MariaIngénieur d'Etude (CDD CNRS)Bioinformatics, Biocurator
    KAMEL YascimIngénieur d'Etude (CDD CNRS)Bioinformatics, Biocurator
    NGUEFACK-NGOUNE VivianeIngénieur d'Etude (CDD CNRS)Bioinformatics, Biocurator
    PAPADAKI AriadniIngénieur d'Etude (CDD CNRS)Bioinformatics, Biocurator
    SIKA DassouIngénieur d'Etude (CDD CNRS)Bioinformatics
    ZEITOUN GuilhemIngénieur d'Etude (CDD UM & CNRS)Bioinformatics, Biocurator
    BATOOL ShamsadoctoranteBiocurator
    DEBBAGH ChahrazeddoctoranteBiocurator
    ELAZAMI-ELHASSANI MerouanedoctorantInformatics
    GORET AgathedoctoranteInformatics
    KUSHWAHA AnjanadoctoranteBioinformatics
    SAMADOVA TurkandoctoranteBiocurator
    SANOU GaoussoudoctorantBioinformatics
    TRAN AnnadoctoranteBioinformatics, Biocurator

    2022

    KOSSIDA SofiaProfesseur Université de Montpellier, Faculté des SciencesIMGT® Director
    DUROUX PatriceIngénieur de Recherche CNRSComputer manager
    GIUDICELLI VéroniqueIngénieur de Recherche Université de MontpellierBioinformatics manager
    MICHALOUD-JABADO JoumanaIngénieur d'Etude CNRSBiocurator, Quality Assurance Manager
    FOLCH GéraldineIngénieur d'Etude CNRSBiocurator, Communication
    PAPADAKI AriadniIngénieur d'Etude (CDD CNRS)Bioinformatics, Biocurator
    GEORGA MariaIngénieur d'Etude (CDD CNRS)Bioinformatics, Biocurator
    ZETOUN GuilhemIngénieur d'Etude (CDD Université de Montpellier)Bioinformatics, Biocurator
    FREZOULS ThéoIngénieur d'Etude (CDD CNRS)Bioinformatics
    KAMEL YascimIngénieur d'Etude (CDD CNRS)Bioinformatics, Biocurator
    NGUEFACK-NGOUNE VivianeIngénieur d'Etude (CDD CNRS)Bioinformatics, Biocurator
    MANSO TacianaIngénieur de Recherche (CDD CNRS)Bioinformatics
    ABDOLLAHI NikaIngénieur de Recherche (CDD CNRS)Bioinformatics
    TRAN AnnadoctoranteBioinformatics, Biocurator
    GORET AgathedoctoranteInformatics
    SANOU GaoussoudoctorantBioinformatics
    DEBBAGH ChahrazeddoctoranteBiocurator
    KUSHWAHA AnjanadoctoranteBioinformatics
    ELAZAMI-ELHASSANI MerouanedoctorantInformatics
    BATOUL ShamsadoctoranteBiocurator
    SAMEDOVA TurkandoctoranteBiocurator

    2021

    KOSSIDA SofiaProfesseur Université de Montpellier, Faculté des SciencesIMGT® Director
    LEFRANC Marie-PauleIMGT® FounderIMGT® Founder
    DUROUX PatriceIngénieur de Recherche CNRSComputer manager
    GIUDICELLI VéroniqueIngénieur de Recherche Université de MontpellierBioinformatics manager
    MICHALOUD-JABADO JoumanaIngénieur d'Etude CNRSBiocurator, Quality Assurance Manager
    FOLCH GéraldineIngénieur d'Etude CNRSBiocurator, Communication
    PAPADAKI AriadniIngénieur d'Etude (CDD CNRS)Bioinformatics, Biocurator
    GEORGA MariaIngénieur d'Etude (CDD CNRS)Bioinformatics, Biocurator
    ALBANI AlexandreIngénieur d'Etude (CDD CNRS)Bioinformatics, Biocurator
    BERTIGNAC MorganeIngénieur d'Etude (CDD CNRS)Biocurator
    MEKDAD RedaIngénieur d'Etude (CDD CNRS)Bioinformatics
    ROLLIN MaëlIngénieur d'Etude (CDD CNRS)Informatics
    NGUEFACK-NGOUNE VivianeIngénieur d'Etude (CDD CNRS)Bioinformatics, Biocurator
    MANSO TacianaIngénieur de Recherche (CDD CNRS)Bioinformatics
    ABDOLLAHI NikaIngénieur de Recherche (CDD CNRS)Bioinformatics
    TRAN AnnadoctoranteBioinformatics, Biocurator
    GORET AgathedoctoranteInformatics
    SANOU GaoussoudoctorantBioinformatics
    DEBBAGH ChahrazeddoctoranteBiocurator
    KUSHWAHA AnjanadoctoranteBioinformatics
    ELAZAMI-ELHASSANI MerouanedoctorantInformatics

    2020

    KOSSIDA SofiaProfesseur Université de Montpellier, Faculté des SciencesIMGT® Director
    LEFRANC Marie-PauleIMGT® FounderIMGT® Founder
    DUROUX PatriceIngénieur de Recherche CNRSComputer manager
    GIUDICELLI VéroniqueIngénieur de Recherche Université de MontpellierBioinformatics manager
    MICHALOUD-JABADO JoumanaIngénieur d'Etude CNRSBiocurator, Quality Assurance Manager
    FOLCH GéraldineIngénieur d'Etude CNRSBiocurator, Communication
    CHEROUALI KarimaIngénieur d'Etude (CDD CNRS)Biocurator
    PEGORIER PerrineIngénieur d'Etude (CDD CNRS)Biocurator
    PAPADAKI AriadniIngénieur d'Etude (CDD CNRS)Bioinformatics, Biocurator
    GEORGA MariaIngénieur d'Etude (CDD CNRS)Bioinformatics, Biocurator
    ALBANI AlexandreIngénieur d'Etude (CDD CNRS)Bioinformatics, Biocurator
    BERTIGNAC MorganeIngénieur d'Etude (CDD CNRS)Biocurator
    MEKDAD RedaIngénieur d'Etude (CDD CNRS)Bioinformatics
    ROLLIN MaëlIngénieur d'Etude (CDD CNRS)Informatics
    NGUEFACK-NGOUNE VivianeIngénieur d'Etude (CDD CNRS)Bioinformatics, Biocurator
    GORET AgatheIngénieur d'Etude (CDD CNRS)Informatics
    KUSHWAHA AnjanaIngénieur d'Etude (CDD CNRS)Bioinformatics
    VIART BenjaminIngénieur de Recherche (CDD CNRS)Bioinformatics
    MANSO TacianaIngénieur de Recherche (CDD CNRS)Bioinformatics
    TRAN AnnadoctoranteBiocurator
    SANOU GaoussoudoctorantBioinformatics
    DEBBAGH ChahrazeddoctoranteBiocurator
    ELAZAMI-ELHASSANI MerouanedoctorantInformatics

    2019

    BERTIGNAC Morgane Ingénieur d'Etude (CDD CNRS) Biocurator
    CHEROUALI Karima Ingénieur d'Etude (CDD CNRS) Biocurator
    CHENTLI Imène Ingénieur d'Etude (CDD CNRS) Bioinformatics, Biocurator
    GORET Agathe Ingénieur d'Etude (CDD CNRS) Informatics
    KALYAN Karthik Ingénieur d'Etude (CDD CNRS) Informatics
    KUSHWAHA Anjana Ingénieur d'Etude (CDD CNRS) Bioinformatics, Biocurator
    NGUEFACK-NGOUNE Viviane Ingénieur d'Etude (CDD CNRS) Bioinformatics, Biocurator
    PEGORIER Perrine Ingénieur d'Etude (CDD CNRS) Bioinformatics, Biocurator
    ROLLIN Maël Ingénieur d'Etude (CDD CNRS) Informatics
    SALJOQI Saida Ingénieur d'Etude (CDD CNRS) Biocurator
    TRAN Anna Ingénieur d'Etude (CDD CNRS), doctorante Biocurator

    2018

    BERTIGNAC Morgane Ingénieur d'Etude (CDD CNRS) Biocurator
    CAMBON Melissa Ingénieur d'Etude (CDD CNRS) Bioinformatics, Biocurator
    CHEROUALI Karima Ingénieur d'Etude (CDD CNRS) Biocurator
    CHENTLI Imène Ingénieur d'Etude (CDD CNRS) Bioinformatics, Biocurator
    KALYAN Karthik Ingénieur d'Etude (CDD CNRS) Informatics
    KUSHWAHA Anjana Ingénieur d'Etude (CDD CNRS) Bioinformatics, Biocurator
    LEBRE Marianne Ingénieur d'Etude (CDD CNRS) Bioinformatics
    LORENZI Claudio Ingénieur d'Etude (CDD CNRS) Informatics
    NGUEFACK-NGOUNE Viviane Ingénieur d'Etude (CDD CNRS) Bioinformatics, Biocurator
    PEGORIER Perrine Ingénieur d'Etude (CDD CNRS) Bioinformatics, Biocurator
    ROLLIN Maël Ingénieur d'Etude (CDD CNRS) Informatics
    SALJOQI Saida Ingénieur d'Etude (CDD CNRS) Biocurator

    2017

    KOSSIDA Sofia Professeur Université de Montpellier, Faculté des Sciences IMGT® Director
    LEFRANC Marie-Paule Professeur classe exceptionnelle Emérite Université de Montpellier, Faculté des Sciences IMGT® Founder and Executive Director Emeritus
    LEFRANC Gérard Professeur classe exceptionnelle Emérite Université de Montpellier, Faculté des Sciences IMGT® Expert
    DUROUX Patrice Ingénieur de Recherche CNRS Computer manager
    GIUDICELLI Véronique Ingénieur de Recherche Université de Montpellier Bioinformatics manager
    MICHALOUD-JABADO Joumana Ingénieur d'Etude CNRS Biocurator, Quality Assurance Manager
    FOLCH Géraldine Ingénieur d'Etude CNRS Biocurator, Communication
    AOUINTI Safa Ingénieur d'Etude (CDD CNRS), doctorante Biostatistics
    CAMBON Mélissa Ingénieur d'Etude (CDD CNRS) Bioinformatics, Biocurator
    CHENTLI Imène Ingénieur d'Etude (CDD CNRS) Bioinformatics, Biocurator
    HADI-SALJOQI Saïda Ingénieur d'Etude (CDD CNRS) Biocurator
    KALYAN Karthik Ingénieur d'Etude (CDD CNRS) Informatics
    KUSHWAHA Anjana Ingénieur d'Etude (CDD CNRS) Bioinformatics, Biocurator>
    LAVOIE Arthur Ingénieur d'Etude (CDD CNRS) Informatics
    LORENZI Claudio Ingénieur d'Etude (CDD CNRS) Informatics
    PEGORIER Perrine Ingénieur d'Etude (CDD CNRS) Biocurator
    PICANDET Laurène Ingénieur d'Etude (CDD CNRS) Biocurator

    2016

    KOSSIDA Sofia Professeur Université de Montpellier, Faculté des Sciences IMGT® Director
    LEFRANC Marie-Paule Professeur classe exceptionnelle Emérite Université de Montpellier, Faculté des Sciences IMGT® Founder and Executive Director Emeritus
    LEFRANC Gérard Professeur classe exceptionnelle Emérite Université de Montpellier, Faculté des Sciences IMGT® Expert
    DUROUX Patrice Ingénieur de Recherche CNRS Computer manager
    GIUDICELLI Véronique Ingénieur de Recherche Université de Montpellier Bioinformatics manager
    MICHALOUD-JABADO Joumana Ingénieur d'Etude CNRS Biocurator, Quality Assurance Manager
    FOLCH Géraldine Ingénieur d'Etude CNRS Biocurator, Communication
    AOUINTI Safa Ingénieur d'Etude (CDD CNRS), doctorante Biostatistics
    ARRIVET Mélanie Ingénieur d'Etude (CDD CNRS) Biocurator
    BENTO Pascal Ingénieur d'Etude (CDD CNRS) Informatics
    CAMBON Mélissa Ingénieur d'Etude (CDD CNRS) Bioinformatics, Biocurator
    CHENTLI Imène Ingénieur d'Etude (CDD CNRS) Bioinformatics, Biocurator
    HADI-SALJOQI Saïda Ingénieur d'Etude (CDD CNRS) Biocurator
    KALYAN Karthik Ingénieur d'Etude (CDD CNRS) Informatics
    LAVOIE Arthur Ingénieur d'Etude (CDD CNRS) Informatics
    LORENZI Claudio Ingénieur d'Etude (CDD CNRS) Informatics
    PAYSAN-LAFOSSE Typhaine Ingénieur d'Etude (CDD CNRS) Bioinformatics
    PEGORIER Perrine Ingénieur d'Etude (CDD CNRS) Biocurator
    PERALTA Marine Ingénieur d'Etude (CDD CNRS) Informatics
    PICANDET Laurène Ingénieur d'Etude (CDD CNRS) Biocurator
    Students and visitors (2016)
    KLEIN Valentin Université de Montpellier Informatics
    HIBERT Charlotte Vacataire Ingénieur d'Etude (CNRS) Informatics

    2015

    KOSSIDA Sofia Professeur Université de Montpellier, Faculté des Sciences IMGT® Director
    LEFRANC Marie-Paule Professeur classe exceptionnelle Emérite Université de Montpellier, Faculté des Sciences IMGT® Founder and Executive Director Emeritus
    LEFRANC Gérard Professeur classe exceptionnelle Emérite Université de Montpellier, Faculté des Sciences IMGT® Expert
    DUROUX Patrice Ingénieur de Recherche CNRS Computer manager
    GIUDICELLI Véronique Ingénieur de Recherche Université de Montpellier Bioinformatics manager
    MICHALOUD-JABADO Joumana Ingénieur d'Etude CNRS Biocurator, Quality Assurance Manager
    FOLCH Géraldine Ingénieur d'Etude (CDI CNRS) Biocurator, Communication
    AOUINTI Safa Ingénieur d'Etude (CDD CNRS), doctorante Biostatistics
    ARRIVET Mélanie Ingénieur d'Etude (CDD CNRS) Biocurator
    BENTO Pascal Ingénieur d'Etude (CDD CNRS) Informatics
    CARILLON Emilie Ingénieur d'Etude (CDD CNRS) Biocurator
    DUVERGEY Hugo Ingénieur d'Etude (CDD CNRS) Bioinformatics
    HOULES Amélie Ingénieur d'Etude (CDD CNRS) Webmaster
    LAVOIE Arthur Ingénieur d'Etude (CDD CNRS) Informatics
    PAYSAN-LAFOSSE Typhaine Ingénieur d'Etude (CDD CNRS) Bioinformatics
    PERALTA Marine Ingénieur d'Etude (CDD CNRS) Informatics
    SALJOQI Saïda Ingénieur d'Etude (CDD CNRS) Biocurator
    SASORITH Souphatta Ingénieur de Recherche (CDD CNRS) Bioinformatics
    Student (2015)
    BAEZA CENTURION Pablo University of Oxford Biology

    2014

    LEFRANC Marie-Paule PRCE2 Université Montpellier 2, UFR Sciences IMGT founder and director
    KOSSIDA Sofia Université Montpellier 2, UFR Sciences Professor
    LEFRANC Gérard Chercheur Emérite, Professeur Université Montpellier 2, UFR Sciences IMGT expert, LIGM group leader
    DUROUX Patrice Ingénieur de Recherche CNRS Computer manager
    GIUDICELLI Véronique Ingénieur de Recherche Montpellier 2 Bioinformatics manager
    MICHALOUD-JABADO Joumana Ingénieur d'Etude CNRS Biocurator, Quality Assurance Manager
    ALAMYAR Eltaf Ingénieur d'Etude (CDD CNRS) Informatics
    FOLCH-GENIES Géraldine Ingénieur d'Etude CNRS Biocurator
    SALJOQI Saïda Ingénieur d'Etude (CDD CNRS) Biocurator
    AOUINTI Safa Ingénieur d'Etude (CDD CNRS) Biostatistics
    CARILLON Emilie Assistant Ingénieur (CDD CNRS) Biocurator
    MORENO Denis Ingénieur d'Etude (CDD CNRS) Informatics
    SASORITH Souphatta Ingénieur de Recherche (CDD CNRS) Bioinformatics
    TOURNIER Caroline Ingénieur d'Etude (CDD CNRS) Bioinformatics
    DUVERGEY Hugo Ingénieur d'Etude (CDD CNRS) Bioinformatics
    PAYSAN-LAFOSSE Typhaine Ingénieur d'Etude (CDD CNRS) Bioinformatics
    HOULES Amélie Assistant Ingénieur (CDD CNRS) Communication - Webmaster
    BENTO Pascal Ingénieur d'Etude (CDD CNRS) Informatics
    PERALTA Marine Ingénieur d'Etude (CDD CNRS) Informatics
    LAVOIE Arthur Ingénieur d'Etude (CDD CNRS) Informatics
    Students and visitors (2014)
    HIBERT Charlotte DUT Université Montpellier 2 Informatics
    BAEZA CENTURION Pablo University of Oxford Biology

    2013

    LEFRANC Marie-Paule PRCE2 Université Montpellier 2, UFR Sciences IMGT founder and director
    LEFRANC Gérard Chercheur Emérite, Professeur Université Montpellier 2, UFR Sciences IMGT expert, LIGM group leader
    DUROUX Patrice Ingénieur de Recherche CNRS Computer manager
    GIUDICELLI Véronique Ingénieur de Recherche Montpellier 2 Bioinformatics manager
    MICHALOUD-JABADO Joumana Ingénieur d'Etude CNRS Biocurator, Quality Assurance Manager
    ALAMYAR Eltaf Ingénieur d'Etude (CDD CNRS) Informatics
    BELLAHCENE Fatena Ingénieur d'Etude (CDD CNRS) Biocurator
    FOLCH-GENIES Géraldine Ingénieur d'Etude CNRS Biocurator
    JOUFFRE Nelly Ingénieur d'Etude (CDD CNRS) Bioinformatics
    SALJOQI Saïda Assistant Ingénieur (CDD CNRS) Biocurator
    AOUINTI Safa Ingénieur d'Etude (CDD CNRS) Biostatistics
    CARILLON Emilie Assistant Ingénieur (CDD CNRS) Biocurator
    MORENO Denis Ingénieur d'Etude (CDD CNRS) Informatics
    SASORITH Souphatta Ingénieur de Recherche (CDD CNRS) Bioinformatics
    TOURNIER Caroline Ingénieur d'Etude (CDD CNRS) Bioinformatics
    DUVERGEY Hugo Ingénieur d'Etude (CDD CNRS) Bioinformatics
    PAYSAN-LAFOSSE Typhaine Ingénieur d'Etude (CDD CNRS) Bioinformatics

