IMGT/PRIMER-DB Primer accession number | IPP700002 |
IMGT/PRIMER-DB entry date | 04/11/2003 |
IMGT/PRIMER-DB update | 05/11/2003 |
IMGT/PRIMER-DB Primer definition | Homo sapiens IGKV2D-29*01 Antisense primer Antisense |
Primer alias name | AF68 |
Bibliographic references (PubMed) |
PMID: 8662073 |
Catalogue comments | IGKV2D-29*01 Allele specific |
IMGT/PRIMER-DB Primer sequence | 30 pb; 8 A; 10 C; 10 G; 2 T; 0 other 5' CTGAGCGCCGCCCAGACAAGCAGTGCAAG 3' |
IMGT/PRIMER-DB Sequence length (number of nucleotides) | 30 |
IMGT/PRIMER-DB Primer orientation | Antisense |
IMGT/LIGM-DB reference sequence Accession number |
M31952 |
IMGT/LIGM-DB reference sequence Primer position (start-end) |
1109-1138 |
Primer Localization |
CCGACAAGAATTTGGAAGCCCTGACATCCTATAAAACGTTACTTGCCCAAGATTGAAACT 60 |
Characteristics comments | |
IMGT/PRIMER-DB Set | IPS000047 |
IMGT/LIGM-DB reference sequence Classification |
Species | Homo sapiens |
IMGT group | IGKV | |
IMGT subgroup | IGKV2 | |
IMGT gene name | IGKV2D-29 | |
IMGT allele name | IGKV2D-29*01 | |
Classification comments and specificity |
IMGT/PRIMER-DB Primer labels |
|
|||||||||
Differences between the IMGT/LIGM-DB reference sequence and the primer sequence |
Modified: T7 is replaced by G7 in primer sequence Modified: A8 is replaced by G8 in primer sequence Modified: T10 is replaced by C10 in primer sequence Modified: C11 is replaced by G11 in primer sequence |
|||||||||
Restriction enzyme name | ||||||||||
Restriction site position | ||||||||||
Purification methods | ||||||||||
Keywords | ||||||||||
Description comments |