Citing IMGT databases: Manso T. et al. IMGT® databases, related tools and web resources through three main axes of research and development. Nucleic Acids Res. 2022 Jan 7;50(D1):D1262-D1272. doi: 10.1093/nar/gkab1136 PMID: 34875068 Free PMC article.
Program version: v. 

Add the possibility to obtain a gene table per strain (for mouse now and for other species later) and allotypes/isotypes for human.
September 25th, 2024.

Bibliographical references in alphabetic order, small design changes and addition of "NL" for non-localized gene.
June 14th, 2024.

Addition of 'Score for IMGT allele confirmation' as well as NCBI TPA accession numbers.
September 20th, 2023.

Implementation of the dynamic gene table.

Gene table legend:

"+" or "-" indicates if the gene sequences have been found (+) or not been found (-) rearranged (R), transcribed (T) and/or translated into protein (Pr). Arbitrarily that information is shown on the first line of each gene, when the data have been confirmed by several studies.

Functionality is shown in parentheses, (F) and (P), when the accession number refers to rearranged genomic DNA or cDNA and the corresponding germline gene has not yet been isolated.

IMGT allele confirmation: A scoring system is employed to indicate the number of IMGT/LIGM-DB reference sequences and other sequences from the literature in which an IG or TR gene allele has been identified and annotated.