    2012

    LEFRANC Marie-Paule PRCE2 Université Montpellier 2, UFR Sciences IMGT founder and director
    LEFRANC Gérard Chercheur Emérite, Professeur Université Montpellier 2, UFR Sciences IMGT expert, LIGM group leader
    DUROUX Patrice Ingénieur de Recherche CNRS Computer manager
    GIUDICELLI Véronique Ingénieur de Recherche Montpellier 2 Bioinformatics manager
    MICHALOUD-JABADO Joumana Ingénieur d'Etude CNRS Biocurator
    ALAMYAR Eltaf Ingénieur d'Etude (CDD CNRS) Informatics
    BELLAHCENE Fatena Ingénieur d'Etude (CDD CNRS) Biocurator
    EHRENMANN François Ingénieur d'Etude (CDD CNRS) Bioinformatics
    FOLCH-GENIES Géraldine Ingénieur d'Etude (CDD CNRS) Biocurator
    JOUFFRE Nelly Ingénieur d'Etude (CDD CNRS) Bioinformatics
    LACAN Amandine Ingénieur d'Etude (CDD CNRS) Biocurator
    POIRON Claire Ingénieur d'Etude (CDD CNRS) Bioinformatics
    REGNIER Laëtitia Ingénieur d'Etude (CDD CNRS) Bioinformatics, Quality Assurance Manager
    SALJOQI Mansour Ingénieur d'Etude (CDD Université Montpellier 2) Informatics
    SALJOQI Saïda Assistant Ingénieur (CDD CNRS) Biocurator
    BROCHET Xavier Ingénieur d'Etude (CDD CNRS)
    CARILLON Emilie Assistant Ingénieur (CDD CNRS) Biocurator
    MORENO Denis Ingénieur d'Etude (CDD CNRS) Informatics
    SASORITH Souphatta Ingénieur de Recherche (CDD CNRS) Bioinformatics
    TOURNIER Caroline Ingénieur d'Etude (CDD CNRS) Bioinformatics
    Students and visitors (2012)
    AOUINTI Safa Master 2 Information Processing ans complexity of Living Biostatistics
    BARECHE Yacine Master STIC Université Montpellier 2 Bioinformatics

    2011

    LEFRANC Marie-Paule PRCE2 Université Montpellier 2, UFR Sciences IMGT founder and director
    LEFRANC Gérard Chercheur Emérite, Professeur Université Montpellier 2, UFR Sciences IMGT expert, LIGM group leader
    DUROUX Patrice Ingénieur de Recherche CNRS Computer manager
    GIUDICELLI Véronique Ingénieur de Recherche Montpellier 2 Bioinformatics manager
    MICHALOUD-JABADO Joumana Ingénieur d'Etude CNRS Biocurator
    GINESTOUX-BUSIN Chantal Technicien CNRS Webmaster
    ALAMYAR Eltaf Ingénieur d'Etude (CDD CNRS) Informatics
    BELLAHCENE Fatena Ingénieur d'Etude (CDD CNRS) Biocurator
    EHRENMANN François Ingénieur d'Etude (CDD CNRS) Bioinformatics
    FOLCH-GENIES Géraldine Ingénieur d'Etude (CDD CNRS) Biocurator
    JOUFFRE Nelly Ingénieur d'Etude (CDD CNRS) Bioinformatics
    LACAN Amandine Ingénieur d'Etude (CDD CNRS) Biocurator
    LANE Jérôme Postdoctorant (CDD CNRS) Bioinformatics
    POIRON Claire Ingénieur d'Etude (CDD CNRS) Bioinformatics
    REGNIER Laëtitia Ingénieur d'Etude (CDD CNRS) Bioinformatics, Quality Assurance Manager
    SALJOQI Mansour Ingénieur d'Etude (CDD Université Montpellier 2) Informatics
    SALJOQI Saïda Assistant Ingénieur (CDD CNRS) Biocurator

    2010

    LEFRANC Marie-Paule PRCE2 Université Montpellier 2, UFR Sciences IMGT founder and director
    LEFRANC Gérard Chercheur Emérite, Professeur Université Montpellier 2, UFR Sciences IMGT expert, LIGM group leader
    DUROUX Patrice Ingénieur de Recherche CNRS Computer manager
    GIUDICELLI Véronique Ingénieur de Recherche Montpellier 2 Bioinformatics manager
    MICHALOUD-JABADO Joumana Ingénieur d'Etude CNRS Biocurator
    GINESTOUX-BUSIN Chantal Technicien CNRS Webmaster
    ALAMYAR Eltaf Ingénieur d'Etude (CDD CNRS) Informatics
    BELLAHCENE Fatena Ingénieur d'Etude (CDD CNRS) Biocurator
    BROCHET Xavier Postdoc (CDD CNRS) Bioinformatics
    EHRENMANN François Ingénieur d'Etude (CDD CNRS) Bioinformatics
    FOLCH-GENIES Géraldine Ingénieur d'Etude (CDD CNRS) Biocurator
    JOUFFRE Nelly Ingénieur d'Etude (CDD CNRS) Informatics
    LACAN Amandine Ingénieur d'Etude (CDD CNRS) Biocurator
    LANE Jérôme Postdoctorant (CDD CNRS) Bioinformatics
    LE ROY Christophe Ingénieur d'Etude (CDD CNRS) Biocurator
    POIRON Claire Ingénieur d'Etude (CDD CNRS) Bioinformatics
    REGNIER Laëtitia Ingénieur d'Etude (CDD CNRS) Bioinformatics, Head of Quality Management
    SALJOQI Mansour Ingénieur d'Etude (CDD Université Montpellier 2) Bioinformatics
    SCHUMENG Marie Ingénieur d'Etude (CDD CNRS) Quality Engineer
    Students and visitors (2010)
    HUET Vincent Bachelor Bioinformatics, Bruges (Belgium)
    ZNASSI Nadia Master Intégration de compétences spécialité bio-informatique (Université Montpellier 2)

    2009

    LEFRANC Marie-Paule PRCE2 Université Montpellier 2, UFR Sciences IMGT founder and director
    LEFRANC Gérard PRCE2 Université Montpellier 2, UFR Sciences IMGT expert, LIGM group leader
    ALAMYAR Eltaf Ingénieur d'Etude (CDD CNRS) Informatics
    BELLAHCENE Fatena Ingénieur d'Etude (CDD CNRS) Biocurator
    BROCHET Xavier Postdoc (CDD CNRS) Postdoc
    DUROUX Patrice Ingénieur de Recherche CNRS Computer manager
    EHRENMANN François Ingénieur d'Etude (CDD CNRS) PhD student
    FOLCH-GENIES Géraldine Ingénieur d'Etude (CDD CNRS) Biocurator
    GEMROT Elodie Ingénieur d'Etude (CDD CNRS) Biocurator
    GINESTOUX-BUSIN Chantal Technicien CNRS Webmaster
    GIUDICELLI Véronique Ingénieur d'Etude Université Montpellier 2 Bioinformatics manager
    LACAN Amandine Ingénieur d'Etude (CDD CNRS) Biocurator
    LANE Jérôme Thèse (CDD Auxiliaire) PhD student
    LE ROY Christophe Ingénieur d'Etude (CDD CNRS) Biocurator
    MICHALOUD-JABADO Joumana Ingénieur d'Etude CNRS Biocurator
    OUARAY Zohra Ingénieur d'Etude (CDD CNRS) Bioinformatics
    POIRON Claire Ingénieur d'Etude (CDD CNRS) Bioinformatics
    REGNIER Laëtitia Ingénieur d'Etude (CDD CNRS) Bioinformatics, Head of Quality Management
    SCHUMENG Marie Ingénieur d'Etude (CDD CNRS) Quality Engineer
    OUARAY Zohra Ingénieur d'Etude (CDD Université Montpellier 2) Bioinformatics
    WU Yan Ingénieur d'Etude (CDD CNRS) Bioinformatics
    Students and visitors (2009)
    LACAN Amandine Master 2 Université Montpellier 2
    PROMSY Elsa Master 1 Université Montpellier 2

    2008

    LEFRANC Marie-Paule PRCE2 Université Montpellier 2, UFR Sciences IMGT founder and director
    LEFRANC Gérard PRCE2 Université Montpellier 2, UFR Sciences IMGT expert, LIGM group leader
    BELLAHCENE Fatena Ingénieur d'Etude (CDD CNRS) Biocurator
    BROCHET Xavier Thèse, Bourse Allocataire de Recherche PhD student
    DUROUX Patrice Ingénieur de Recherche (CDD CNRS) Computer manager
    EHRENMANN François Ingénieur d'Etude (CDD CNRS) Bioinformatics
    FOLCH-GENIES Géraldine Ingénieur d'Etude (CDD CNRS) Biocurator
    GEMROT Elodie Ingénieur d'Etude (CDD CNRS) Biocurator
    GINESTOUX-BUSIN Chantal Technicien CNRS IMGT interface design
    GIUDICELLI Véronique Ingénieur d'Etude Université Montpellier 2 Bioinformatics manager
    LANE Jérôme Thèse (CDD Auxiliaire) PhD student
    LUCAS Odile Ingénieur d'Etude (CDD ADER) Biocurator
    MICHALOUD-JABADO Joumana Ingénieur d'Etude CNRS Biocurator
    REGNIER Laëtitia Ingénieur d'Etude (CDD CNRS) Bioinformatics
    WU Yan Ingénieur d'Etude (CDD CNRS) Bioinformatics
    Students and visitors (2008)
    Philippe François Stage volontaire (Juillet-Août)

    2007

    LEFRANC Marie-Paule PRCE2 Université Montpellier 2, UFR Sciences IMGT founder and director
    LEFRANC Gérard PRCE2 Université Montpellier 2, UFR Sciences IMGT expert, LIGM group leader
    BELLAHCENE Fatena Ingénieur de Recherche (CDD ASA) Biocurator
    BROCHET Xavier Thèse, Bourse Allocataire de Recherche PhD student
    DUROUX Patrice Ingénieur de Recherche (CDD CNRS) Computer manager
    EHRENMANN François Ingénieur d'Etude (CDD CNRS) Bioinformatics
    FOLCH-GENIES Géraldine Assistant Ingénieur (CDD ADER) Biocurator
    GARAPATI Phani Vijay Assistant Ingénieur (CDD CNRS) Bioinformatics
    GINESTOUX-BUSIN Chantal Technicien CNRS IMGT interface design
    GIUDICELLI Véronique Ingénieur d'Etude Université Montpellier 2 Bioinformatics manager
    LANE Jérôme Thèse (CDD Auxiliaire) PhD student
    MICHALOUD-JABADO Joumana Ingénieur d'Etude CNRS Biocurator
    REGNIER Laetitia Ingénieur d'Etudes (CDD CNRS) Bioinformatics
    SERVIER Emmanuel-Jean Assistant ingénieur (CDD CNRS) Bioinformatics
    WU Yan Assistant Ingénieur (CDD CNRS) Bioinformatics
    Students and visitors (2007)
    Issam El Fatni Institut National des Sciences Appliquées et de Technologie
    Université du 7 Novembre, Cartage, Tunisie
    Marine Freychet L2 Université Montpellier 2

    2006

    LEFRANC Marie-Paule PRCE2 Université Montpellier 2, UFR Sciences IMGT founder and director
    LEFRANC Gérard PRCE2 Université Montpellier 2, UFR Sciences IMGT expert, LIGM group leader
    BROCHET Xavier Thèse, Bourse Allocataire de Recherche
    CHAUME Denys Ingénieur d'Etude CNRS Computer manager (Retirement 10 April 2006)
    DUROUX Patrice Ingénieur de Recherche (CDD CNRS) Computer manager
    EHRENMANN Francois Ingénieur d'Etude (CDD CNRS) Bioinformatics
    EL ALAOUI Wafae Thèse co-tutelle UMII et Université de montréal, Canada Analyse génomique et phylogénétique des gènes d'immunoglobulines et de récepteurs T de génomes nouvellement séquencés
    FOLCH-GENIES Géraldine CDD ADER Biocurator
    GARAPATI Phani Vijay Assistant Ingénieur (CDD CNRS) Bioinformatics
    GINESTOUX-BUSIN Chantal Technicien CNRS IMGT interface design
    GIUDICELLI Véronique Ingénieur d'Etude Université Montpellier 2 Bioinformatics manager
    KAAS Quentin PostDoc IMGT/3Dstructure-DB developer and manager
    MICHALOUD-JABADO Joumana Ingénieur d'Etude CNRS Biocurator
    SERVIER Emmanuel-Jean Assistant ingénieur (CDD CNRS) Bioinformatics
    Students and visitors (2006)
    LANE Jérôme Master 2 Pro-Compétences complémentaires en informatique, Université d'Angers
    LODHIA Seema ép. PALA Master 1 Pro-Parcours Bioinformatique, Université Montpellier 2
    WU Yan Bourse EGIDE

    2005

    LEFRANC Marie-Paule PRCE2 Université Montpellier 2, UFR Sciences IMGT initiator and coordinator
    LEFRANC Gérard PRCE2 Université Montpellier 2, UFR Sciences IMGT expert
    CHAUME Denys Ingénieur d'Etude CNRS Computer manager
    CLEMENT Oliver Ingénieur d'Etude CNRS (CDD) Computer manager
    DUPRAT Elodie Thesis, Bourse Allocataire de Recherche Caractérisation des domaines des superfamilles IgSF et MhcSF et classification fonctionnelle dans IMGT
    FOLCH-GENIES Géraldine CDD EUROGENTEC (contrat CEE) Biocurator, IMGT/PRIMER-DB
    GINESTOUX-BUSIN Chantal T3 CNRS IMGT interface design
    GIUDICELLI Véronique IE Université Montpellier 2 Bioinformatics manager
    KAAS Quentin Thesis, Bourse Allocataire de Recherche Analyse structurale des récepteurs d'antigènes dans IMGT et modélisation moléculaire
    MICHALOUD-JABADO Joumana CDD CNRS (Contrat CEE) Biocurator
    NEGRE Vincent CDD CNRS 01/07/2004 - 15/05/2005 (collaboration Thullier, Grenoble)
    POMMIE Christelle Thesis, Bourse Allocataire de Recherche-Moniteur Statistical methods
    Students and visitors (2005)
    EHRENMANN Francois DESS Bioinformatique, UMII Développement d'une interface graphique pour les oligonucléotides dans IMGT/PRIMER-DB
    EL ALAOUI Wafae Thèse co-tutelle UMII et Université de montréal, Canada Analyse génomique et phylogénétique des gènes d'immunoglobulines et de récepteurs T de génomes nouvellement séquencés
    FRIGOUL Aurelie Mention Biologie-Santé,Master Pro Nutrition, Aliment, Santé Publique, UMII Analyse bioinformatique standardisée des domaines de la superfamille du MHC (MhcSF) en prenant comme exemples MICA et MICB
    HENRY Arnaud Maîtrise IUP Bio-Technologies et Bio-Industrie, GBI3 Université d'Evry, Val d'Essonne Alignement et implémentation d'un outil « Aligmnent of alleles » (séquences nucléotidiques et protéiques de domaines de la MhcSF)
    SERVIER Emmanuel Jean DESS Bioinformatique, UMII Implémentation d'un serveur en Distributed Annotation System DAS à l'EBI, pour les gènes des IG et TR, à partir des données d'IMGT
    ZAGHLOUL Lamia 5ème année Bioinformatique et Modélisation Institut National des Sciences Appliquées de Lyon Analyse et implémentation d'une base de données de gènes de la superfamille des immunoglobulines (IgSF) et du MHC (MhcSF) et développement d'outils pour l'étude des domaines

    2004

    LEFRANC Marie-Paule PRCE2 Université Montpellier 2, UFR Sciences, Membre Senior de l’Institut Universitaire de France, IMGT Founder and Director
    LEFRANC Gérard PRCE2 Université Montpellier 2, UFR Sciences, Research 'Consanguinity and rare autosomal diseases'
    CHAUME Denys Computer manager, IE CNRS
    CLEMENT Oliver Informatics, CDD (CNRS)
    COMBRES Kora Informatics, CDD (CNRS/CEE)
    DUPRAT Elodie Thesis, Allocataire de recherche MEN
    FOLCH Géraldine Biocurator, CDD
    GINESTOUX-BUSIN Chantal IMGT web manager, T3 CNRS
    GIUDICELLI Véronique Bioinformatics, IGE2 Université Montpellier 2
    HENRY Ruth Secretariat, CES (CNRS)
    JABADO-MICHALOUD Joumana Biocurator, CDD (PPF, Université Montpellier 2)
    KAAS Quentin Thesis, Allocataire de recherche MEN
    NEGRE Vincent CDD CNRS (collaboration Ph. Thullier, Grenoble)

