IMGT®, the international ImMunoGeneTics information system®

logo IMGT

FASTA format

fr

Definition and description

IMGT FASTA header of nucleotide IMGT reference sequences


The IMGT FASTA header of nucleotide IMGT  reference sequences contains 15 fields separated by '|':
1. IMGT/LIGM-DB accession number(s)
2. IMGT gene and allele name
3. species
4. IMGT allele functionality
5. exon(s), region name(s), or extracted label(s)
6. start and end positions in the IMGT/LIGM-DB accession number(s)
7. number of nucleotides in the IMGT/LIGM-DB accession number(s)
8. codon start, or 'NR' (not relevant) for non coding labels
9. +n: number of nucleotides (nt) added in 5' compared to the corresponding label extracted from IMGT/LIGM-DB
10. +n or -n: number of nucleotides (nt) added or removed in 3' compared to the corresponding label extracted from IMGT/LIGM-DB
11. +n, -n, and/or nS: number of added, deleted, and/or substituted nucleotides to correct sequencing errors, or 'not corrected' if non corrected sequencing errors
12. number of amino acids (AA): this field indicates that the sequence is in amino acids
13. number of characters in the sequence: nt (or AA)+IMGT gaps=total
14. partial (if it is)
15. reverse complementary (if it is)

>M99641|IGHV1-18*01|Homo sapiens|F|V-REGION|188..483|296 nt|1| | | | |296+24=320| | |
caggttcagctggtgcagtctggagct...gaggtgaagaagcctggggcctcagtgaag
gtctcctgcaaggcttctggttacaccttt............accagctatggtatcagc
tgggtgcgacaggcccctggacaagggcttgagtggatgggatggatcagcgcttac...
...aatggtaacacaaactatgcacagaagctccag...ggcagagtcaccatgaccaca
gacacatccacgagcacagcctacatggagctgaggagcctgagatctgacgacacggcc
gtgtattactgtgcgagaga


Examples of nucleotide sequences in FASTA format