A single star ()
indicates that an IG or TR gene allele is annotated in the reference sequence only.
Two stars ()
indicate that an IG or TR gene allele is annotated in its reference sequence and in one sequence from the literature.
Three stars ()
indicate that an IG or TR gene allele is annotated in its reference sequence and in at least two sequences from the literature.
In the Excel file, the stars are represented by the plus symbol (+).
Click on:
  • IMGT gene name to get the corresponding IMGT/GENE-DB entry (link).
  • IMGT allele name to see the corresponding Alignments of alleles (link).
  • Accession number to get the corresponding IMGT/LIGM-DB entry (link).
  • MAP: mapped sequences. Click to access GENE-DB «LOCALIZATION IN GENOME ASSEMBLIES» (link).
  • [number] to access the corresponding IMGT reference (popover).
  • (number) to see the corresponding IMGT note (popover).
Options:
  • You can show/hide columns (), download data () or put the table in fullscreen () using buttons.
See also (IMGT Scientific chart):
Select a species and a IMGT group to get the gene table:
Only IMGT available species/group are shown in the drop-down list.
The gene table can take several seconds to appear, please be patient.
Gene table of sheep (Ovis aries) TRDV IMGT group:
IMGT sub­groupIMGT gene nameIMGT allele nameScore for
IMGT allele
confirmation
FctChromosomosal
localization
R T PrIMGT/LIGM-DB reference sequencesIMGT/LIGM-DB sequences from the literature
Clone namesBreedAccession
numbers
Positions
in the sequence
(L-V-GENE-UNIT)
or V-REGION (*)
Secondary
accession
numbers
Clone namesBreedAccession
numbers
Positions
in the sequence
(L-V-GENE-UNIT)
or V-REGION (*)
TRDV1TRDV1-1 TRDV1-1*01 (1) 7 CM008478.1 Rambouillet BK064708 [2,3] MAP 255732-256330
TRDV1TRDV1-2 TRDV1-2*01 F 7 CM008478.1 Rambouillet BK064708 [2,3] MAP 292343-292942
TRDV1TRDV1-2 TRDV1-2*02 F 7 TRDV1S17*01 Texel NW_004082010 (33) complement(2242-2843)
TRDV1TRDV1-2D TRDV1-2D*01 F 7 CM008478.1 Rambouillet BK064708 [2,3] MAP 1955919-1956519
TRDV1TRDV1-3 TRDV1-3*01 F 7 CM008478.1 Rambouillet BK064708 [2,3] MAP 388875-389476
TRDV1TRDV1-4 TRDV1-4*01 (2) 7 CM008478.1 Rambouillet BK064708 [2,3] MAP 589887-590491
TRDV1TRDV1-5 TRDV1-5*01 F 7 CM008478.1 Rambouillet BK064708 [2,3] MAP 621023-621629 pzVD57 Gentile di Puglia AJ868225 [1] 279-571 *
TRDV1TRDV1-5 TRDV1-5*02 F 7 TRDV1S1*01 Texel OviAri_3_chr7 (33) [4] complement(53142-53747)
TRDV1TRDV1-5 TRDV1-5*03 F 7 LD21, pzD21.3 Altamurana AJ786840 [1] (33) 567-1174
TRDV1TRDV1-6 TRDV1-6*01 (3) 7 CM008478.1 Rambouillet BK064708 [2,3] MAP 637507-638113
TRDV1TRDV1-7 TRDV1-7*01 (4) 7 CM008478.1 Rambouillet BK064708 [2,3] MAP 669413-670005
TRDV1TRDV1-8 TRDV1-8*01 F 7 CM008478.1 Rambouillet BK064708 [2,3] MAP 730543-731148
TRDV1TRDV1-8 TRDV1-8*02 F 7 LD33, pzD33.15 Altamurana AJ786834 [1] (33) 559-1164
TRDV1TRDV1-8 TRDV1-8*03 ORF (5) 7
RTPr
++
pzVD65 Gentile di Puglia AJ868223 [1] (33) 278-570 *
TRDV1TRDV1-9 TRDV1-9*01 F 7 CM008478.1 Rambouillet BK064708 [2,3] MAP 753240-753848
TRDV1TRDV1-9 TRDV1-9*02 F 7 TRDV1S14*01 Texel NW_004081110 (33) complement(12470-13071)
TRDV1TRDV1-10 TRDV1-10*01 (6) 7 CM008478.1 Rambouillet BK064708 [2,3] MAP complement(780119-780725)