    2003

    LEFRANC Marie-Paule PRCE2 Université Montpellier 2, UFR Sciences, Membre Senior de l’Institut Universitaire de France, IMGT Founder and Director
    LEFRANC Gérard PRCE2 Université Montpellier 2, UFR Sciences, Research 'Consanguinity and rare autosomal diseases'
    BOSC Nathalie Biocurator, CDD (CNRS/CEE, CNRS.interEPST)
    CHAUME Denys Computer manager, IE CNRS
    COMBRES Kora Informatics, CDD (CNRS/CEE)
    DUPRAT Elodie Thesis, Allocataire de recherche MEN
    FOLCH Géraldine Biocurator, CDD (EUROGENTEC/ CEE, ADER UM2)
    GINESTOUX Chantal IMGT web manager, T3 CNRS
    GIUDICELLI Véronique Bioinformatics, IGE2 Université Montpellier 2
    GOMEZ Anita CES (CNRS)
    GUIRAUDOU Delphine Biocurator, CDD (CNRS/CEE)
    HENRY Ruth Secretariat, CES (CNRS)
    JABADO-MICHALOUD Joumana Biocurator, CDD (CNRS/CEE)
    KAAS Quentin Thesis, Allocataire de recherche MEN
    MAGRIS Séverine Biocurator, CDD (CNRS/Génopole)
    POMMIE Christelle Thesis, Allocataire de recherche - Moniteur
    PROTAT Céline Biocurator, CDD (UM2, CNRS/interEPST)
    SCAVINER Dominique Biocurator, CDD (CNRS/CEE, CNRS/interEPST)
    THOUVENIN-CONTET Valérie Scientific secretariat, CDD (CNRS/CEE)
    YOUSFI MONOD Mehdi Scientific Summer job, CDD (ADER)

    2002

    LEFRANC Marie-Paule PRCE2 Université Montpellier 2, UFR Sciences, Membre Senior de l’Institut Universitaire de France, IMGT Founder and Director
    LEFRANC Gérard PRCE2 Université Montpellier 2, UFR Sciences, Research 'Consanguinity and rare autosomal diseases'
    BONNET-SAIDALI Nora CDD (ADER, CNRS)
    BOSC Nathalie Biocurator, CDD (CNRS/CEE)
    CHAUME Denys Computer manager, IE CNRS
    COMBRES Kora Informatics, CDD (CNRS/CEE)
    DUPRAT Elodie Thesis, Allocataire de recherche MEN
    ELEMENTO Olivier Thesis, Allocataire de recherche MEN, CDD (ADER)
    FOLCH Géraldine Biocurator, CDD (EUROGENTEC/ CEE)
    GASULL Serge CDD (ADER, PPF)
    GINESTOUX Chantal IMGT web manager, T3 CNRS
    GIUDICELLI Véronique Bioinformatics, IGE2 Université Montpellier 2
    GOMEZ Anita CES (CNRS)
    GUIRAUDOU Delphine Biocurator, CDD (CNRS/CEE)
    JABADO-MICHALOUD Joumana Biocurator, CDD (CNRS/CEE)
    KAAS Quentin Thesis, Allocataire de recherche MEN
    MAGRIS Séverine Biocurator, CDD (CNRS/Génopole)
    POMMIE Christelle Thesis, Allocataire de recherche - Moniteur
    PROTAT Céline Biocurator, CDD (Université Montpellier 2)
    SCAVINER Dominique Biocurator, CDD (CNRS/CEE)
    THOUVENIN-CONTET Valérie Scientific secretariat, CDD (CNRS/CEE)
    YOUSFI MONOD Mehdi Scientific Summer job, CDD (ADER)

    2001

    LEFRANC Marie-Paule PRCE2 Université Montpellier 2, UFR Sciences, IMGT Founder and Director
    LEFRANC Gérard PRCE2 Université Montpellier 2, UFR Sciences, Research 'Consanguinity and rare autosomal diseases'
    BONNET-SAIDALI Nora CDD (ADER, CNRS)
    BOSC Nathalie Biocurator, CDD (CNRS/CEE)
    CHAUME Denys Computer manager, IE CNRS
    COMBRES Kora Informatics, CDD (CNRS/CEE)
    DUPRAT Elodie Thesis, Allocataire de recherche MEN
    ELEMENTO Olivier Thesis, Allocataire de recherche MEN
    FOLCH Géraldine Biocurator, CDD (EUROGENTEC/ CEE)
    FOULQUIER Elodie Biocurator, CDD (ADER)
    GINESTOUX Chantal IMGT web manager, T3 CNRS
    GIUDICELLI Véronique Bioinformatics, IGE2 Université Montpellier 2
    GODIRIS Chrystel CES (CNRS)
    JABADO-MICHALOUD Joumana Biocurator, CDD (CNRS/CEE)
    JEAN-MARTINEZ Christèle Biocurator, CDD (CNRS)
    KAAS Quentin Thesis, Allocataire de recherche MEN
    POMMIE Christelle Thesis, Allocataire de recherche - Moniteur
    ROUARD Mathieu Scientific Summer job, Vacations CNRS
    RUIZ Manuel Thesis, Bourse Région, CDD (AFM)
    SCAVINER Dominique Biocurator, CDD (CNRS/CEE)
    THOUVENIN-CONTET Valérie Scientific secretariat, CDD (CNRS/CEE)
    VUILLEMIN Jean-Marc CDD IE (Genopole)
    YOUSFI MONOD Mehdi Scientific Summer job, CDD (ADER)

    2000

    LEFRANC Marie-Paule PRCE2 Université Montpellier 2, UFR Sciences, IMGT Founder and Director
    LEFRANC Gérard PRCE2 Université Montpellier 2, UFR Sciences, Research 'Consanguinity and rare autosomal diseases'
    BERANGER Sandrine Biocurator (CDD CNRS)
    BOSC Nathalie Biocurator, CDD (ADER)
    CHAUME Denys Computer manager, IE CNRS
    ELEMENTO Olivier Thesis, Allocataire de recherche MEN
    FOLCH Géraldine Biocurator, EUROGENTEC
    GINESTOUX Chantal IMGT web manager, T3 CNRS
    GIUDICELLI Véronique Bioinformatics, IGE2 Université Montpellier 2
    GODIRIS Chrystel CES (CNRS)
    MARLHENS Françoise Formation permanente
    MARTINEZ Christèle Biocurator, CDD (CNRS)
    POMMIE Christelle Thesis, Allocataire de recherche - Moniteur
    RODRIGUES Pauline CES (CNRS)
    RUIZ Manuel Thesis, Bourse ARC
    SCAVINER Dominique Biocurator, CDD (ADER, CNRS/CEE)
    THOUVENIN-CONTET Valérie Scientific secretariat, CDD (ADER, CNRS/CEE)
    VUILLEMIN Jean-Marc CDD IE (Genopole)

    1999

    LEFRANC Marie-Paule PRCE2 Université Montpellier 2, UFR Sciences, IMGT Founder and Director
    LEFRANC Gérard PRCE2 Université Montpellier 2, UFR Sciences, Research 'Consanguinity and rare autosomal diseases'
    ABAD Johanne Biocurator, Vacations (CNRS)
    ARTERO Sylvaine Biocurator, CDD (CNRS)
    BARBIE Valérie Biocurator, CDD (CNRS)
    BOSC Nathalie Biocurator, Vacations (CNRS)
    CHAUME Denys Computer manager, IE CNRS
    ELEMENTO Olivier Thesis, Allocataire de recherche MEN
    FOLCH Géraldine Biocurator, EUROGENTEC
    GINESTOUX Chantal IMGT web manager, T3 CNRS
    GIUDICELLI Véronique Bioinformatics, CDD UM2 (recruited IGE2 UM2 01/11/99)
    MARLHENS Françoise Formation permanente
    MARTINEZ Christèle Biocurator, CDD (CNRS)
    RUIZ Manuel Thesis, CDD (CNRS)
    SCAVINER Dominique Biocurator, CDD (CNRS/CEE)
    THOUVENIN-CONTET Valérie Scientific secretariat, CDD (CNRS/CEE)

    1998

    LEFRANC Marie-Paule PRCE2 Université Montpellier 2, UFR Sciences, IMGT Founder and Director
    LEFRANC Gérard PRCE2 Université Montpellier 2, UFR Sciences, Research 'Consanguinity and rare autosomal diseases'
    ABAD Johanne Biocurator, CES (CNRS)
    ARTERO Sylvaine Biocurator, CDD (CNRS)
    BARBIE Valérie Biocurator, EUROGENTEC, CDD (CNRS)
    CHAUME Denys Computer manager, IE CNRS
    CONTET Valérie Scientific secretariat, Vacations (CNRS)
    FOLCH Géraldine Biocurator, EUROGENTEC
    GINESTOUX Chantal IMGT web manager, T3 CNRS
    GIUDICELLI Véronique Bioinformatics, CDD UM2
    MARTINEZ Christèle Biocurator, CDD (CNRS)
    RUIZ Manuel Thesis, CDD (CNRS)
    SCAVINER Dominique Biocurator, CDD (CNRS/CEE)
    SERRE-BERRIERE Nathalie CES (CNRS)

    1997

    LEFRANC Marie-Paule PRCE2 Université Montpellier 2, UFR Sciences, IMGT Founder and Director
    LEFRANC Gérard PRCE2 Université Montpellier 2, UFR Sciences, Research 'Consanguinity and rare autosomal diseases'
    BARBIE Valérie Biocurator, EUROGENTEC
    BOUISSON Anne Biocurator, CDD (ADER)
    CHAUME Denys Computer manager, IE CNRS
    CONTET Valérie Scientific secretariat, Vacations (CNRS)
    FOLCH Géraldine Biocurator, CDD (CNRS)
    GINESTOUX Chantal IMGT web manager, T3 CNRS
    GIUDICELLI Véronique Bioinformatics, CDD (ADER, UM2)
    PALLARES Nathalie Biocurator, CDD (CNRS/CEE)
    RUIZ Manuel CDD (ADER)
    SCAVINER Dominique Biocurator, CDD (CNRS/CEE)
    SERRE-BERRIERE Nathalie CES (CNRS)

    1996

    LEFRANC Marie-Paule PRCE1 Université Montpellier 2, UFR Sciences, IMGT Founder and Director
    LEFRANC Gérard PRCE2 Université Montpellier 2, UFR Sciences, Research 'Consanguinity and rare autosomal diseases'
    BARBIE Valérie Biocurator, CDD (ADER)
    BOUISSON Anne Biocurator, CDD (ADER)
    CHAUME Denys Computer manager, IE CNRS
    FOLCH Géraldine Biocurator, CDD (ADER)
    GINESTOUX Chantal IMGT web manager, T3 CNRS
    GIUDICELLI Véronique Bioinformatics, CDD (ADER)
    MORELLE Bruno Biocurator, CDD (ADER)
    PALLARES Nathalie Biocurator, CDD (ADER)
    ROUSSEAUX Gaëlle Biocurator, CDD (ADER)
    SERRE-BERRIERE Nathalie CES (CNRS)

    1995

    LEFRANC Marie-Paule PRCE1 Université Montpellier 2, UFR Sciences, IMGT Founder and Director
    LEFRANC Gérard PRCE2 Université Montpellier 2, UFR Sciences, Research 'Consanguinity and rare autosomal diseases'
    CHAUME Denys Computer manager, IE CNRS
    DRIDER-RENE Christine CES (CNRS)
    FLOUTARD Régine CDD (CEE, ADER)
    FOLCH Géraldine Biocurator, CDD (ADER)
    GINESTOUX Chantal CDD CNRS (recruited T3 CNRS 01/12/95)
    GIUDICELLI Véronique Bioinformatics, CDD (ADER)
    LEFEBVRE Sophie CDD (ADER, 2months)
    MORELLE Bruno Biocurator, CDD (ADER)
    ROUSSEAUX Gaëlle CDD (ADER)
    SERRE-BERRIERE Nathalie CES (CNRS)

    Students and visitors (2003-2004)

    BELKEBIR Nabil DESS IASV (Informatique et Applications aux Sciences de la Vie) Université René Descartes Développement d’un outil informatique pour l’analyse des mutations hypersomatiques des immunoglobulines, au sein d’IMGT, the international ImMunoGeneTics information system®, http://www.imgt.org
    IMGT/table of alleles
    CARNEC Alain Licence Biochimie UMII Expertise des données des protéines MHC-like (HFE et FCGRT) (humain)
    CHASTELLAN Patrick DESS Bioinformatique, UMII Modélisation de IMGT-Chroreography et implémentation de Web services IMGT/Allele-Align
    CLAVERT Nathalie Maîtrise IUP TASV MHC-like (RAET1, H, I, L et N) Locus RAE humain
    COEHLO Isabelle DESS Bioinformatique, UMII IMGT/PROTEIN-DB
    Outils d'entrée de données
    DOUCHY Laurent Maîtrise Biochimie, UMII Analyse standardisée des gènes et protéines FCGR2A et FCGR2B humains, étude et utilisation d’outils bioinformatiques pour l’introduction des données expertisées dans les différentes bases de IMGT, http://www.imgt.org
    FATTOUM Fadhel 2ème année Ecole d’Ingénieur - Tunis Implémentation d’un outil en Java pour la représentation des exons-introns d'un gène
    GARELLE Valérie DESS Bioinformatique, Poitiers Création et visualisation d'un outil interactif d'alignement des domaines IMGT/Domain-Align
    GAUBY Guillaume Ecole des Mines d'Alès IMGT-Choreography
    GHAYAD Sandra Faculté des Sciences de l’Université St Joseph, Beyrouth - Liban Evolution structurale et fonctionnelle du CD1 humain (CD1A, B, C, D, E)
    MONNIER Bertrand Maîtrise BioCell et Physio Analyse bioinformatique d'une famille multigénique: séquences polymorphiques et structures 3D pour l'entrée dans IMGT, the international ImMunoGeneTics information system® http://www.imgt.org
    Les récepteurs Fc gamma humains (FCGR1A, B, C) et murins (FCGR1).
    PARROD Elise 3è année iup Génie Biologique et Informatique (GBI), Evry Val d'Essone Implantation des outils statistiques pour l'analyse des résultats de l'outil IMGT/JunctionAnalysis représentation des classes d'acides aminés
    REBAI Ahmed Visitor
    Centre de Biotechnologie de Sfax, Unité de Bioinformatique
    07/07/2004 – 20/07/2004
    RONDEAU Erwan DESS Compétence Informatique, Faculté des sciences et techniques de Corte Représentation graphique de locus de familles multigéniques et d’histogrammes d’utilisation des gènes, dans IMGT (Java)
    SARNIGUET Fabrice DESS méthodes stat. dans les industries agronomiques, agroalimentaires et pharmaceutiques, Montpellier 2 Analyse statistiques des contacts peptide-MHC-TR
    SPIESSER Thomas Etudiant ERASMUS, Universitaet Berlin Bioinformatics analysis of a multigene family: sequences, polymorphisms and 3D structures data for entry in IMGT, the international ImMunoGeneTics information system®: human Fc epsilon receptors (FCERI)
    TOURNEUR Guillaume DESS Bioinformatique, Poitiers Analyse structurale et visualisation des G-DOMAIN (technologie XML)

    Students and visitors (2002-2003)

    BENABDELKRIM EL FILALI Naoufel Maîtrise Biochimie, Université Montpellier 2 Caractérisation des poches de liaison des peptides au MHC dans IMGT/3Dstructure-DB
    BOUCOMONT Elodie 1ère année DUT Génie Biologique option Bioinformatique, IUT Clermont-Ferrand, antenne Aurillac
    CHASTELLAN Patrick Maîtrise Biochimie, Université Montpellier 2 Développements d'IMGT liés aux attentes ciblées d'utilisateurs professionnels
    GARELLE Valérie IUP Bioinformatique, Poitiers L'analyse structurale des G DOMAIN (technologie XML) ou La représentation automatique des allèles (PERL)
    GOMEZ Anita CES CNRS, Secretary
    JEANJEAN Stéphanie DESS Bioinformatique, Université Montpellier 2 Analyse et représentation des données d'expression dans IMGT, the international ImMunoGeneTics information system®, http://www.imgt.org
    MRANI Amina Postdoctoral visitor (Université d'Agadir, Maroc) IMGT Lexique
    ROBERT Lorenne DESS Bioinformatique, Université Montpellier 2 Constitution d'une base de données de peptides antimicrobiens de Peneides
    TORREGROSSA Valérie Licence professionnelle Informatique, IUT de Montpellier (développeur d'applications e-business) Mise en place d'un serveur SOAP (communication par XML)
    TOURNEUR Guillaume IUP Bioinformatique, Poitiers L'analyse structurale des G DOMAIN (technologie XML) ou La représentation automatique des allèles (PERL)

    Students and visitors (2001-2002)

    BERTRAND Julien Maîtrise Biochimie, Université Montpellier 2, CDD ADER (PPF) Analyse et implémentation de IMGT/PRIMER-DB
    FONTAINE Anne-Catherine Espace Ifad, Montpellier, Secrétariat Scientifique Connaissance des métiers pour construire son parcours professionnel
    GASULL Serge Ecole des Techniques du Génie Logiciel
    LEVADOUX Séverine Maîtrise de Biologie Cellulaire et Physiologie, Université Clermont-Ferrand
    PIMENTEL Cyril Maîtrise de Biochimie, Université Montpellier 2
    PROTAT Céline DESS Bioinformatique, Université Montpellier 2
    PROVENZALE Jean-Max IUT Nîmes, Université Montpellier 2
    REVERSEAU Céline IAE, Université Montpellier 2
    TRANNE Madeleine Maîtrise de Biochimie, Université Montpellier 2

    Students (2000-2001)

