| IMGT/PRIMER-DB Primer accession number | IPP900099 |
| IMGT/PRIMER-DB entry date | 03/01/2005 |
| IMGT/PRIMER-DB update | 03/01/2005 |
| IMGT/PRIMER-DB Primer definition | Homo sapiens Sense primer Sense |
| Primer alias name | BCL1/MTC |
| Bibliographic references (PubMed) |
PMID: 14671650 |
| Catalogue comments | BCL1-MTC specific , BCL1-MTC: Major translocation cluster located 123 kb dowstream of the CCND1 gene |
| IMGT/PRIMER-DB Primer sequence | 21 pb; 9 A; 2 C; 8 G; 2 T; 0 other 5' GGATAAAGGCGAGGAGCATAA 3' |
| IMGT/PRIMER-DB Sequence length (number of nucleotides) | 21 |
| IMGT/PRIMER-DB Primer orientation | Sense |
| IMGT/LIGM-DB reference sequence Accession number |
S77049 |
| IMGT/LIGM-DB reference sequence Primer position (start-end) |
286-306 |
| Primer Localization |
Incomplete annotation for this Primer. Please make a new attempt later on. |
| Characteristics comments | |
| IMGT/PRIMER-DB Set | IPS000222 |
| IMGT/LIGM-DB reference sequence Classification |
Species | Homo sapiens |
| IMGT group | CCND1 (BCL) | |
| IMGT subgroup | ||
| IMGT gene name | ||
| IMGT allele name | ||
| Classification comments and specificity | ||
| IMGT/PRIMER-DB Primer labels |
|
|||||||||
| Differences between the IMGT/LIGM-DB reference sequence and the primer sequence |
||||||||||
| Restriction enzyme name | ||||||||||
| Restriction site position | ||||||||||
| Purification methods | ||||||||||
| Keywords | ||||||||||
| Description comments | ||||||||||