IMGT/PRIMER-DB Primer accession number | IPP700000 |
IMGT/PRIMER-DB entry date | 03/11/2003 |
IMGT/PRIMER-DB update | 05/11/2003 |
IMGT/PRIMER-DB Primer definition | Homo sapiens IGKV2D-29*01 Sense primer Sense |
Primer alias name | AF76 |
Bibliographic references (PubMed) |
PMID: 8662073 |
Catalogue comments | IGKV2D-29 gene specific |
IMGT/PRIMER-DB Primer sequence | 23 pb; 6 A; 9 C; 5 G; 3 T; 0 other 5' ATGGCTCAGCCACACCACTGCA 3' |
IMGT/PRIMER-DB Sequence length (number of nucleotides) | 23 |
IMGT/PRIMER-DB Primer orientation | Sense |
IMGT/LIGM-DB reference sequence Accession number |
M31952 |
IMGT/LIGM-DB reference sequence Primer position (start-end) |
183-205 |
Primer Localization |
CCGACAAGAATTTGGAAGCCCTGACATCCTATAAAACGTTACTTGCCCAAGATTGAAACT 60 |
Characteristics comments | IGKV2D-29*01 Allele chosen as a representative of the IGKV2D-29 Gene |
IMGT/PRIMER-DB Set | IPS000045 |
IMGT/LIGM-DB reference sequence Classification |
Species | Homo sapiens |
IMGT group | IGKV | |
IMGT subgroup | IGKV2 | |
IMGT gene name | IGKV2D-29 | |
IMGT allele name | IGKV2D-29*01 | |
Classification comments and specificity | IGKV2D-29 is a pseudogene |
IMGT/PRIMER-DB Primer labels |
|
|||||||||
Differences between the IMGT/LIGM-DB reference sequence and the primer sequence |
Modified: T8 is replaced by G8 in primer sequence Modified: T9 is replaced by A9 in primer sequence Modified: T10 is replaced by G10 in primer sequence |
|||||||||
Restriction enzyme name | ||||||||||
Restriction site position | ||||||||||
Purification methods | ||||||||||
Keywords | ||||||||||
Description comments |