    COMBRES Kora DU Conception et Ingénierie informatique, IUT, Université Montpellier 2 Programme de comparaison entre 2 fichiers XML
    DANIS Sophie IUT Informatique, Université Montpellier 2 Représentation graphique des gènes recensés dans IMGT
    DE LOVINFOSSE Jean-Yves Maîtrise Biochimie, Université Montpellier 2 Analyse biologique précédant l'implémentation informatique de la base de données IMGT/PRIMER-DB
    FABRE Eric IUT Montpellier Année Spéciale, Université Montpellier 2 Représentation graphique en "Collier de Perles" d'une séquence protéique
    GOPOIS Céline Maîtrise de Physiologie Animale, Université Montpellier 2 Analyse des données pour la soumission dans IMGT/PRIMER-DB
    GUILLAUME Julien DESS IAO, Université Montpellier 2 Analyse de faisabilité d'un outil de traitement automatique de l'annotation de séquences génétiques: utilisation de XML dans l'application IMGT/LIGM-DB
    PAILLART Baptiste Magistère "Mathématiques et modélisation informatique", 2ème année, Rennes Modélisation des données structurales dans IMGT
    PIMENTEL Cyril Licence Biochimie, Université Montpellier 2 Analyse des données pour la soumission dans IMGT/PRIMER-DB
    POULAIN Pierre Ecole Nationale Supérieure de Chimie de Montpellier Outils de visualisation 3D des données structurales dans IMGT
    RAYMOND Bertrand DESS IAO, Université Montpellier 2 Analyse de faisabilité d'un outil de traitement automatique de l'annotation de séquences génétiques: utilisation de XML dans l'application IMGT/LIGM-DB
    ROUARD Mathieu Maîtrise Biochimie, Université Montpellier 2 Analyse et mise en place d'une numérotation unique pour les domaines constants de la superfamille des immunoglobulines
    SEGUI Sandra Maîtrise de Physiologie Animale, Université Montpellier 2 Analyse des données pour la soumission dans IMGT/PRIMER-DB
    TRUONG Lisa DU Immunologie, Université Montpellier 1 Analyse pour une description standardisée des séquences et structures des anticorps humanisés dans IMGT
    YOUSFI Mehdi Licence Bioinformatique, Université Montpellier 2 Implémentation d'un outil pour l'analyse des jonctions des gènes réarrangés des immunoglobulines et récepteurs T
    Réalisation: IMGT/JunctionAnalysis
    BEAUCLAIR Sylvie DU Conception et ingénierie informatique, IUT Montpellier. Programme de calculs statistiques et représentations dynamiques des connexions au site IMGT

    IMGT® Founder and director (1989-2014), Professor Emeritus (2015-2019)

    Marie-Paule Lefranc

    Marie-Paule Lefranc IMGT® Founder: IMGT®, the international ImMunoGeneTics information system®, Senior member of the Institut Universitaire de France
    Chair of Immunogenetics and Immunoinformatics
    Département d'Enseignement Biologie-Mécanismes du Vivant (Bio-MV)
    Institut de Génétique Humaine, IGH, UMR9002 CNRS-UM, (DR13)

    Mail address:
    IMGT®, the international ImMunoGeneTics information system®
    Laboratoire d'ImmunoGénétique Moléculaire
    Institut de Génétique Humaine, IGH, UMR9002 CNRS-UM
    141 rue de la Cardonille
    34396 Montpellier Cedex 5, France

    +33 (0)4 11 75 97 28 /+33 (0)4 11 75 97 29
    +33 (0)4 34 35 99 01
    Marie-Paule.Lefranc@igh.cnrs.fr

    Curriculum Vitae (Summary)
    Curriculum Vitae (in French)

    IMGT® Founder and director (1989-2014), Professor Emeritus (2015-2018)

    Gérard Lefranc

    Gerard Lefranc IMGT®, the international ImMunoGeneTics information system®, IMGT® Expert 'Consanguinity and rare autosomal diseases'
    Département d'Enseignement Biologie-Mécanismes du Vivant (Bio-MV)
    Institut de Génétique Humaine, IGH, UMR9002 CNRS-UM, (DR13)


    Mail address:
    IMGT®, the international ImMunoGeneTics information system®
    Laboratoire d'ImmunoGénétique Moléculaire
    Institut de Génétique Humaine, IGH, UMR9002 CNRS-UM
    Université de Montpellier, CC091
    Place Eugène Bataillon
    34095 Montpellier Cedex 5, France

    +33 (0)4 11 75 97 29
    +33 (0)4 67 14 37 79
    gerard.lefranc@umontpellier.fr

    Curriculum Vitae (in French) 
    Rammal award 2006 

    LIGM

    Laboratoire d'ImmunoGénétique Moléculaire (LIGM)
    Montpellier (France)

    LIGM background

    The Laboratoire d'ImmunoGénétique Moléculaire (LIGM) was created by Prof. Marie-Paule Lefranc and Prof. Gérard Lefranc, at Montpellier in March 1983 (Université de Montpellier and CNRS). The Professors Marie-Paule and Gérard Lefranc have been involved for 50 years in the genetics of rare diseases in congenital families (first in Lebanon at the University of Saint-Joseph at Beirut, then in Tunisia at the Faculté de Pharmacie et de Médecine Dentaire at Monastir that they contributed to create) and in the structure, polymorphism and function of the antigen receptors of the adaptive immune responses, the immunoglobulins (IG) or antibodies and T cell receptors (TR).

    The scientific contribution of LIGM is shown by publications in international journals, communications, invitations to congresses and seminars, the isolation of 40 genomic probes. These probes, released by ATCC (American Type Culture Collection), JCRB (Japanese Cancer Research Resources Bank) and ICRF (Imperial Cancer Research Fund, Human Genetic Resource Centre), are used by many laboratories abroad, for fundamental research and clinical applications. Some of these probes are powerful tools in the characterisation of the B and T cells, the analysis of clonality in leukemias and lymphomas, and the therapeutics follow up (residual diseases). 134 genomic sequences have been sent to the EMBL/GenBank databases.

    In 1989, LIGM started IMGT/LIGM-DB the first specialised and integrated database on immunoglobulins (IG) and T cell receptors (TR). Since May 2000 and owing to the considerable expansion and success of IMGT®, the international ImMunoGeneTics information system®, the LIGM scientific activity has been mainly devoted to the IMGT research and development.

    • LIGM Trainees Licence-Maîtrise-DU-DESS-ERASMUS (1994-2002) pdf
    • LIGM Trainees DEA (1984-2000) pdf
    • LIGM PhD Theses (1982-2009) pdf

    LIGM areas

    • Genetics, structure, polymorphism, function and dysregulation of the Immunoglobulins (IG) and T cell receptors (TR).
    • Antibody engineering, expression of scFv (single chain Fv) and Fab antibody fragments, at the surface of filamentous phages, combinatorial libraries.
    • Humanisation of monoclonal antibodies by construction of chimeric antibodies or reshaping of hypervariable regions. Expression of chimeric and humanised antibodies in insect cells using baculovirus vectors (in collaboration with Protéine Performance) ("ADER" Prize, 1994).
    • Intracellular targeting of antibody fragments. Intracellular immunisation.
    • Since 1989: immunoinformatics, bioinformatics in the field of immunogenetics, development of IMGT/LIGM-DB (created in 1989, on the Web in 1995), and of the IMGT information system (implementation of new databases and tools), based on IMGT-ONTOLOGY
    • IG and TR nomenclature
      • Lefranc, M.-P. and Lefranc, G. The Immunoglobulin FactsBook Academic Press, London, UK (458 pages), 2001.
      • Lefranc, M.-P. and Lefranc, G. The T cell receptor FactsBook Academic Press, London, UK (398 pages), 2001.
      • Lefranc M-P. Immunoglobulin (IG) and T cell receptor genes (TR): IMGT® and the birth and rise of immunoinformatics.
        Front Immunol. 2014 Feb 05;5:22. doi: 10.3389/fimmu.2014.00022. Open access. PMID: 24600447
    • Current main project: IMGT®, the international ImMunoGeneTics information system® (http://www.imgt.org).
      In 2017, 7 databases (sequences, genes, structures), 17 tools and more than 20,000 pages of Web resources.

    LIGM founding of IMGT

    IMGT®, the international ImMunoGeneTics information system®, the global reference in immunogenetics and immunoinformatics (http://www.imgt.org), was founded by LIGM (Prof. Marie-Paule Lefranc and Prof. Gérard Lefranc, University of Montpellier and CNRS, in 1989, in Montpellier (France).

    IMGT® Founder Marie-Paule Lefranc, Director for 25 years (1989-2014) is Executive Director Emeritus since January 1, 2015.

    LIGM activity reports

    Scientific Advisory Board

    The role of the members of the Scientific Advisory Board (SAB) is to meet and make non-binding suggestions and recommendations on matters within the areas of their experience and expertise.

    Current members

    Adrian Altenhoff (2023 - )
    ETH Zurich, Swiss Bioinformatics Institute (SIB), Switzerland
    Yiming Bao (2023 - )
    Beijing Institute of Genomics (BIG), Chinese Academy of Sciences (CAS), China
    Thomas Keane (2023 - )
    EMBL-EBI, Hinxton, UK
    Catherine Prades (2023 - )
    Sanofi, Paris, France
    Kostas STAMATOPOULOS (2024 -)
    CERTH, Centre for Research and Technology, Greece

    Contact

    Email

    contact-imgt at igh.cnrs.fr

    Address

    • Mail: Faculté de Pharmacie, 15 avenue Charles Flahault, BP 14491, 34093 Montpellier Cedex 5, France
    • Building: I - last floor
    • Phone: +33(0) 4 11 75 97 28

    Access

    • Tram line 1: Boutonnet - Cité des Arts or Saint-Éloi
    • Bus lines 10 and 15: Faculté de Pharmacie
    • Bus line 10: Pierre d'Adhémar
    • Bus line 15: Voie Domitienne
    • Bus line 7: Cité Roger

    Map

    Map

    Terms of use

    Copyright© 1995-2026, IMGT®, the international ImMunoGeneTics information system®. All rights reserved.

    "IMGT®, the international ImMunoGeneTics information system®" is covered by a copyright© since 1995 - All rights reserved.

    Intellectual property

    Trademarks

    IMGT®, the international ImMunoGeneTics information system® and its logo are registered marks of Centre National de la Recherche Scientifique (CNRS).

    Patents and Certificat Inter Deposit Digital Numbers (IDNN)

    Registered patents and Certificat Inter Deposit Digital Number (IDNN) are deposited in the name of University of Montpellier and CNRS.

    Conditions of use and license

    The IMGT® information system and website were created and are maintained by the Institute of Human Genetics - IGH (Université de Montpellier and CNRS), as the global reference in immunogenetics and immunoinformatics, for scientific research and educational purpose.
    As of 1st July 2026, IMGT® has been granted ELIXIR Core Data Resource (CDR) status. This designation recognizes life science databases that meet high standards of quality, sustainability, and community impact, ensuring the provision of trusted and reliable data for both public and private users.
    The IMGT® data are provided to both public and private users under the CC BY-4.0 license. For any use of IMGT® tools, please submit your request at the following contact : contact-imgt@igh.cnrs.fr. To support IMGT®â€™s ongoing development, updates, and operations, a financial contribution may be requested from users using the resource, excluding IMGT data. More specifically, this does not affect the CC BY 4.0 licence applicable to the IMGT® data and metadata.

    IMGT® is an ELIXIR Core Data Resource.

    Bot policy

    The IMGT® information system and web site might restrict or forbid some content to bots. A captcha would be prompted, after cookie acceptation.
    See more information on our bot policy page.

    The name of IMGT®, the international ImMunoGeneTics information system® should not be associated with publicity or business promotion without prior written approval.

    Our website does not host any form of advertisement.

    Warranty disclaimer

    No responsibility is assumed by IMGT®, the international ImMunoGeneTics information system® for any injury and/or damage to persons or property as a matter of products liability, negligence or otherwise, or from any use of operation of any methods, products, instructions or ideas contained in IMGT®. Links from IMGT® to third-party sites do not constitute an endorsement by IMGT® of the parties or their products and services. No responsibility is assumed by IMGT® for any technical issues arising on the site.

    Liability

    For documents and software available from the IMGT®, Université de Montpellier and CNRS do not warrant or assume any legal liability or responsibility for the accuracy, completeness, or usefulness of any information, apparatus, product, or process disclosed.

    Endorsement

    IMGT® does not endorse or recommend any commercial products, processes, or services. The views and opinions of authors expressed on IMGT® do not necessarily state or reflect those of University of Montpellier and CNRS, and they may not be used for advertising or product endorsement purposes.

    External links

    IMGT® may provide links to other Internet sites for the convenience of users. IMGT® is not responsible for the availability or content of these external sites, nor does IMGT® endorse, warrant, or guarantee the products, services, or information described or offered at these other Internet sites.

    Users cannot assume that the external sites will abide by the same Privacy policy to which IMGT® adheres. It is the responsibility of the user to examine the copyright and licensing restrictions of linked pages and to secure all necessary permissions.

    Notice and Procedure for Claims of Authorship and or Patent Infringements

    IMGT® respects the intellectual property rights of others and takes claims of copyright and trademark infringement very seriously. We publish the works displayed on our website from researchers and other rights holders to ensure our compliance with applicable law. If you believe any materials accessible on or from this site infringe your intellectual property, you may request removal of those materials (or access to them) by contacting Contact us.

    General Data Protection Regulation (GDPR)

    Data collection

    • For some of the IMGT® tools, access requires you to register with institutional data.
    • This data is used to check your identity and for internal statistical purposes only. We do not share your information (in aggregated or other non-personally identifiable form(s)) with any third party members.
    • This data is accessible to IMGT® administrators only.

    Data retention period

    • We retain the information that we collect about you for the total period of 4 years irrespective of the type of users (such as academic, company and services sector users). At the end of 4 years period the user information will be deleted from our records.
    • Ownership: We do not own your information (be it Personally Identifiable Information or Non Personally Identifiable Information).
    • Your Scientific Data Submission and Storage: Typically, a user(s) scientific data input(s) and its corresponding output(s) are stored at the IMGT® server(s) for an average period between 4 months to 6 months (before clearing it).

    Personal rights

    In accordance with the law Nº 78-17, "Informatique et Libertés" ("Information Technology and Freedoms") of 6th January 1978, IMGT registration procedure is declared to the CNIL, and recorded in dossier Nº 2-16051.

    In compliance with the applicable legal and regulatory provisions - in particular Act n°78-17 of 6 January 1978 on Data Processing, Data Files and Individual Liberties and European Regulation No. 2016/679/EU of 27 April 2016 (applicable since 25 May 2018) - as a registered user you have the following rights:

    • Exercise your right of access, to know the personal data concerning you;
    • Update your data, if it is inaccurate;
    • Request portability or erasure of your data;
    • Request the deletion of your account;
    • Request the limitation of the processing of your data;
    • Oppose, for legitimate reasons, the processing of your data;
    • Withdraw your consent to the processing of your data.

    To exercise these rights, please contact our Data Protection Officer.

    Revised: March 2020

    Citing

    Citing IMGT®, the international ImMunoGeneTics information system®

    • Gaoussou Sanou, Guilhem Zeitoun, Taciana Manso, Milad Eidi, François Grand, Anjana Kushwaha, Myriam Croze, Chahrazed Debbagh, Axel Vaillant, Maria Georga, Ariadni Papadaki, Ifigeneia Sideri, Shamsa Batool, Turkan Samadova, Joumana Jabado-Michaloud, Géraldine Folch, Véronique Giudicelli, Patrice Duroux, and Sofia Kossida.
      IMGT® at scale: FAIR, Dynamic and Automated Tools for Immune Locus Analysis
      Nucleic Acids Research, 2025;, gkaf1024. DOI:10.1093/nar/gkaf1024. PMID:41091930. PMC:Free PMC article. LIGM:517.
    • Manso T, Folch G, Giudicelli V, Jabado-Michaloud J, Kushwaha A, Nguefack Ngoune V, Georga M, Papadaki A, Debbagh C, Pégorier P, Bertignac M, Hadi-Saljoqi S, Chentli I, Cherouali K, Aouinti S, El Hamwi A, Albani A, Elazami Elhassani M, Viart B, Goret A, Tran A, Sanou G, Rollin M, Duroux P, Kossida S.
      IMGT® databases, related tools and web resources through three main axes of research and development.
      Nucleic Acids Res. 2022 Jan 7;50(D1):D1262-D1272. DOI:10.1093/nar/gkab1136. PMID:34875068. PMC:Free PMC article. LIGM:508.
    • Lefranc M-P, Giudicelli V, Duroux P, Jabado-Michaloud J, Folch G, Aouinti S, Carillon E, Duvergey H, Houles A, Paysan-Lafosse T, Hadi-Saljoqi S, Sasorith S, Lefranc G, Kossida S.
      IMGT®, the international ImMunoGeneTics information system® 25 years on.
      Nucleic Acids Res. 2015 Jan;43(Database issue):D413-D422. Epub 2014 Nov 5. DOI:10.1093/nar/gku1056. PMID:25378316. Free article. LIGM:441.
    • Lefranc, M.-P.,
      Immunoglobulin (IG) and T cell receptor genes (TR): IMGT® and the birth and rise of immunoinformatics.
      Front Immunol. 2014 Feb 05;5:22. DOI:10.3389/fimmu.2014.00022. Open access. PMID:24600447. LIGM:429.