TRDV1TRDV1-11 TRDV1-11*01 (7) 7 CM008478.1 Rambouillet BK064708 [2,3] MAP complement(790174-790756)
TRDV1TRDV1-12 TRDV1-12*01 F 7 CM008478.1 Rambouillet BK064708 [2,3] MAP 811026-811631
TRDV1TRDV1-12 TRDV1-12*02 (8) 7 TRDV1S26*01 Texel OviAri_3_chr7 (33) [4] complement(54434-55161)
TRDV1TRDV1-13 TRDV1-13*01 F 7 CM008478.1 Rambouillet BK064708 [2,3] MAP 905853-906458
TRDV1TRDV1-14 TRDV1-14*01 ORF (9) 7 CM008478.1 Rambouillet BK064708 [2,3] MAP 941359-941930
TRDV1TRDV1-15 TRDV1-15*01 (10) 7 CM008478.1 Rambouillet BK064708 [2,3] MAP <955753->955969 *
TRDV1TRDV1-16 TRDV1-16*01 (3) 7 CM008478.1 Rambouillet BK064708 [2,3] MAP 970372-970944
TRDV1TRDV1-17 TRDV1-17*01 (11) 7 CM008478.1 Rambouillet BK064708 [2,3] MAP complement(983073-983645)
TRDV1TRDV1-17 TRDV1-17*02 ORF (9) 7 LD2 Altamurana AJ786836 [1] (33) 280-539 *
TRDV1TRDV1-18 TRDV1-18*01 F 7 CM008478.1 Rambouillet BK064708 [2,3] MAP complement(1016814-1017421)
TRDV1TRDV1-18 TRDV1-18*02 F 7 TRDV1S13*01 Texel NW_004080352 (33) 1959-2566
TRDV1TRDV1-19 TRDV1-19*01 (3) 7 CM008478.1 Rambouillet BK064708 [2,3] MAP 1037344-1037952
TRDV1TRDV1-20 TRDV1-20*01 ORF (9) 7 CM008478.1 Rambouillet BK064708 [2,3] MAP 1053541-1054115
TRDV1TRDV1-21 TRDV1-21*01 F 7 CM008478.1 Rambouillet BK064708 [2,3] MAP 1065001-1065607
TRDV1TRDV1-22 TRDV1-22*01 F 7 CM008478.1 Rambouillet BK064708 [2,3] MAP 1091144-1091752 TRDV1S2*01 Texel OviAri_3_chr7 [4] complement(41653-42262)
TRDV1TRDV1-23 TRDV1-23*01 ORF (9) 7 CM008478.1 Rambouillet BK064708 [2,3] MAP 1125759-1126331
TRDV1TRDV1-24 TRDV1-24*01 (3) 7 CM008478.1 Rambouillet BK064708 [2,3] MAP 1138749-1139292
TRDV1TRDV1-25 TRDV1-25*01 (12) 7 CM008478.1 Rambouillet BK064708 [2,3] MAP 1151716-1152289
TRDV1TRDV1-25 TRDV1-25*02 (13) 7 TRDV1S24*01 Texel NW_004083226 (33) 4873-5431
TRDV1TRDV1-26 TRDV1-26*01 (14) 7 CM008478.1 Rambouillet BK064708 [2,3] MAP 1186083-1186684
TRDV1TRDV1-26 TRDV1-26*02 (14) 7 TRDV1S15*01 Texel NW_004081259 (33) complement(2886-3486)
TRDV1TRDV1-27 TRDV1-27*01 F 7 CM008478.1 Rambouillet BK064708 [2,3] MAP 1203531-1204122 pzVD47 Gentile di Puglia AJ809503 [1] 271-556 *
TRDV1TRDV1-28 TRDV1-28*01 (15) 7 CM008478.1 Rambouillet BK064708 [2,3] MAP 1244752-1245344 pzVD110 Gentile di Puglia AJ809507 [1] ORF (5) (34) 272-557 *
TRDV1TRDV1-29 TRDV1-29*01 (16) 7 CM008478.1 Rambouillet BK064708 [2,3] MAP 1263316-1263927
TRDV1TRDV1-30 TRDV1-30*01 (17) 7 CM008478.1 Rambouillet BK064708 [2,3] MAP complement(1444598-1445214)
TRDV1TRDV1-31 TRDV1-31*01 F 7 CM008478.1 Rambouillet BK064708 [2,3] MAP complement(1500401-1501001)
TRDV1TRDV1-32 TRDV1-32*01 F 7 CM008478.1 Rambouillet BK064708 [2,3] MAP complement(1539200-1539792)
TRDV1TRDV1-33 TRDV1-33*01 F 7 CM008478.1 Rambouillet BK064708 [2,3] MAP complement(1562966-1563575)
TRDV1TRDV1-33 TRDV1-33*02 (17) 7 TRDV1S4*01 Texel OviAri_2_chr7 (33) [4] 299287-299894
TRDV1TRDV1-34 TRDV1-34*01 F 7 CM008478.1 Rambouillet BK064708 [2,3] MAP complement(1589629-1590229)
TRDV1TRDV1-34 TRDV1-34*02 (18) 7 TRDV1S5*01 Texel OviAri_2_chr7 (33) [4] 270875->271151 *
TRDV1TRDV1-35 TRDV1-35*01 F 7 CM008478.1 Rambouillet BK064708 [2,3] MAP complement(1620303-1620903)
TRDV1TRDV1-36 TRDV1-36*01 (3) 7 CM008478.1 Rambouillet BK064708 [2,3] MAP 1699094-1699665
TRDV1TRDV1-37 TRDV1-37*01 (19) 7 CM008478.1 Rambouillet BK064708 [2,3] MAP 1747037-1747667
