IMGT/PRIMER-DB Primer accession number | IPP800005 |
IMGT/PRIMER-DB entry date | 25/11/2003 |
IMGT/PRIMER-DB update | 25/11/2003 |
IMGT/PRIMER-DB Primer definition | Homo sapiens IGKV2-29*01 Antisense primer Antisense |
Primer alias name | 3'A182 |
Bibliographic references (PubMed) |
Eurogentec |
Catalogue comments | IGKV2-29 gene specific |
IMGT/PRIMER-DB Primer sequence | 18 pb; 7 A; 6 C; 4 G; 1 T; 0 other 5' CCCAGACAAGCAGTGCAA 3' |
IMGT/PRIMER-DB Sequence length (number of nucleotides) | 18 |
IMGT/PRIMER-DB Primer orientation | Antisense |
IMGT/LIGM-DB reference sequence Accession number |
X63396 |
IMGT/LIGM-DB reference sequence Primer position (start-end) |
1124-1107 |
Primer Localization |
GACAAGAATTTGGAAGCCCTGACATCCTATAAAACGTTACTTGCCCAAGATTGAAACTTT 60 |
Characteristics comments | IGKV2-29*01 Allele chosen as a representative of the IGKV2-29 Gene |
IMGT/PRIMER-DB Set | IPS000155 |
IMGT/LIGM-DB reference sequence Classification |
Species | Homo sapiens |
IMGT group | IGKV | |
IMGT subgroup | IGKV2 | |
IMGT gene name | IGKV2-29 | |
IMGT allele name | IGKV2-29*01 | |
Classification comments and specificity |
IMGT/PRIMER-DB Primer labels |
|
|||||||||
Differences between the IMGT/LIGM-DB reference sequence and the primer sequence |
||||||||||
Restriction enzyme name | ||||||||||
Restriction site position | ||||||||||
Purification methods | ||||||||||
Keywords | ||||||||||
Description comments |