    Citing IMGT databases and tools (general)

    • Lefranc, M.-P.,
      IMGT, the International ImMunoGeneTics Information System
      Cold Spring Harb Protoc. 2011 Jun 1;2011(6). pii: pdb.top115. DOI:10.1101/pdb.top115. PMID:21632786. LIGM:382. IMGT booklet pdficon (high resolution) pdficon (low resolution) (with generous provision from Cold Spring Harbor (CSH) Protocols).
    • Lefranc, M.-P., Giudicelli, V., Ginestoux, C., Jabado-Michaloud, J., Folch, G., Bellahcene, F., Wu, Y., Gemrot, E., Brochet, X., Lane, J., Regnier, L., Ehrenmann, F., Lefranc, G. and Duroux, P.
      IMGT®, the international ImMunoGeneTics information system®
      Nucl. Acids Res., 37:D1006-D1012 (2009). DOI:10.1093/nar/gkn838. PMID:18978023. pdf LIGM:349.
    • Lefranc, M.-P.
      IMGT®, the international ImMunoGeneTics information system® for immunoinformatics. Methods for querying IMGT® databases, tools and Web resources in the context of immunoinformatics.
      Mol. Biotechnol., 40:101-111 (2008). Epub 2008 May 8. PMID:18463990
    • Lefranc, M.-P., Giudicelli, V., Kaas, Q., Duprat, E., Jabado-Michaloud, J., Scaviner, D., Ginestoux, C., Clé,ment, O., Chaume, D., Lefranc, G.
      IMGT, the international ImMunoGeneTics information system®
      Nucleic Acids Res., 33, D593-597 (2005). DOI:10.1093/nar/gki065. PMID:15608269. Full text. pdf
    • Lefranc, M.-P., Clément, O., Kaas, Q., Duprat, E., Chastellan, P., Coelho, I., Combres, K., Ginestoux, C., Giudicelli, V., Chaume, D. and Lefranc, G.
      IMGT-Choreography for Immunogenetics and Immunoinformatics
      In Silico Biology, 5, 45-60 (2005). Epub 2005, 5, 0006, 24 Dec 2004. PMID:15972004 pdf
    • Lefranc, M.-P., Giudicelli, V., Ginestoux, C., Bosc, N., Folch, G., Guiraudou, D., Jabado-Michaloud, J., Magris, S., Scaviner, D., Thouvenin, V., Combres, K., Girod, D., Jeanjean, S., Protat, C., Yousfi Monod, M., Duprat, E., Kaas, Q., Pommié, C., Chaume, D. and Lefranc, G.
      IMGT-ONTOLOGY for Immunogenetics and Immunoinformatics.
      In Silico Biol. 4, 0004. Epub http://www.bioinfo.de/isb/2003/04/0004, November 2003. In Silico Biology, 4:17-29 (2004). PMID:15089751.
    • Lefranc, M.-P.
      IMGT-ONTOLOGY and IMGT databases, tools and web resources for immunogenetics and immunoinformatics
      Molecul. Immunol., 40:647-659 (2004). PMID:14644091.
    • Lefranc, M.-P.
      IMGT® databases, web resources and tools for immunoglobulin and T cell receptor sequence analysis, http://www.imgt.org
      Leukemia, 17:260-266 (2003). PMID:12529691.
    • Lefranc, M.-P.
      IMGT, the international ImMunoGeneTics database®
      Nucleic Acids Res., 31, D307-310 (2003). DOI:10.1093/nar/gkg085. PMID:12520009. pdf
    • Lefranc, M.-P.
      IMGT, the international ImMunoGeneTics database
      Nucleic Acids Res., 29, D207-209 (2001). DOI:10.1093/nar/29.1.207. PMID:11125093. pdf
    • Ruiz, M., Giudicelli, V., Ginestoux, C., Stoehr, P., Robinson, J., Bodmer, J., Marsh, S., Bontrop, R., Lemaitre, M., Lefranc, G., Chaume, D. and Lefranc, M.-P.
      IMGT, the international ImMunoGeneTics database
      Nucleic Acids Res., 28, D219-221 (2000). DOI:10.1093/nar/28.1.219. PMID:10592230. pdf
    • Lefranc, M.-P., Giudicelli, V., Ginestoux, C., Bodmer, J., Müller, W., Bontrop, R., Lemaitre, M., Malik, A., Barbié, V. and Chaume, D.
      IMGT, the international ImMunoGeneTics database
      Nucleic Acids Res., 27, D209-212 (1999). DOI:10.1093/nar/27.1.209. PMID:9847182. pdf

    Citing IMGT overviews

    Citing IMGT overview on immunoglobulin (IG) genes

    Citing IMGT overview on T cell receptor (TR) genes

    Citing IMGT overviews on IG and TR genes per locus

    Citing IMGT-ONTOLOGY

    • Giudicelli, V. and Lefranc, M.-P.
      IMGT-ONTOLOGY 2012
      Frontiers in Bioinformatics and Computational Biology Online access. Front. Genet. 2012; 3:79. Epub 2012 May 23. PMID:22654892.
    • Duroux, P., Kaas, Q., Brochet, X., Lane, J., Ginestoux, C., Lefranc, M.-P. and Giudicelli, V
      IMGT-Kaleidoscope, the Formal IMGT-ONTOLOGY paradigm
      Biochimie, 90:570-583 (2008). Epub 2007 Sep11. PMID:17949886.
    • Lefranc, M.-P.
      IMGT-ONTOLOGY and IMGT databases, tools and web resources for immunogenetics and immunoinformatics
      Mol. Immunol., 40:647-660 (2004). PMID:14644091. pdf
    • Giudicelli, V. and Lefranc, M.-P.
      Ontology for Immunogenetics: IMGT-ONTOLOGY
      Bioinformatics, 15:1047-1054 (1999). PMID:10745995.
    • Lefranc, M.-P.
      From IMGT-ONTOLOGY CLASSIFICATION Axiom to IMGT Standardized Gene and Allele Nomenclature: For Immunoglobulins (IG) and T Cell Receptors (TR)
      Cold Spring Harb Protoc. 2011 Jun 1;2011(6). pii: pdb.ip84. DOI:10.1101/pdb.ip84. PMID:21632790.
      IMGT booklet pdficon (high resolution) pdficon (low resolution) (with generous provision from Cold Spring Harbor (CSH) Protocols).
    • Lefranc, M.-P.
      From IMGT-ONTOLOGY DESCRIPTION Axiom to IMGT Standardized Labels: For Immunoglobulin (IG) and T Cell Receptor (TR) Sequences and Structures
      Cold Spring Harb Protoc. 2011 Jun 1;2011(6). pii: pdb.ip83. DOI:10.1101/pdb.ip83. PMID:21632791.
      IMGT booklet pdficon (high resolution) pdficon (low resolution) (with generous provision from Cold Spring Harbor (CSH) Protocols).
    • Lefranc, M.-P.
      From IMGT-ONTOLOGY IDENTIFICATION Axiom to IMGT Standardized Keywords: For Immunoglobulins (IG), T Cell Receptors (TR), and Conventional Genes
      Cold Spring Harb Protoc. 2011 Jun 1;2011(6). pii: pdb.ip82. DOI:10.1101/pdb.ip82. PMID:21632792
      IMGT booklet pdficon (high resolution) pdficon (low resolution) (with generous provision from Cold Spring Harbor (CSH) Protocols).

    Citing IMGT Scientific chart

    Citing the IMGT unique numbering (princeps papers)

    • Lefranc, M.-P.
      Unique database numbering system for immunogenetic analysis.
      Immunology Today, 18:509 (1997). DOI:10.1016/s0167-5699(97)01163-8. PMID:9386342
    • Lefranc, M.-P.
      The IMGT unique numbering for Immunoglobulins, T cell receptors and Ig-like domains.
      The Immunologist, 7:132-136 (1999).
    • Lefranc, M.-P. IMGT Unique Numbering for the Variable (V), Constant (C), and Groove (G) Domains of IG, TR, MH, IgSF, and MhSF.
      Cold Spring Harb Protoc. 2011 Jun 1;2011(6). pii: pdb.ip85. DOI:10.1101/pdb.ip85. PMID:21632789
      IMGT booklet pdficon (high resolution) pdficon (low resolution) (with generous provision from Cold Spring Harbor (CSH) Protocols).
    • Lefranc, M.-P.
      IMGT Collier de Perles for the Variable (V), Constant (C), and Groove (G) Domains of IG, TR, MH, IgSF, and MhSF.
      Cold Spring Harb Protoc. 2011 Jun 1;2011(6). pii: pdb.ip86. DOI:10.1101/pdb.ip86. PMID:21632788.
      IMGT booklet pdficon (high resolution) pdficon (low resolution) (with generous provision from Cold Spring Harbor (CSH) Protocols).

    Citing the IMGT unique numbering for V-DOMAIN and V-LIKE-DOMAIN

    • Lefranc, M.-P., Pommié, C., Ruiz, M., Giudicelli, V., Foulquier, E., Truong, L., Thouvenin-Contet, V. and Lefranc, G.
      IMGT unique numbering for immunoglobulin and T cell receptor variable domains and Ig superfamily V-like domains
      Dev. Comp. Immunol., 27(1):55-77 (2003). DOI:10.1016/s0145-305x(02)00039-3. PMID:12477501. pdf.

    Citing the IMGT unique numbering for C-DOMAIN and C-LIKE-DOMAIN

    • Lefranc M.-P., Pommié C., Kaas Q., Duprat E., Bosc N., Guiraudou D., Jean C., Ruiz M., Da Piedade I., Rouard M., Foulquier E., Thouvenin V. and Lefranc G.
      IMGT unique numbering for immunoglobulin and T cell receptor constant domains and Ig superfamily C-like domains
      Dev. Comp. Immunol., 29(3):185-203 (2005). DOI:10.1016/j.dci.2004.07.003. PMID:15572068. pdf.

    Citing the IMGT unique numbering for G-DOMAIN and G-LIKE-DOMAIN

    • Lefranc M.-P., Duprat E., Kaas Q., Tranne M., Thiriot A. and Lefranc G.
      IMGT unique numbering for MHC groove G-DOMAIN and MHC superfamily (MhcSF) G-LIKE-DOMAIN
      Dev. Comp. Immunol., 29(11):917-938 (2005). DOI:10.1016/j.dci.2005.03.003. PMID:15936075. pdf.

    Citing IMGT reference profiles for amino acid properties

    • Pommié, C., Levadoux, S., Sabatier, R., Lefranc, G. and Lefranc, M.-P.
      IMGT standardized criteria for statistical analysis of immunoglobulin V-REGION amino acid properties.
      Journal of Molecular Recognition, 17(1):17-32 (2004). DOI:10.1002/jmr.647. PMID:14872534.

    Citing standardization of T cell receptor/peptide/MHC contact sites

    • Kaas, Q., Duprat, E., Tourneur, G. and Lefranc, M.-P.
      IMGT standardization for molecular characterization of the T cell receptor/peptide/MHC complexes
      In: Immunoinformatics (Schoenbach C., Ranganathan S. and Brusic V. eds.), Immunomics Reviews, Series of Springer Science and Business Media LLC, Springer, New York, USA chap. 2, pp.19-49 (2008).
    • Kaas Q. and Lefranc M.-P.
      T cell receptor/peptide/MHC molecular characterization and standardized pMHC contact sites in IMGT/3Dstructure-DB.
      In Silico Biology, 5(5-6):505-528 (2005), 20 October 2005. PMID:16268793. Abstract.

    Citing WHO/IUIS Nomenclature Subcommittee reports

    • Lefranc, M.-P.
      WHO-IUIS Nomenclature Subcommittee for immunoglobulins and T cell receptors report: August 2007, 13th International Congress of Immunology, Rio de Janeiro, Brazil.
      Dev. Comp. Immunol., 32:461-463 (2008). Epub 2007 Nov6. DOI:10.1016/j.dci.2007.09.008. PMID:18036660. pdf with permission from Elsevier
    • Lefranc, M.-P.
      WHO-IUIS Nomenclature Subcommittee for Immunoglobulins and T cell receptors report.
      Immunogenetics, 59:899-902 (2007). Epub 2007 Nov29. DOI:10.1007/s00251-007-0260-4. PMID:18046549.

    Citing IMGT databases

    Citing IMGT/LIGM-DB

    • Giudicelli, V., Duroux, P., Ginestoux, C., Folch, G., Jabado-Michaloud, J., Chaume, D. and Lefranc, M.-P.
      IMGT/LIGM-DB, the IMGT® comprehensive database of immunoglobulin and T cell receptor nucleotide sequences.
      Nucl. Acids Res., 34(S1):D781-D784 (2006). DOI:10.1093/nar/gkj088. PMID:16381979. pdf.

    Citing IMGT/GENE-DB

    • Giudicelli V., Chaume D. and Lefranc M.-P.
      IMGT/GENE-DB: a comprehensive database for human and mouse immunoglobulin and T cell receptor genes
      Nucl. Acids Res., 33(S1):D256-D261 (2005). DOI:10.1093/nar/gki010. PMID:15608191. pdf.

    Citing IMGT/3Dstructure-DB

    • Kaas, Q., Ruiz, M. and Lefranc, M.-P.
      IMGT/3Dstructure-DB and IMGT/StructuralQuery, a database and a tool for immunoglobulin, T cell receptor and MHC structural data
      Nucl. Acids Res., 32(S1):D208-D210 (2004). DOI:10.1093/nar/gkh042. PMID:14681396.
    • Ehrenmann, F., Kaas, Q. and Lefranc, M.-P.
      IMGT/3Dstructure-DB and IMGT/DomainGapAlign: a database and a tool for immunoglobulins or antibodies, T cell receptors, MHC, IgSF and MhcSF.
      Nucl. Acids Res., 38(S1):D301-D307 (2010). Epub 2009 Nov 9; DOI:10.1093/nar/gkp946. PMID:19900967. pdf LIGM:361
    • Ehrenmann, F., Lefranc, M.-P.
      IMGT/3Dstructure-DB: Querying the IMGT Database for 3D Structures in Immunology and Immunoinformatics (IG or Antibodies, TR, MH, RPI, and FPIA)
      Cold Spring Harb Protoc., 2011(6):750-761 (2011). DOI:10.1101/pdb.prot5637. PMID:21632774.
      IMGT booklet pdficon (high resolution) pdficon (low resolution) (with generous provision from Cold Spring Harbor (CSH) Protocols).

    Citing IMGT tools

    Citing IMGT/V-QUEST

    • Brochet, X., Lefranc, M.-P. and Giudicelli, V.
      IMGT/V-QUEST: the highly customized and integrated system for IG and TR standardized V-J and V-D-J sequence analysis.
      Nucl. Acids Res., 36(S2):W503-W508 (2008). DOI:10.1093/nar/gkn316. PMID:18503082.
    • Giudicelli, V., Brochet, X., Lefranc, M.-P.
      IMGT/V-QUEST: IMGT Standardized Analysis of the Immunoglobulin (IG) and T Cell Receptor (TR) Nucleotide Sequences.
      Cold Spring Harb Protoc. 2011 Jun 1;2011(6). pii: pdb.prot5633. DOI:10.1101/pdb.prot5633. PMID:21632778.
      IMGT booklet pdficon (high resolution) pdficon (low resolution) (with generous provision from Cold Spring Harbor (CSH) Protocols).
    • Giudicelli V., Duroux P., Rollin M., Aouinti S., Folch G., Jabado-Michaloud J., Lefranc M.-P., Kossida S.
      IMGT® Immunoinformatics Tools for Standardized V-DOMAIN Analysis.
      Methods Mol Biol. 2453:477-531 (2022). DOI:10.1007. PMID:35622340.

    Citing IMGT/HighV-QUEST

    • Alamyar, E., Giudicelli, V., Shuo, L., Duroux, P. and Lefranc, M.-P.
      IMGT/HighV-QUEST: the IMGT® web portal for immunoglobulin (IG) or antibody and T cell receptor (TR) analysis from NGS high throughput and deep sequencing.
      Immunome Res. 2012, April 20;8:1:2. PMID:22647994. pdf LIGM:400
    • Alamyar, E., Duroux, P., Lefranc, M.-P. and Giudicelli, V.
      IMGT tools for the nucleotide analysis of immunoglobulin (IG) and T cell receptor (TR) V-(D)-J repertoires, polymorphisms, and IG mutations: IMGT/V-QUEST and IMGT HighV-QUEST for NGS.
      In: B. Tait and F. Christiansen (Eds.), Immunogenetics, chap 32, Humana Press, Springer, New York, USA. Methods Mol. Biol., 882:569-604 (2012). DOI:10.1007/978-1-61779-842-9_32. PMID:22665256. LIGM:404.
    • Giudicelli V., Duroux P., Rollin M., Aouinti S., Folch G., Jabado-Michaloud J., Lefranc M.-P., Kossida S.
      IMGT® Immunoinformatics Tools for Standardized V-DOMAIN Analysis.
      Methods Mol Biol. 2453:477-531 (2022). DOI:10.1007. PMID:35622340.

    Citing IMGT/JunctionAnalysis

    • Yousfi Monod M., Giudicelli V., Chaume D. and Lefranc M.-P.
      IMGT/JunctionAnalysis : the first tool for the analysis of the immunoglobulin and T cell receptor complex V-J and V-D-J JUNCTIONs.
      Bioinformatics, 20:I379-I385 (2004). DOI:10.1093/bioinformatics/bth945. PMID:15262823.
    • Giudicelli, V., Lefranc, M.-P.
      IMGT/JunctionAnalysis: IMGT Standardized Analysis of the V-J and V-D-J Junctions of the Rearranged Immunoglobulins (IG) and T Cell Receptors (TR).
      Cold Spring Harb Protoc. 2011 Jun 1;2011(6). pii: pdb.prot5634. DOI:10.1101/pdb.prot5634. PMID:21632777.
      IMGT booklet pdficon (high resolution) pdficon (low resolution) (with generous provision from Cold Spring Harbor (CSH) Protocols).
    • Giudicelli V., Duroux P., Rollin M., Aouinti S., Folch G., Jabado-Michaloud J., Lefranc M.-P., Kossida S.
      IMGT® Immunoinformatics Tools for Standardized V-DOMAIN Analysis.
      Methods Mol Biol. 2453:477-531 (2022). DOI:10.1007. PMID:35622340.

    Citing IMGT/PhyloGene

    • Elemento, O. and Lefranc, M.-P.
      IMGT/PhyloGene: an online software package for phylogenetic analysis of immunoglobulin and T cell receptor genes.
      Dev. Comp. Immunol., 27:763-779 (2003). DOI:10.1016/s0145-305x(03)00078-8. PMID:12818634.

    Citing IMGT/GeneInfo

    • Baum, T.P., Hierle, V., Pascal, N., Bellahcene, F., Chaume, D., Lefranc, M.-P., Jouvin-Marche, E., Marche, P.N. and Demongeot, J.
      IMGT/GeneInfo: T cell receptor gamma TRG and delta TRD genes in database give access to all TR potential V(D)J recombinations.
      BMC Bioinformatics, 7, 224 (2006). DOI:10.1186/1471-2105-7-224. PMID:16640788. pdf

    Citing IMGT/StructuralQuery

    • Kaas, Q., Ruiz, M. and Lefranc, M.-P.
      IMGT/3Dstructure-DB and IMGT/StructuralQuery, a database and a tool for immunoglobulin, T cell receptor and MHC structural data
      Nucl. Acids Res., 32(S1):D208-D210 (2004). DOI:10.1093/nar/gkh042. PMID:14681396.

    Citing IMGT/Colliers-de-Perles

    • Ehrenmann, F., Giudicelli., V, Duroux, P., Lefranc, M.-P.
      IMGT/Collier de Perles: IMGT Standardized Representation of Domains (IG, TR, and IgSF Variable and Constant Domains, MH and MhSF Groove Domains)
      Cold Spring Harb Protoc., 2011(6):726-736 (2011). DOI:10.1101/pdb.prot5635. PMID:21632776.
      IMGT booklet pdficon (high resolution) pdficon (low resolution) (with generous provision from Cold Spring Harbor (CSH) Protocols).
    • Giudicelli V., Duroux P., Rollin M., Aouinti S., Folch G., Jabado-Michaloud J., Lefranc M.-P., Kossida S.
      IMGT® Immunoinformatics Tools for Standardized V-DOMAIN Analysis.
      Methods Mol Biol. 2453:477-531 (2022). DOI:10.1007. PMID:35622340.