TRDV1TRDV1-38 TRDV1-38*01 (20) 7 CM008478.1 Rambouillet BK064708 [2,3] MAP 1763113-1763706
TRDV1TRDV1-39 TRDV1-39*01 F 7 CM008478.1 Rambouillet BK064708 [2,3] MAP 1779449-1780062
TRDV1TRDV1-40 TRDV1-40*01 F 7 CM008478.1 Rambouillet BK064708 [2,3] MAP 1792694-1793302
TRDV1TRDV1-40 TRDV1-40*02 F 7 TRDV1S20*01 Texel NW_004082507 (33) [4] complement(47564-48172)
TRDV1TRDV1-41 TRDV1-41*01 (21) 7 CM008478.1 Rambouillet BK064708 [2,3] MAP 1797373-1797944
TRDV1TRDV1-42 TRDV1-42*01 F 7 CM008478.1 Rambouillet BK064708 [2,3] MAP 1813277-1813902 LD14A, pzD14.28 Altamurana AJ786839 [1] 750-1375
TRDV1S6*01 Texel OviAri_2_chr7 [4] complement(254755-255047) *
TRDV1TRDV1-43 TRDV1-43*01 F 7
RTPr
++
CM008478.1 Rambouillet BK064708 [2,3] MAP 1826064-1826672 pzVD46 Gentile di Puglia AJ868221 [1] 282-573 *
TRDV1TRDV1-43 TRDV1-43*02 (22) 7 TRDV1S7*01 Texel OviAri_2_chr7 (33) [4] complement(240114-240759)
TRDV1TRDV1-43 TRDV1-43*03 F 7 LD14B, pzD14.5 Altamurana AJ786831 [1] (33) 4-612
TRDV1TRDV1-44 TRDV1-44*01 ORF (23) 7 CM008478.1 Rambouillet BK064708 [2,3] MAP 1837606-1838181 TRDV1S8*01 Texel OviAri_2_chr7 [4] complement(228721-229296)
TRDV1TRDV1-45 TRDV1-45*01 (24) 7 CM008478.1 Rambouillet BK064708 [2,3] MAP 1868159->1868428 * TRDV1S9*01 Texel OviAri_2_chr7 [4] complement(<206901-207170) *
TRDV1TRDV1-46 TRDV1-46*01 F 7 CM008478.1 Rambouillet BK064708 [2,3] MAP 1889839-1890432
TRDV1TRDV1-46 TRDV1-46*02 ORF (5) 7 LD4 Altamurana AJ786829 [1] (33) 270-555 * pzVD14 Gentile di Puglia AJ868219 [1] 273-558 *
TRDV1TRDV1-47 TRDV1-47*01 (20) 7 CM008478.1 Rambouillet BK064708 [2,3] MAP 1969348-1969924
TRDV1TRDV1-48 TRDV1-48*01 F 7 CM008478.1 Rambouillet BK064708 [2,3] MAP 2016557-2017068 TRDV1S10*01 Texel OviAri_2_chr7 [4] complement(195461-195971)
TRDV1TRDV1-49 TRDV1-49*01 F 7 CM008478.1 Rambouillet BK064708 [2,3] MAP 2031592-2032117
TRDV1TRDV1-50 TRDV1-50*01 (25) 7 CM008478.1 Rambouillet BK064708 [2,3] MAP 2044723-2045043 *
TRDV1TRDV1-51 TRDV1-51*01 (20) 7 CM008478.1 Rambouillet BK064708 [2,3] MAP 2058528-2059054
TRDV1TRDV1-52 TRDV1-52*01 F 7 CM008478.1 Rambouillet BK064708 [2,3] MAP 2072459-2073054
TRDV1TRDV1-53 TRDV1-53*01 F 7 CM008478.1 Rambouillet BK064708 [2,3] MAP 2090266-2090858
TRDV1TRDV1-53 TRDV1-53*02 ORF (5) 7
RTPr
++
pzVD86 Gentile di Puglia AJ809501 [1] (33) 275-560 *
TRDV1TRDV1-54 TRDV1-54*01 (14) 7 CM008478.1 Rambouillet BK064708 [2,3] MAP 2118725-2119326
TRDV1TRDV1-54 TRDV1-54*02 ORF (26) 7 LD15A, pzL15.22 Altamurana AJ786838 [1] (33) 554-1155
TRDV1TRDV1-54 TRDV1-54*03 ORF (26) 7 pzVD63 Gentile di Puglia AJ868224 [1] (33) 280-566 *
TRDV1TRDV1-55 TRDV1-55*01 (20) 7 CM008478.1 Rambouillet BK064708 [2,3] MAP 2136250-2136850
TRDV1TRDV1-56 TRDV1-56*01 (14) 7 CM008478.1 Rambouillet BK064708 [2,3] MAP 2157269-2157869
TRDV1TRDV1-57 TRDV1-57*01 F 7 CM008478.1 Rambouillet BK064708 [2,3] MAP 2174739-2175333
TRDV1TRDV1-58 TRDV1-58*01 (3) 7 CM008478.1 Rambouillet BK064708 [2,3] MAP 2186056-2186651
TRDV1TRDV1-59 TRDV1-59*01 (27) 7 CM008478.1 Rambouillet BK064708 [2,3] MAP 2195915-2196507
TRDV1TRDV1-60 TRDV1-60*01 F 7 CM008478.1 Rambouillet BK064708 [2,3] MAP 2207117-2207709
TRDV1TRDV1-61 TRDV1-61*01 (3) 7 CM008478.1 Rambouillet BK064708 [2,3] MAP 2221162-2221661
TRDV1TRDV1-62 TRDV1-62*01 (19) 7 CM008478.1 Rambouillet BK064708 [2,3] MAP 2235256-2235855
