IMGT/PRIMER-DB Primer accession number | IPP800004 |
IMGT/PRIMER-DB entry date | 25/11/2003 |
IMGT/PRIMER-DB update | 25/11/2003 |
IMGT/PRIMER-DB Primer definition | Homo sapiens IGKV2-29*01 Sense primer Sense |
Primer alias name | 5'A183 |
Bibliographic references (PubMed) |
PMID: 9234481 |
Catalogue comments | IGKV2-29 gene specific |
IMGT/PRIMER-DB Primer sequence | 20 pb; 5 A; 4 C; 5 G; 6 T; 0 other 5' TAATTTCAGGATCCAGTGCG 3' |
IMGT/PRIMER-DB Sequence length (number of nucleotides) | 20 |
IMGT/PRIMER-DB Primer orientation | Sense |
IMGT/LIGM-DB reference sequence Accession number |
X63396 |
IMGT/LIGM-DB reference sequence Primer position (start-end) |
729-748 |
Primer Localization |
...CCTAAAAGCAGT 540 |
Characteristics comments | IGKV2-29*01 Allele chosen as a representative of the IGKV2-29 Gene |
IMGT/PRIMER-DB Set | IPS000154 |
IMGT/LIGM-DB reference sequence Classification |
Species | Homo sapiens |
IMGT group | IGKV | |
IMGT subgroup | IGKV2 | |
IMGT gene name | IGKV2-29 | |
IMGT allele name | IGKV2-29*01 | |
Classification comments and specificity | The most 3' nucleotide G allows to specifically hybridize IGKV2-29 alleles at the exception of the IGKV2-29*03 allele (L-PART2 g12>a) which has a A at position 12 as the IGKV2D-29 gene. |
IMGT/PRIMER-DB Primer labels |
|
||||||
Differences between the IMGT/LIGM-DB reference sequence and the primer sequence |
|||||||
Restriction enzyme name | |||||||
Restriction site position | |||||||
Purification methods | |||||||
Keywords | |||||||
Description comments |