    Citing IMGT/DomainGapAlign

    • Ehrenmann, F., Lefranc, M.-P.
      IMGT/DomainGapAlign: IMGT Standardized Analysis of Amino Acid Sequences of Variable, Constant, and Groove Domains (IG, TR, MH, IgSF, MhSF)
      Cold Spring Harb Protoc., 2011(6):737-749 (2011). DOI:10.1101/pdb.prot5636. PMID:21632775.
      IMGT booklet pdficon (high resolution) pdficon (low resolution) (with generous provision from Cold Spring Harbor (CSH) Protocols).
    • Giudicelli V., Duroux P., Rollin M., Aouinti S., Folch G., Jabado-Michaloud J., Lefranc M.-P., Kossida S.
      IMGT® Immunoinformatics Tools for Standardized V-DOMAIN Analysis.
      Methods Mol Biol. 2453:477-531 (2022). DOI:10.1007. PMID:35622340.

    Citing IMGT/RobustpMHC

    • Kushwaha A., Duroux P., Giudicelli V., Todorov K., Kossida S.
      IMGT/RobustpMHC: robust training for class-I MHC peptide binding prediction
      Briefings in Bioinformatics, Volume 25, Issue 6, (2024). DOI:10.1093. PMID:39504482.

    Citing IMGT/mAb-KG

    • Sanou G., Manso T., Todorov K., Giudicelli V., Duroux P., Kossida S.
      IMGT/mAb-KG: the Knowledge Graph for Therapeutic Monoclonal Antibodies.
      Frontiers in Immunology, 15, pp.1393839, (2024). DOI:10.3389. PMID:38975336.

    Citing IMGT Repertoire

    Citing IMGT Repertoire

    • Lefranc, M.-P.
      IMGT®, the international ImMunoGeneTics database.
      Nucl. Acids Res., 29(1):207-209 (2001). DOI:10.1093/nar/29.1.207. PMID:11125093.

    Citing IMGT Protein displays

    • Scaviner, D., Barbié, V., Ruiz, M. and Lefranc, M.-P.
      Protein displays of the human immunoglobulin heavy, kappa and lambda variable and joining regions.
      Exp. Clin. Immunogenet., 16:234-240 (1999). DOI:10.1159/000019115. PMID:10575277.

    Citing IMGT Colliers de Perles

    • Ruiz, M. and Lefranc, M.-P.
      IMGT gene identification and Colliers de Perles of human immunoglobulins with known 3D structures.
      Immunogenetics, 53:857-883 (2002). DOI:10.1007/s00251-001-0408-6. PMID:11862387.
    • Kaas, Q. and Lefranc, M.-P.
      IMGT Colliers de Perles: standardized sequence-structure representations of the IgSF and MhcSF superfamily domains.
      Current Bioinformatics, 2:21-30 (2007). DOI:10.2174/157489307779314302. pdf
    • Kaas, Q., Ehrenmann, F. and Lefranc, M.-P. IG, TR and IgSF, MHC and MhcSF: what do we learn from the IMGT Colliers de Perles? Brief. Funct. Genomic Proteomic, 6(4):253-264 (2007). DOI:10.1093/bfgp/elm032. PMID:18208865. pdf

    Citing IMGT Repertoire individual page

    • Author name(s) followed by editor name(s) if present.
      Title of the IMGT Repertoire page, IMGT Repertoire. IMGT®, the international ImMunoGenetics information system® http://www.imgt.org. Created: DD/MM/YYYY. Version (corresponds to Last updated): DD/MM/YYYY.

    Examples:

    • Martinez-Jean C. and Bosc N.
      Gene tables: Human IGHC, IMGT Repertoire. IMGT®, the international ImMunoGenetics information system® http://www.imgt.org.
      Created: 08/01/1999. Version: 19/06/2003.
    • Lefranc G., Lefranc M.-P and Jeanjean S.
      Allotypes: Human IGKC, IMGT Repertoire. IMGT®, the international ImMunoGenetics information system® http://www.imgt.org.
      Created: 13/05/2003. Version: 22/07/2004.

    When citing IMGT Repertoire, the Nuclear Acids Research reference in (1) should also be quoted.

    Citing IMGT-ML

    • Chaume, D., Giudicelli, V. and Lefranc, M.-P.
      IMGT-ML a XML language for IMGT-ONTOLOGY and IMGT/LIGM-DB data
      In: CORBA and XML: Towards a Bioinformatics Integrated Network Environment, Proceedings of NETTAB 2001 (Genoa, Italy, May 17-18, 2001). Network Tools and Applications in Biology, pp 71-75 (2001).
    • Chaume D., Giudicelli V., Combres K., Ginestoux C. and Lefranc M.-P.
      IMGT-Choreography: processing of complex immunogenetics knowledge.
      CMSB 2004 Computational Methods in Systems Biology (Paris, France, May 26-28, 2004). Lecture Notes in BioInformatics LNBI, Springer-Verlag GmbH Berlin Heidelberg, pp 73-84 (2005). DOI:10.1007/978-3-540-25974-9_7. ISBN:3-540-25375-0.

    Citing IMGT-Choreography

    Lefranc, M.-P., Clément, O., Kaas, Q., Duprat, E., Chastellan, P., Coelho, I., Combres, K., Ginestoux, C., Giudicelli, V., Chaume, D. and Lefranc, G.
    IMGT-Choreography for Immunogenetics and Immunoinformatics.
    In Silico Biology, 5(1):45-60 (2005). Epub 2005, 5, 0006, 24 Dec 2004 Abstract. PMID:15972004. pdf

    Frequently Asked Questions

    Why are immunoglobulin and T cell receptor genes described as "genes", instead of "gene segments" or "segments"?
    Immunoglobulin and T cell receptor genes were accepted as "genes" by the Human Organisation (HUGO) Nomenclature Committee (HGNC) in 1999. It was the only way to have the IG and TR genes entered into the general genome databases (LocusLink, GDB, GeneCards, Entrez Gene) and to define and characterize alleles in a standardized way. This has been accepted as different definitions of a gene coexist in biology. Moreover, each IG or TR gene has its own promotor and can be transcribed as an independent transcript.
    Why are abbreviations of IG and TR used, instead of Ig and TcR?
    The official nomenclature for the immunoglobulin and T cell receptor genes (approved by HGNC in 1999) starts with the 2 letters "IG" and "TR". IG and TR are therefore used when referring to the genes, loci and chains, whereas Ig and TcR are used for a more general description. The abbreviation TCR should be avoided as, being in capital letters, it creates a confusion with gene names.
    Why are immunoglobulin and T cell receptors in "subgroups", rather than in "families"?
    A subgroup is part of a group. Both a subgroup and a group are well defined entities, whereas a family is not.
    Why is there sometimes capitalization in midsentence?
    Capital letters, if in midsentence, indicate sections of the IMGT Repertoire (for example: Alignments of alleles, Tables of alleles, etc.).
    Is it judicious to use a L-PART1 oligonucleotide to amplify V-REGIONs?
    L-PART1 corresponds to the exon that encodes the first part (the longest one) of the leader. An oligonucleotide in L-PART1 will work well on cDNAs, for the amplification of V-REGIONs. On genomic DNAs, such an oligonucleotide will also amplify the intron between L-PART1 and L-PART2. See Variable region representation in gDNA and cDNA.
    Where can I find known human IG allotype sequences?
    For Gm allotype sequences, the IMGT/LIGM-DB accession numbers of the sequences that correspond to the Gm allotypes are indicated in "Gene tables: Human IGHC" in IMGT Repertoire The corresponding IGHG allele sequences in FASTA format (per exon) are available from IMGT/GENE-DB.
    For Km allotypes, the correspondence between Km alleles and IGKC allele names is available in "Allotypes: Human IGKC" in IMGT Repertoire. The corresponding IGKC allele sequences in FASTA format are available from IMGT/GENE-DB.
    What differences between allotypes and alleles?
    The definition of "allotypes" requires that antibody reagents are available to determine the allotypes serologically. If the determination is only done at the sequence level, the polymorphisms have to be described as "alleles". This does not hinder to establish a correspondence with allotypes if the correspondence allele-allotype has been experimentally proven, or if the individual sequence is identical to a sequence for which it has been demonstrated.
    Why are there differences in the V and J assignments of rearranged human IG and TR sequences, between IMGT/LIGM-DB and the generalist databases GenBank/EMBL/DDBJ, although the flat file accesssion numbers are identical?
    IMGT/LIGM-DB provides annotated flat files and uses the official nomenclature of the human immunoglobulin (IG) and T cell receptor (TR) genes, defined by IMGT and approved by the HUGO Nomenclature committee (HGNC) in 1999. The official nomenclature is used by GeneCards, LocusLink and Entrez Gene at NCBI: 28644. The IMGT/V-QUEST tool analyses rearranged IG or TR sequences, provides the correct gene and allele assignment of the closest Germline genes. Citing IMGT/V-QUEST: PMID:15215425.
    See Correspondence between nomenclatures and IMGT Index: Nomenclature for more information on nomenclatures.
    The reference books are the following:
    Lefranc, M.-P. and Lefranc, G., The Immunoglobulin FactsBook, Academic Press, 458 pages (2001) ISBN:012441351X
    Lefranc, M.-P. and Lefranc, G., The T cell receptor FactsBook, Academic Press, 398 pages (2001) ISBN:0124413528.
    Is it possible to observe sequences with additional amino acids in the CDR-IMGT?
    Yes, sequences may have additional amino acids in the CDR-IMGT. For example, the IGIV sequences of Oncorhynchus mykiss (IMGT Repertoire).
    Is it possible to selectively obtain, from IMGT/LIGM-DB, the sequences of antibodies that are known to bind to antibodies?
    You can query IMGT/LIGM-DB on "Specificities" (module: "Taxonomy,..."). For example: anti-idiotype, anti-IgG rhumatoid factor, anti-Fc...
    If several lines have in common a given specificity, you need to make a query for each line, individually . For example, for "anti-idiotype":
    anti-idiotype
    anti-idiotype (A48: levan-specific BALB/c myeloma protein ABPC48)
    anti-idiotype (Ab3) (anti-Neisseria meningitidis polysaccharide C)
    anti-idiotype (anti-sigma receptor)
    anti-idiotype (anti-tumor effect)
    anti-idiotype > cocaine
    anti-idiotype > cyclosporine (Cs)
    anti-idiotype HLA class II
    anti-idiotype [human]
    anti-idiotype, anti-cancer [human]
    anti-idiotype, anti-epidermal growth factor receptor
    Specificities available in IMGT/LIGM-DB are listed at here.
    Where, on the IMGT site, can we find information about the antibody diversity calculation?
    Click on the different links in "IG and TR number of genes: Human". The 3 first links lead to sections in the same page:
    Total number of IG and TR genes
    Number of functional IG and TR genes
    Number of genes in the IMGT genome analysis tools
    
    The other links lead to other pages:
    Potential germline repertoires
    Questions and answers (IMGT Education): Nomenclature and overview of the human immunoglobulin genes
    Questions and answers (IMGT Education): Nomenclature and overview of the human T cell receptor genes
    
    There is also some information in French at IMGT Education > Questions and Answers > Gènes et locus
    Is it possible to get restriction maps for the IG and TR loci?
    The restriction maps of the IG and TR loci are not stored on the IMGT site.
    One way to proceed is to go to IMGT/LocusView. This will allow to identify the clones that contain the genes you are looking for (if you are only interested by a given gene, you can query IMGT/GeneSearch instead of IMGT/LocusView). You can then retrieve the sequences containing the genes of interest (clicking on the clones - in blue - gives access to the entries in IMGT/LIGM-DB, and therefore to the sequences in FASTA format).
    You can then analyse the sequences with a tool such as RESTRICT (EMBOSS).
    Which gene to choose, in IMGT/V-QUEST results, when two genes give an identical score?
    A look on the IMGT/V-QUEST alignment is useful to check where the differences are between the input sequence and the two germline genes, and eventually to decide which gene to choose.
    For the human IGKV genes, if two germline genes, one from the proximal cluster and one from the distal cluster, give an identical score with the input sequence, it is preferable to select the gene of the proximal cluster (as genes of the distal cluster are rarely used).
    How to analyse comparison between IG V sequences from a species with human ones?
    You can compare:
    1. the IG V gene sequences from a species with the human ones using IMGT/V-QUEST.
    2. the IG V amino acid alignment with the human IGHV, IGKV and IGLV IMGT Protein display (germline sequences) to identify if unusual amino acids found in the analysed sequences are found in human V genes.
    3. the IG V gene sequences from a species with the human IG productively rearranged V sequences (Pommié C. et al 2004 PMID:14872534).
      • How many of the 19 conserved positions (chemical characteristics in Table 2C and Table 3A of Pommié et al 2004) between human IGHV and IGKV/IGLV are conserved in the analysed sequences?
      • How many of the 41 conserved positions between human IGKV and IGLV (chemical characteristics in Table 2C and Table 3B- yellow+pink+light green) are conserved in the analysed sequences?
      • Are the specific positions in human IGKV or IGLV conserved in the analysed sequences? For human IGKV, for instance, the four specific positions are 7: hydroxyl, 24: basic, 86: acidic, and 87: F (Pommié C. et al 2004 PMID:14872534).
    4. the IG V amino acid alignment with the human IGHV, IGKV and IGLV IMGT Protein display (germline sequences) to identify if unusual amino acids found in the analysed sequences are found in human V genes.
    How to determine the CDR3-IMGT length of a germline V gene?
    The length of the CDR3-IMGT, is expressed in number of amino acids or number of complete codons, following the 2nd-CYS at position 104.
    Between the end of the last complete codon in 3' and the V-HEPTAMER, there are frequently one or two nucleotides. This(ese) nucleotide(s) belong(s) to the V-REGION and are taken into account for a nucleotide comparison, but they are not considered in the CDR3-IMGT length.
    How to represent CDR-IMGT lengths?
    CRD-IMGT lengths should be represented as described in Lefranc et al 2003 PMID:12477501, that is as numbers separated by dots, between brackets.
    For example, [6.3.7] indicates that the CDR1-IMGT has a length of 6 amino acids, the CDR2-IMGT has a length of 3 amino acids and the CDR3-IMGT has a length of 7 amino acids. The same type of representation is used for germline and rearranged genes, and the information (subgroup or gene name, and configuration) should be provided with the CDR-IMGT lengths.
    What are the recommendations for correctly representing V-REGION IMGT Protein displays?
    Check the following items:
    • the IMGT numbering is correct (Lefranc et al 2003 PMID:12477501)
    • a space is added between the FR-IMGT and CDR-IMGT (between 26 and 27, between 38 and 39, between 55 and 56, between 65 and 66, between 104 and 105
    • dots are added in all unoccupied positions according to the IMGT unique numbering (for example 33 to 38, 59 to 65, 73, 81,82, 112 to 117 for human IGKV genes)
    • dashes are used for similarity (for the version in which only different amino acids are shown).
    • the figure header is completed with FR1-IMGT, CDR1-IMGT, ...as in the example: Protein display: Human IGK V-REGIONs
    Where can I find information about the antibody diversity calculation with clear figures and legends?
    You may click on the 6 different links in "IG and TR number of genes: Human". The 3 first links lead to sections in the same page:
    • Total number of IG and TR genes
    • Number of functional IG and TR genes
    • Number of genes in the IMGT genome analysis tools
    • The 3 other links lead to other pages:
      • Potential germline repertoires
      • Questions and answers (IMGT Education): Nomenclature and overview of the human immunoglobulin genes
      • Questions and answers (IMGT Education): Nomenclature and overview of the human T cell receptor genes
    There is also some information in French at IMGT Education > Questions and Answers > Gènes et locus (Correction)
    Is it possible to retrieve flanking sequence at the 5' and/or 3' ends of IMGT labels that describe IMGT/GENE-DB annotated sequences?
    Yes, flanking sequences at the 5' and/or 3' ends of the IMGT labels can be retrieved, in FASTA format, by querying the IMGT/GENE-DB entry section, "Choose your display > IMGT label extraction from IMGT/LIGM-DB reference sequences". For more information: IMGT label extraction from IMGT/LIGM-DB reference sequences.
    What are "P" nucleotides in a V-J or V-D-J junction?
    "P" nucleotides refer to nucleotides that are found in V-J or V-D-J junctions and that are palindromic to the last (3') nucleotides of the germline V-REGION, to the first (5') nucleotides of the germline J-REGION, or to the (5' or 3) ends of the germline D-REGION of immunoglobulin or T cell receptor genes. "P" nucleotides are only identified in junctions in which the V-REGION, D-REGION or J-REGION has not been submitted to the exonuclease activity (intact ends of the respective V, D, and J coding regions).
    Formation of "P" nucleotides:
    The "P" nucleotides result from the opening of the DNA hairpin formed during the V-(D)-J rearrangement, when this opening does not occur exactly at the tip of the hairpin ("P" nucleotides can only be identified if this hairpin opening is not followed by exonuclease activity on the sequence ends).
    Example:
    1. Cut at the end of the 3' V-REGION or at the 3' D-REGION (during the V-(D)-J rearrangement):
      5'  T - C - A - G
      3'  A - G - T - C
      
    2. Link between G and C forming an hairpin:
      5'  T - C - A - G
      3'  A - G - T - C
      }
    3. Opening of the hairpin. If the cut occurs for instance between A and G on the upper strand:
      5'  T - C
      3'  A- G - T - C - G - A
      
    4. The upper strand is completed. In the final sequence, C - T are designated as "P" nucleotides:
      5'  T - C - A - G - C - T
      3'  A - G - T - C - G - A
      