TRDV1TRDV1-62 TRDV1-62*02 F 7 TRDV1S11*01 Texel OviAri_2_chr7 (33) [4] complement(180907-181509)
TRDV1TRDV1-63 TRDV1-63*01 F 7 CM008478.1 Rambouillet BK064708 [2,3] MAP 2254634-2255226
TRDV1TRDV1-63 TRDV1-63*02 F 7 TRDV1S19*01 Texel NW_004082203 (33) complement(1992-2586)
TRDV1TRDV1-64 TRDV1-64*01 (20) 7 CM008478.1 Rambouillet BK064708 [2,3] MAP 2265752-2266327
TRDV1TRDV1-65 TRDV1-65*01 F 7
RTPr
++
CM008478.1 Rambouillet BK064708 [2,3] MAP 2283169-2283761
TRDV1TRDV1S1 NL TRDV1S1*01 F 7 TRDV1S3*01 Texel OviAri_2_chr7 (33) [4] complement(362191-362783)
TRDV1TRDV1S1 NL TRDV1S1*02 F 7 TRDV1S12*01 Texel NW_004080312 (33) 1399-1991
TRDV1TRDV1S1 NL TRDV1S1*03 F 7 LD26, pzD26.28 Altamurana AJ786828 [1] (33) 37-630 pzVD61 Gentile di Puglia AJ868218 [1] 273-558 *
TRDV1TRDV1S2 NL TRDV1S2*01 ORF (28) 7 TRDV1S16*01 Texel NW_004081954 (33) 3011->3251 *
TRDV1TRDV1S3 NL TRDV1S3*01 F 7 TRDV1S18*01 Texel NW_004082156 (33) 1064-1572
TRDV1TRDV1S4 NL TRDV1S4*01 F 7 TRDV1S23*01 Texel NW_004082507 (33) [4] complement(2700-3303)
TRDV1TRDV1S5 NL TRDV1S5*01 F 7
RTPr
++
TRDV1S22*01 Texel NW_004082507 (33) [4] complement(15155-15655)
TRDV1TRDV1S6 NL TRDV1S6*01 ORF (29) 7 TRDV1S21*01 Texel NW_004082507 (33) [4] complement(43056-43628)
TRDV1TRDV1S7 NL TRDV1S7*01 F 7 TRDV1S25*01 Texel NW_004083566 (33) complement(271-865)
TRDV1TRDV1S8 NL TRDV1S8*01 F 7 LD29, pzG29.35 Altamurana AJ786827 [1] (33) 346-935 pzVD91 Gentile di Puglia AJ868217 [1] 272-555 *
TRDV1TRDV1S9 NL TRDV1S9*01 F 7
RTPr
++
LD30, pzD30.36 Altamurana AJ786830 [1] (33) 160-755
TRDV1TRDV1S9 NL TRDV1S9*02 ORF (5) 7 pzVD84 Gentile di Puglia AJ868220 [1] (33) 273-559 *
TRDV1TRDV1S10 NL TRDV1S10*01 F 7 LD37, pzL37.17 Altamurana AJ786832 [1] (33) 826-1419
TRDV1TRDV1S10 NL TRDV1S10*02 ORF (5) 7 pzVD100 Gentile di Puglia AJ868222 [1] (33) 271-558 *
TRDV1TRDV1S11 NL TRDV1S11*01 F 7 LD15B, pzL15.3 Altamurana AJ786833 [1] (33) 1-595
TRDV1TRDV1S12 NL TRDV1S12*01 F 7 LD13, pzD13.08 Altamurana AJ786835 [1] (33) 55-699
TRDV1TRDV1S13 NL TRDV1S13*01 ORF (5) 7 LD1 Altamurana AJ786837 [1] (33) 280-571 *
TRDV1TRDV1S14 NL TRDV1S14*01 F 7 LD34, pzL34.2 Altamurana AJ786841 [1] (33) 293-894
TRDV1TRDV1S15 NL TRDV1S15*01 ORF (5) 7 pzVD5 Gentile di Puglia AJ809502 [1] (33) 292-584 *
TRDV1TRDV1S16 NL TRDV1S16*01 ORF (30) 7 pzVD60 Gentile di Puglia AJ809504 [1] (33) 272-557 *
TRDV1TRDV1S17 NL TRDV1S17*01 ORF (5) 7 pzVD92 Gentile di Puglia AJ809505 [1] (33) 301-593 *
TRDV1TRDV1S18 NL TRDV1S18*01 ORF (5) 7 pzVD105 Gentile di Puglia AJ809506 [1] (33) 272-563 *
TRDV2TRDV2 TRDV2*01 ORF (31) 7 CM008478.1 Rambouillet BK064708 [2,3] MAP 2634184-2634712
TRDV2TRDV2 TRDV2*02 ORF (31) 7 TRDV2S2*01 Texel OviAri_1_chr7 (33) complement(320807-321335)
TRDV3TRDV3 TRDV3*01 F 7 CM008478.1 Rambouillet BK064708 [2,3] MAP complement(2765508-2766131) TRDV4-1*01 Texel OviAri_1_chr7 199768-200391
TRDV3TRDV3 TRDV3*02 F 7 LMCD, pzD30 Altamurana AJ810117 [1] (33) 599-1222
TRDV4TRDV4 TRDV4*01 (32) 7 CM008478.1 Rambouillet BK064708 [2,3] MAP 2610461-2611002 Texel OviAri_1_chr7 complement(344518-345059)
TRDV5TRDV5 TRDV5*01 F 7
RTPr
++
CM008478.1 Rambouillet BK064708 [2,3] MAP 2568593-2569157
TRDV5TRDV5 TRDV5*02 F 7 TRDV3-1*01 Texel OviAri_1_chr7 (33) complement(388874-389438)