    Lafaille J.J. et al. Cell, 59: 859-870 (1989) PMID:2590942
    Lewis S.M. Proc Natl Acad Sci U S A., 91: 1332-1336 (1994) PMID:8108412
    How are the CDR lengths defined in IMGT?
    The CDR-IMGT length is based on the IMGT unique numbering for V-DOMAIN.
    1. This numbering has been defined following extensive alignment analysis and taking into account the structural data.
      The rules for the IMGT unique numbering are described in: Lefranc, M.-P. et al. "IMGT unique numbering for immunoglobulin and T cell receptor variable domains and Ig superfamily V-like domains". Dev. Comp. Immunol., 27, 55-77 (2003) PMID:12477501
    2. The same IMGT unique numbering for V-DOMAIN is used whatever the species, whatever the receptor (IG or TR), and whatever the chain (IGH heavy, IGK kappa or IGL lambda, IGI iota in teleostei; TRA alpha, TRB beta, TRG gamma, TRD delta). Moreover, the IMGT unique numbering for V-DOMAIN is used, by extension, for the V-LIKE-DOMAIN of the immunoglobulin superfamily IgSF proteins.
      IMGT unique numbering for all IG and TR V-REGIONs of all species: interest for structure and evolution
      IMGT unique numbering for V-DOMAIN and V-LIKE-DOMAIN
    3. In IMGT/3Dstructure-DB, for example, the CDR-IMGT lengths of 1hzh are, for the VH domain [8.8.20], and for the V-KAPPA domain [7.3.9].
      In the IMGT/3Dstructure-DB card, you can click and see the IMGT Colliers de Perles, on one or two layers. In the IMGT Collier de Perles on two layers, 3D structures experimentally determined hydrogen bonds are represented by green lines.
    4. Correspondence between the Kabat numbering and the IMGT unique numbering are available in PMID:12477501 and on the IMGT site. For example: Correspondence between V numberings
    5. Correspondence between the Chothia structures and the IMGT unique numbering are available on the IMGT site: FR-IMGT and CDR-IMGT lengths (V-REGION and V-DOMAIN)
    6. Practically we only use the IMGT unique numbering (and have been using it for more than 8 years) as it allows to deal remarkably well with the sequences and structures. Moreover we have strong evolutionary data evidence that it is correct!
    What are the differences between IgBlast and IMGT/V-QUEST?
    The algorithms behind IgBlast and IMGT/V-QUEST are different, and therefore the scores are different. However, the main differences are more on the biological side, and therefore on the interpretation that derives from it:
    1. IMGT/V-QUEST uses the standardized IMGT nomenclature (gene name), which has been approved by the Human Genome (HUGO) Nomenclature Committee (HGNC) in 1999, and entered in LocusLink at NCBI in 2000, and now in Entrez Gene at NCBI (with direct links to IMGT/GENE-DB).
    2. IMGT/V-QUEST uses the standardized amino acid (and codon) numberings, according to the IMGT unique numbering for V-DOMAIN.
    3. IMGT/V-QUEST uses the delimitations of the frameworks (FR-IMGT) and complementarity determining regions (CDR-IMGT), which are identical whatever the receptor type (IG and TR) whatever the chain type and whatever the species. This is quite important when determining the number of IG mutations in the different regions.
    4. At last, but not least, IMGT/V-QUEST provides the information by comparison to all the available alleles. This definition of the alleles represents a huge work but a very valuable one as it allows to take into account the germline diversity.
    Is the IMGT gene name valid for both genomic and cDNA sequences?
    Yes, the IMGT gene name (CLASSIFICATION concept of IMGT-ONTOLOGY) is valid for both genomic DNA and cDNA sequences. It is also valid for amino acid sequences, and protein 2D (IMGT Colliers de Perles) and 3D structures.
    Note that the names of the genes and subgroups depend on the species. For example, in human, TRAV5 is also the subgroup name (as there is only one gene in the subgroup). In contrast, in mouse, TRAV5 is only the subgroup name (as there are several genes in the subgroup).
    The lists of the genes per locus and per species are in Gene Tables (IMGT Repertoire for IG and TR).
    All the human and mouse IG and TR genes are known. The "Gene tables" lists are therefore comprehensive. All the human and mouse genes are also available in IMGT/GENE-DB. Known IMGT/LIGM-DB cDNA sequences for each gene is available in a section at the bottom of each IMGT/GENE-DB gene entry.
    When do we use "V-ALPHA" or "V-BETA"?
    V-ALPHA and V-BETA are domain labels, but these labels are also used for the corresponding nucleotide and amino acid sequences. Thus, V-ALPHA refers to the TRA V-J-REGION and V-BETA refers to the TRB V-D-J-REGION (nucleotide or amino acid sequence, protein 2D and 3D structure).
    V-ALPHA, V-BETA, V-J-REGION and V-D-J-REGION are written in capital letters as they are IMGT standardized labels (DESCRIPTION concept of IMGT-ONTOLOGY). Labels are independent on the species.
    The V-ALPHA and V-BETA amino acid sequences extend from the V-REGION amino acid 1 to the J-REGION most downstream amino acid. The V-ALPHA and V-BETA nucleotide sequences extend from the V-REGION codon 1 to the J-REGION most downstream nucleotide (that is the nucleotide downstream of the most 3' codon).
    A V-ALPHA or a V-BETA domain is characterized, as an IG V-DOMAIN, by its CDR-IMGT lengths (written between brackets separared by dots, for example [6.6.10]). Dev. Comp. Immunol., 27, 55-77 (2003) pdf available at https://www.imgt.org/IMGTScientificChart/Numbering/IMGTIGVLsuperfamily.html
    The V-ALPHA and V-BETA labels, as the IG V-DOMAIN labels, are important for the representation of the variable domain 3D structures in IMGT/3Dstructure-DB. For instance, in the entry 1ao7, it allows to represent the IMGT Collier de Perles of the V-ALPHA and V-BETA, according to the IMGT unique numbering for V-DOMAIN (NUMEROTATION concept of IMGT-ONTOLOGY).
    IMGT Colliers de Perles on one layer
    IMGT Colliers de Perles on two layers
    How the V-ALPHA and V-BETA of rearranged cDNA sequences, amino acid sequences, protein 2D and 3D structures should be referred to?
    The V-ALPHA and V-BETA of rearranged cDNA sequences, amino acid sequences, protein 2D (IMGT Collier de Perles) and 3D structures are referred to in an identical way, that is, species, gene names and CDR-IMGT lenghs.
    For instance, taking the example of 1ao7:
    • the V-ALPHA of the 3D structure but also of the corresponding rearranged cDNA sequence, amino acid sequence and protein 2D is referred to as Homo sapiens TRAV12-2-TRAJ24 [6.5.11].
    • the V-BETA of the 3D structure but also of the corresponding rearranged cDNA sequence, amino acid sequence and protein 2D is referred to as Homo sapiens TRBV6-5-TRBD2-TRBJ2-7 [5.6.14].
    PDF
    Homo sapiens, cDNA or amino acid, or protein: to identify.
    V-ALPHA, or V-BETA: to describe.
    TRAV12-2-TRAJ24, or TRBV6-5-TRBD2-TRBJ2-7: to classify.
    [6.5.11] or [5.6.14]: to number.
    Is it possible to study rearrangements of a pseudogene or unusual sequences (such as translocated IG with other genes)?
    Yes, it is possible to study rearrangements of pseudogenes or unusual sequences (such as translocated IG with other genes) for the species whose reference sequences are in IMGT/GENE-DB, that is human and mouse. On these sequences, IMGT/V-QUEST does not work, but you can use BLAST2 at CINES on IMGT/GENE-DB reference sequences.
    Compare your sequence against IMGT
    How to find the correspondence between a "previous" gene name and the current IMGT gene name?
    You have two ways to find the correspondences:
    1. either go the "Gene tables" in IMGT Repertoire
      For example, for a human IGHV gene, Gene table: human (Homo sapiens) IGHV in IMGT repertoire and "Find in This page" (Ctrl+F) the "previous" gene name (or its accession number, if known).
    2. or Google "IMGT domain", on the IMGT Home page, with the "previous" gene name (or its accession number, if known), which lead you to "Alignments of alleles"
      For example: Alignment of alleles: human (Homo sapiens) IGHV4-34
      This approach is valid for any old name of genomic genes which are in the IMGT Repertoire (comprehensive for human and mouse).
    What defines an allele?
    1. A single nucleotide difference in the coding region (sequence polymorphism) is sufficient to define a new allele. IMGT allele nomenclature for sequence polymorphisms.
    2. A different number of exons (polymophism by insertion/deletion) is also sufficient to define a new allele. For example, Homo sapiens IGHG3*11 and IGHG3*12 have identical genomic sequences for the coding regions they share, but they differ by the number of hinge exons. The IGHG3*11 allele has four hinge (H1, H2, H3, H4) exons, whereas the allele IGHG3*12 allele has three hinge exons (H1, H2, H4).
    3. Can new alleles be submitted from NGS?
      'Putative' alleles identified by NGS from V-(D)-J rearrangements cannot be accepted as new alleles.
      They should be confirmed.
      Authors are strongly encouraged to confirm the nucleotide differences by genomic sequencing of the corresponding germline gene in order to keep an updated IMGT reference directory for the scientific community.
    Is it possible to identify IMGT/LIGM-DB sequences associated to a PubMed abstract?
    Yes, it is possible, by 'LinkOut' at NCBI, to access IMGT/LIGM-DB sequences associated to a PubMed abstract.
    1. Following a query at NCBI (https://www.ncbi.nlm.nih.gov/) with an accession number (select Nucleotide), click on 'Links', then 'LinkOut', then 'The international ImMunoGeneTics database'.
    2. Following a query at NCBI with an author (select PubMed), click on 'Links', then on 'Nucleotide' (if present), you will obtain the list of GenBank accession numbers associated to the abstract. For each result, click on 'Links', then 'LinkOut', then 'The international ImMunoGeneTics database'.
    How to summarize the fact that the FR-IMGT and CDR-IMGT delimitations represent the standard for FR and CDR?
    The FR-IMGT and CDR-IMGT delimitations are based on the IMGT® standardization, and more particularly on the IMGT unique numbering.
    See also pdf of references 217, 268 and 287
    That standardization takes into account the structural data. The CDR-IMGT correspond to the loops of the variable domains. That standardization is used whatever the species, the receptor (immunoglobulin or T cell receptor), and the chain (heavy, kappa, lambda for the IG; alpha, beta, gamma, delta for the TR).
    IMGT Colliers de Perles are 2D graphical representations, based on the FR-IMGT and CDR-IMGT delimitations. IMGT Colliers de Perles of antibodies with known 3D structures are available in IMGT/3Dstructure-DB.
    Are the IMGT gene names the official ones?
    Yes, the IMGT® gene names are the official ones. IMGT® is the international reference in ImMunoGeneTics and has delegation from the HUGO Gene Nomenclature Commiteee HGNC for the IG and TR genes. All the IMGT® gene names for human have been approved by HGNC in 1999 and entered in GDB, and in Entrez Gene at NCBI, with links to IMGT/GENE-DB. The IMGT-NC works in close collaboration with HGNC and is under the aegis of the IUIS.
    How can I retrieve the V leader sequences from IMGT reference sequences?
    Step 1: Make your selection (species, group, functionality) in IMGT/GENE-DB (access from https://www.imgt.org). For a selection "Homo sapiens", "IGHV" and "functional", the results of your search will be, for example:
    Gene-DB result 1

    Step 2: Select all genes (click in box at the bottom of the list of resulting genes) and in the "Choose your display" "IMGT label extraction from IMGT/LIGM-DB reference sequences" section, click on "Choose label(s) for extraction" and select the IMGT label "L-PART1+L-PART2" (L-PART1 and L-PART2 being shown as artificially spliced in that query).
    Gene-DB result 2

    Results for "Nucleotide sequences" will be shown as follows:
    >M99641|IGHV1-18*01|Homo sapiens|F|L-PART1+L-PART2|47..92+177..187
    atggactggacctggagcatccttttcttggtggcagcaccaacaggtgcccactcc
    >X60503|IGHV1-18*02|Homo sapiens|F|L-PART1+L-PART2|1..46+131..141
    atggactggacctggagcatccttttcttggtggcagcagcaacaggtgcccactcc
    >X07448|IGHV1-2*01|Homo sapiens|F|L-PART1+L-PART2|126..171+258..268
    atggactggacctggaggatcctcttcttggtggcagcagccacaggagcccactcc
    >X62106|IGHV1-2*02|Homo sapiens|F|L-PART1+L-PART2|21..66+152..162
    atggactggacctggaggatcctcttcttggtggcagcagccacaggagcccactcc
    >X92208|IGHV1-2*03|Homo sapiens|F|L-PART1+L-PART2|18..63+149..159
    atggactggacctggaggatcctcttcttggtggcagcagccacaggagcccactcc
    ...
    
    Results for "Amino acid sequences" will be shown as follows:
    >M99641|IGHV1-18*01|Homo sapiens|F|L-PART1+L-PART2|47..92+177..187
    MDWTWSILFLVAAPTGAHS
    >X60503|IGHV1-18*02|Homo sapiens|F|L-PART1+L-PART2|1..46+131..141
    MDWTWSILFLVAAATGAHS
    >X07448|IGHV1-2*01|Homo sapiens|F|L-PART1+L-PART2|126..171+258..268
    MDWTWRILFLVAAATGAHS
    >X62106|IGHV1-2*02|Homo sapiens|F|L-PART1+L-PART2|21..66+152..162
    MDWTWRILFLVAAATGAHS
    >X92208|IGHV1-2*03|Homo sapiens|F|L-PART1+L-PART2|18..63+149..159
    MDWTWRILFLVAAATGAHS
    ...
    
    Does IMGT allow one to make multiple alignments and derive consensus sequences?
    IMGT has no specific mutiple alignment tools. The curators use BLAST and CLUSTAL. However the priority is always to maintain the gaps according to the IMGT unique numbering. If there is a conflict between the IMGT Protein displays and the BLAST/CLUSTAL results, the gaps are adjusted manually.
    How are the positions of gaps and insertions placed in IMGT Collier de Perles?
    CDR3-IMGT
    In IMGT Collier de Perles, the positions of gaps and insertions are always at the top of the CDR3-IMGT loop. The two CDR3-IMGT anchor positions are Cystein (C) (F strand) at position 104 of FR3-IMGT, and Phenylalanine (F) or Tryptophane (W) (G strand) at position 118 of FR4-IMGT (the F and G strands in 3D structures are antiparallel strands with conserved hydrogen bonds). See IMGT unique numbering for V-DOMAIN and V-LIKE-DOMAIN.
    This numbering has been validated by superposition of 3D structures of variable domains with different CDR3-IMGT lengths.
    CDR1-IMGT and CDR2-IMGT
    For structural data, as recommended in Lefranc M.-P. et al. 2003, PMID:12477501 pdf, gaps may be placed at the top of CDR1-IMGT and CDR2-IMGT loop (as it is done in IMGT/3Dstructure-DB). However, working on sequences it is usually easier to have the gaps at the end of CDR1-IMGT and CDR2-IMGT, as it is done in IMGT/V-QUEST. This allows an easier comparison of CDR-IMGT lengths according to subgroups and avoids to split small CDR in two parts (for example, the CDR2-IMGT of IGKV which have only three amino acids).
    Is it possible to search an amino acid sequence against the IMGT reference directory?
    You can search an amino acid sequence against the IMGT domain reference directory, using IMGT/DomainGapAlign. You will get the IMGT Collier de Perles of your domain by clicking on "IMGT Collier de Perles" at the bottom of the results page.
    For the IG and TR V-DOMAIN, IMGT/DomainGapAlign provides the aligment with the closest V-REGION and the displayed "IMGT Collier de Perles" corresponds to the V-REGION in your sequence. To obtain an IMGT Collier de Perles for the complete V-DOMAIN (V-D-J-REGION or V-J-REGION), you need:
    • to complete your sequence in the window with the CDR3 and the J (at least 9 or 10 amino acids beyond the F or W, respectively of the motif F/WGXG, to get the complete J)
    • to add gaps (if the CDR3-IMGT is <13 amino acids), or additional positions (if the CDR3-IMGT is >13 amino acids).
    See IMGT unique numbering for V-DOMAIN and V-LIKE-DOMAIN.
    For help on the J sequences, see Alignments of alleles for the IGHJ, IGKJ and IGLJ (in IMGT Repertoire)
    How to find IMGT unique numbering for a VH or VL protein domain?
    IMGT/DomainDisplay allows to query and to display available domains from the IMGT domain directory (domain amino acid sequences according to the IMGT unique numbering and in the format of IMGT Protein display).
    IMGT/DomainGapAlign allows to create gaps in your own amino acid sequence, according to the IMGT unique numbering, for V-REGION or C-DOMAIN, by aligning your sequence with the closest germline V-REGION or with the closest C-DOMAIN (from the IMGT domain directory).
    The tool provides the IMGT Collier de Perles of your V-REGION or C-DOMAIN by clicking on "IMGT Collier de Perles" at the bottom of the results page. You can also obtain an IMGT Collier de Perles for the complete IG and TR V-DOMAIN (V-D-J-REGION or V-J-REGION).
    How to obtain IMGT/LIGM-DB entries while querying PubMed?
    You can obtain IMGT/LIGM-DB entries for IG and TR sequences using LinkOut at NCBI:
    1. Query Pubmed as usual to get publication abstracts http://www.ncbi.nlm.nih.gov/sites/entrez?db=pubmed (type one accession number, e.g. X97469, or an author, etc..).
    2. On the right of the abstract, click on "Links" and select "Nucleotide". You will get a list of GenBank accession numbers (with their definition) if sequences are described and quoted in the paper.
    3. For each accession number, click on "Links" and select "LinkOut".
    In the next page click on "The international ImMunoGeneTics database" to obtain a direct link to the IMGT/LIGM-DB accession number.
    See also LinkOut at NCBI in IMGT Index.
    Is there information on the frequency and population use of particular V, D and J genes?
    There are no direct data on the frequency and population use of particular V, D or G genes, however there are some indicators on their expression, based on the number of sequences found in IMGT/LIGM-DB. This is illustrated by:
    1. the results of IMGT/GeneFrequency,
    2. the IMGT/GENE-DB tables of rearranged annotated cDNA and gDNA for each gene (at the bottom of each entry).
    Regarding the alleles, as all known germline sequences are displayed in Alignments of alleles (in IMGT Repertoire), the number of germline sequences for each allele is also an indicator of the possible frequency of the different alleles in the population.
    How is delimited the CDR3?
    The CDR3 is delimited by (but does not include) the anchor positions 2nd-CYS 104 and J-PHE or J-TRP 118. As for the CDR1 and CDR2 these anchor positions (that belong to the neighbouring FR) are shown as squares in the IMGT Collier de Perles.
    The JUNCTION includes 2nd-CYS 104 and J-PHE or J-TRP 118 and is therefore two amino acids longer than the CDR3.
    The CDR3 numbering goes from 105 to 117 and, if necessary, gaps or additional positions are added at the top of the loop https://www.imgt.org/IMGTScientificChart/Numbering/IMGTIGVLsuperfamily.html
    Note that:
    1. the J-PHE or J-TRP belongs to the characteristic J-REGION motif 'F/W-G-X-G' at positions 118-121
    2. the CDR3 is delimited by the same anchor positions (2nd-CYS 104 and J-PHE or J-TRP 118), whatever the receptor type (IG or TR), the chain type (heavy or light for IG; alpha, beta, gamma or delta for TR) or the species.
    How can one appropriately and clearly number amino acids in the constant region of immunoglobulins, for example the LL of IgG1 in position 4 and 5 of CH2 (...APELLGGP...)?
    The LL of IgG1 in position 4 and 5 of CH2 (...APELLGGP...) are at positions CH2 1.3 and 1.2 according to the IMGT unique numbering for C-DOMAIN. Lefranc, M.-P. et al., Dev. Comp. Immunol., 29, 185-203 (2005) (approved as standard by the WHO/IUIS committee and WHO/INN).
    IGHG1 Alignment of alleles
    In IMGT®, the numbering of the amino acids in the IG constant region is given per domain as it is the only way to compare sequences in a standardized way between different isotypes, and this numbering is independent on the variable domain length.
    Correspondence, per domain, with the IMGT unique numbering, can be obtained using the IMGT/DomainGapAlign tool.
    Correspondence between the IMGT unique numbering for C-DOMAINS, the IMGT exon numbering and the EU and Kabat numberings: Human IGHG
    How to find cDNA or rearranged gDNA using a given human or mouse V gene?
    You will find cDNA and rearranged gDNA using a given human or mouse gene by querying the IMGT/GENE-DB
    1. In the IMGT/GENE-DB Query page, use SHORT CUT: Select the 'Species' and type the 'IMGT gene name', then 'do the search'.
    2. In the resulting page, select the gene, then 'Do the search'.
    3. At the bottom of the IMGT/GENE-DB entry, you will find links to tables displaying lists of annotated IMGT/LIGM-DB cDNA and rearranged gDNA, using that gene.

    You can access the same tables starting from the IMGT/GENE-DB Query page:
    Click on 'IMGT/GENE-DB direct links for a given gene' (at the bottom of the Query page), and then in the resulting page select the appropriate format:

    Why "Protein displays" and "Colliers de Perles" of variable genes do not include the last strand G?
    The strand G is not shown in "Protein displays" and "Colliers de Perles" of variable germline genes as this strand is contributed by the J-REGION that is brought, following the V-J or V-D-J rearrangements.
    The alignments of the J genes (that contribute to the G strand) and those of the D genes (for IGH, TRB and TRD) (that contribute to the CDR3-IMGT are available in the IMGT Repertoire
    You have to be aware that, at the V-J and V-D-J junctions, there are trimming of the V, (D) and J, and addition at random of N nucleotides to create the diversity of the junctions (see The T cell receptor FactsBook).
    To see complete variable domains, you may have a look at the IMGT Colliers de Perles in IMGT/3Dstructure-DB. for example https://www.imgt.org/3Dstructure-DB/cgi/details.cgi?pdbcode=1AO7.
    How to retrieve the recombination signals (RS) from the IMGT databases?
    To retrieve recombination signals (RS), for instance the human V-RS, from the IMGT® databases:
    1. Query IMGT/GENE-DB
      Example: Species: 'Homo sapiens', Group: 'IGHV', Functionality: 'Functional'
      Do the search
    2. In the result page:
      Select all genes
      then at the bottom of the page in: IMGT label extraction from IMGT/LIGM-DB reference sequences
      Choose label(s) for extraction
      V-RS
    You can proceed in the same way for J-RS (Group: IGHD), 5'D-RS and 3'D-RS (Group: IGHD).
    You can also proceed in the same way for the other IG and TR loci.
    How to find the hinge sequences of IG heavy chains of many species easily?
    You can query IMGT/LIGM-DB by selecting in Taxonomy: Loci, genes or chains: 'Ig-heavy' then Do the search
    You will get 78786 results (in January 2010). On the same page click on 'Subsequences'. In next page click in the list of labels on 'H' and then on 'Get translated sequences (Fasta)'. You will get 228 sequences.
    For hinges encoded by several exons, you need to query individually each exon, that is you have to go back one page and now click in the list of labels on 'H1' and repeat the same operation and again for 'H2', 'H3' and 'H4'.
    How to retrieve IGHC hinge sequences?
    The IGHC hinge amino acid sequences are displayed at the bottom of the 'IMGT Protein display' IGHC individual pages per species, in IMGT Repertoire. For example for 'Human' https://www.imgt.org/IMGTrepertoire/Proteins/proteinDisplays.php?species=human&latin=Homo sapiens&group=IGHC
    The correspondence between nucleotide and amino acid sequences is displayed in 'IMGT Alignments of alleles', for individual genes and per species. For example, for the human IGHC genes, links are at the page: https://www.imgt.org/IMGTrepertoire/Proteins/alleles/list_alleles.php?species=Homo sapiens&group=IGHC
    You can retrieve nucleotide and amino acid hinge sequences from IGHC genes which are annotated in IMGT/GENE-DB, that is human, mouse, rat and rabbit, and also IGHD trout and Danio rerio:
    1. Query IMGT/GENE-DB
    2. Select :
      • Gene type: constant
      • Group: IGHC
    3. Do the search.
      In the resulting page, you will get a list of 52 genes. Select manually the IGHA, IGHD and IGHG genes of interest.
    4. Click on the radio button of 'Choose label for extraction'. Select H, H1, H2, H3, H4 (together).
    5. Click on the radio button of: 'Amino acid sequences' (see results below after selecting all IGHA, IGHD and IGHG).
      You can do the same kind of query for nucleotide sequences: Click on the radio button of: 'Nucleotide sequences'.
    Why is the delimitation of IGKJ2 given as 1094-1132 in V00777 from IMGT/LIGM DB, whereas it is 1096-1134 found from the literature source?
    From V00777 from IMGT/LIGM-DB:
    J-REGION [740..777]
    gtggacgttcggtggaggcaccaagctggaaatcaaac
    W  T  F  G  G  G  T  K  L  E  I  K
    
    J-REGION [1094..1132]
    tgtacacgttcggaggggggaccaagctggaaataaaac
    Y  T  F  G  G  G  T  K  L  E  I  K
    
    1. The definition of the IMGT label "J-REGION" includes the additional 1 or 2 nucleotides that can be found following the J-HEPTAMER. Indeed these nucleotides can be found in V-(D)-J junctions when the rearrangement occurs without trimming of the J region.
      IMGT label definition:
      J-REGION: coding region of J-GENE (plus 1 or 2 nucleotide(s) after J-HEPTAMER, if present) or corresponding region in cDNA
      
      In genomic sequences J-HEPTAMER and J-REGION are therefore be contiguous (numbers in green below).
    2. As these additional nucleotides are taken into account in IMGT, "codon_start" is added to indicate on which nucleotide (nt), in the IMGT coding label, should start the translation by automatic tools: codon_start=2 means that it is the 2nd nt (the "t" of tgg) for IGKJ1*01 codon_start=3 means that it is the 3rd nt ("t" of tac) for IGKJ2*01. These nucleotides are shown in bold in the sequences above.
      FT J-HEPTAMER 733..739
      FT J-REGION 740..777
      FT /note="functional"
      FT /allele="IGKJ1*01"
      FT /gene="IGKJ1"
      FT /codon_start=2
      FT /translation="WTFGGGTKLEIK"
      
      FT J-HEPTAMER 1087..1093
      FT J-REGION 1094..1132
      FT /note="functional"
      FT /allele="IGKJ2*01"
      FT /gene="IGKJ2"
      FT /codon_start=3
      FT /translation="YTFGGGTKLEIK"
      
    How to obtain from IMGT/GENE-DB complete amino acid sequences (artificially spliced) of a constant gene, or of a group of C genes?
    1. To get the complete amino acid sequence (artificially spliced) of a reference constant gene, the query is 13.2
      • https://www.imgt.org/genedb/GENElect?query=13.2+Genesymbol&species=Species
        with for Genesymbol, the gene name (for instance IGHG1), and for Species, the latin name of the species (for instance Homo+sapiens) https://www.imgt.org/genedb/GENElect?query=13.2+IGHG1&species=Homo+sapiens
    2. To get the artificially spliced nucleotide sequence of that gene, the query is 13.1
    3. To get the complete amino acid sequence (artificially spliced) of reference constant genes of a group, the query is 14.2
      • https://www.imgt.org/genedb/GENElect?query=14.2+Group&species=Species
        with for Group, the group name (for instance IGHC), and for Species, the latin name of the species (for instance Homo+sapiens) https://www.imgt.org/genedb/GENElect?query=14.2+IGHC&species=Homo+sapiens
    4. To get the artificially spliced nucleotide sequence of that group, the query is 14.1
    The information on the direct links are available at: https://www.imgt.org/genedb/share/textes/GENEDBDirectLinks.html
    You can access that page at the bottom of the IMGT/GENE-DB Query page.
    How can I get the sequences of the recombination signals?
    To get the recombination signals:
    1. query IMGT/GENE-DB
      • Example: Species: Homo sapiens, Group: IGHV, Functionality: Functional
      • Do the search.
    2. In the result page:
      • Select all genes
      • then at the bottom of the page in: 'IMGT label extraction from IMGT/LIGM-DB reference sequences'
      • 'Choose label(s) for extraction':
        • V-RS.
        • For J genes: the label is J-RS
        • For D genes: the labels are 5'D-RS and 3'V-RS.
    What does the letter 'S' mean in the temporary IMGT gene nomenclature, for example in IGHV1S1 or IGHJ1S1 ?
    The letter S means 'subgroup' for V genes and eventually C genes, and it means 'sequential' for J and D genes: IMGT gene name nomenclature for IG and TR of human and other vertebrates
    What are the functionalities of rearranged V-(D)-J genes compared to germline V, D or J genes?
    There are two possible functionalities for rearranged V-(D-)J genes, either productive or unproductive.
    In contrast, the germline V, D or J genes, and the C genes, have three possible functionalities (as the conventional genes): functional, ORF or pseudogene.
    A complete identification of rearranged V-(D-)J genes requires the identification of the two (or three) genes and alleles which are involved in the rearrangement.
    This can be determined using IMGT/V-QUEST. IMGT/V-QUEST provides the functionality of the rearranged V-(D)-J gene. It also provides the gene and allele names of the closest V, D (in the IMGT/JunctionAnalysis section) and J genes involved in the rearrangement and their germline functionality.
    How to deal with 'complement' sequences?
    We can take as an example AL122127. AL122127 in the nucleotide databases 'GEDI' (GenBank, ENA, DDBJ and IMGT/LIGM-DB) is a genomic sequence of 169,802 nucleotides (FASTA in IMGT/LIGM-DB AL122127).
    AL122127 contains several constant IGHC genes, including Homo sapiens IGHG1*05 and IGHG3*10, as shown in IMGT/LIGM-DB 'Annotation' (DESCRIPTION section) and the sequence is 'complement' with respect to the orientation of the IGHC genes.
    The IMGT labels positions are indicated for the 'complement' sequence (for example, complement(24528..169802) for the IGHG3 gene), however, for a more convivial display, the nucleotide sequence and the translation of each IMGT coding label are displayed in the gene direct orientation.
    In 'Alignments of alleles' why is the first nucleotide of the exons in 'pink' color?
    In 'Alignments of alleles', the first nucleotide in 5' of an exon is shown in pink when it comes from the preceding exon and contributes to the codon resulting from a splicing frame 1 (codon NNN from sf1) (see Splicing sites) to encode the first amino acid of the translated region.
    How to propose new IG or TR gene names to IMGT?
    To propose new IG or TR genes to IMGT, the genomic sequence should be publicly available (in generalist databases or in genome assembly).

    Information to be provided

    The information to be provided comprises, for each gene:
    1) the public accession number of the clone from which the sequence was extracted (or of the NCBI assembly positions and version), with the proposed gene name (provisional), positions start and end in that accession number,
    2) the corresponding sequence in FASTA format:
    - for V genes: from the beginning of the L-PART1 (atg) to the 3'end of the V-RS
    - for D genes: from the 5' end of the 5'D-RS to the 3' end of the 3'D-RS
    - for J genes: from the 5' end of the J-RS to the 3'end of the J-REGION
    - for C genes: from the 5' end of the first exon to the 3' end (stop codon) of the last exon.
    3) the proposed functionality (F, ORF, P), and comments (any comment which can be useful, for example, why a gene is considered 'ORF' or 'P')
    4) additionally, for V genes,
    - the CDR-IMGT lengths (the germline CDR3-IMGT includes, if present, the one or two nucleotides upstream of the V-HEPTAMER)
    - the closest human V-REGION gene and allele with score, percentage of identity and alignment length ratio, as provided by IMGT/V-QUEST.
    For pseudogenes, the above information obtained using the option 'Search for insertions and deletions in V-REGION', with summary of the out-of-frame defects (for example, '1 del (1), 2 ins (1,2)' for one deletion of 1 nucleotide (nt), 2 insertions of 1 nt and 2nt).

    IG and TR subgroup numbers

    The IG and TR subgroup numbers are assigned, whenever it is possible, by comparison to the Homo sapiens subgroups (V-REGION nucleotide sequence identity >75% for functional and ORF genes and, for information, CDR-IMGT lengths). This means that some Homo sapiens subgroup numbers may not be represented in some species or conversely that new numbers may be added for subgroups not represented in Homo sapiens.

    IG and TR gene numbers.

    More information

    Lefranc M-P. Immunoglobulin (IG) and T cell receptor genes (TR): IMGT® and the birth and rise of immunoinformatics. Front Immunol. 2014 Feb 05;5:22. doi: 10.3389/fimmu.2014.00022. Open access. PMID:24600447

    Does "partial in 3' " or "partial in 5' " make sequences non-functional or is it just that the gene region was not fully sequenced?
    "partial in 3' " or "partial in 5' " indicates that the gene region was not fully sequenced.
    There are a few sequences that are marked "F" but end in a stop codon. Are these functional?
    When there is a high probability that the stop codon will be trimmed and replaced by a N-region during the V-(D)-J rearrangement the gene is considered as functional.
    What does 'OR9' means in some Homo sapiens TRBV genes?
    'OR9' in the IMGT gene name indicates that this gene is an orphon 'OR', located on chromosome 9.
    An orphon is a gene identified in a chromosomal location outside the main loci and which therefore cannot participate to the in vivo IG or TR chain synthesis.
    https://www.imgt.org/IMGTindex/orphon.php
    https://www.imgt.org/IMGTScientificChart/Nomenclature/IMGTnomenclature.html
    In IMGT/V-QUEST, orphons are excluded from 'F+ORF+ in-frame P' (used, for instance, for repertoire analysis) but may be searched if relevant (for instance, for genomic analysis) using the options 'including orphons' in Advanced parameters.
    What happens if there is a stop codon in a leader sequence?
    A stop codon in the leader sequence makes a gene or an allele a pseudogene. This is the case of the Homo sapiens IGKV1-39*02 allele which is noted as 'P' (pseudogene) in Gene table Homo sapiens IGKV: https://www.imgt.org/IMGTrepertoire/index.php?section=LocusGenes&repertoire=genetable&species=human&group=IGKV Such an allele or gene may be transcribed (and therefore found in 5'RACE/NGS sequencing) but is not translated in vivo.
    How to retrieve nucleotide sequence of IG and/or TR genes without any introns?
    Nucleotide sequence of IG and/or TR genes without any introns can be retrieved from the 'artificially spliced sets' at the page: https://www.imgt.org/vquest/refseqh.html#VQUEST
    Are nucleotide sequence differences in the untranslated EX4 taken into account in the assignment of the TRAC and TRDC alleles?
    In the assignment of the TRAC and TRDC alleles [1], nucleotide sequence differences in the untranslated EX4 + 3'UTR (Figure 7 pages 34-35 [2]) (IMGT label EX4UTR), are not considered for the assignment of the TRAC and TRDC alleles.
    A given TRAC allele or TRDC allele (for example, Homo sapiens TRAC*01) from different sources may therefore display small differences in the EX4UTR.
    More information:
    [1] Lefranc M-P. Immunoglobulin (IG) and T cell receptor genes (TR): IMGT® and the birth and rise of immunoinformatics. Front Immunol. 2014 Feb 05;5:22. doi: 10.3389/fimmu.2014.00022. Open access. PMID: 24600447.
    [2] Lefranc, M.-P. and Lefranc, G., The T cell receptor FactsBook, Academic Press, 398 pages (2001) ISBN:0124413528.

    Affiliation

    Institutions

    Université montpellier MESRI

    Acknowledgments

    International

    IMIA UE ELIXIR Healthlinks
    genomicsAndHealth

    National

    MUSE
    CNRS MESRI Investissements Avenir IUF Ibisa
    ANR INSERM CEA IRD INRA

    Interregional

    Canceropole mabimprove

    Regional

    CNRS DR13
    CNRS Occitanie Est
    IGH Université montpellier
    BioCampus Montpellier PBSR LR

    Previous funding support

    Immunogrid 7 capacities FP6
    IMPBIO Montpellier Cancer GENOPOLE IFR3 LR

    Announcements

    News RSS

    The previous version is still available here.