✤ : NCBI accession number that correspond to a previously internal IMGT accession number. See the correspondence table.

IMGT notes:
  1. frameshift in L-PART1, frameshift in V-REGION: deletion of 1 nt in FR3-IMGT
  2. no INIT-CODON: Thr instead of Met, frameshift in L-PART1, frameshift in V-REGION: deletion of 1 nt in FR3-IMGT
  3. frameshifts in V-REGION: several insertions and deletions
  4. frameshifts in V-REGION: deletion of 1 nt and insertion of 1 nt in FR3-IMGT
  5. functionality defined as ORF because partial gene in 3'
  6. frameshift in V-REGION: deletion of 1 nt in FR2-IMGT
  7. frameshifts in V-REGION: several deletions
  8. frameshift in L-PART1, no L-PART2, deletions in V-REGION: AA 1 to 20 are missing
  9. deletions in V-REGION: 9 AA are missing
  10. truncated pseudogene
  11. frameshifts in V-REGION: deletion of 1 nt and 1 nt in FR2-IMGT
  12. frameshift in L-PART1, frameshift in V-REGION: insertion of 1 nt in FR1-IMGT
  13. no CDR2-IMGT
  14. no CONSERVED-TRP: STOP-CODON instead of Trp
  15. frameshift in L-PART2
  16. frameshift in L-PART1, the splicing between the DONOR-SPLICE of L-PART1 and the ACCEPTOR-SPLICE of L-PART2 results into a STOP-CODON, frameshift in L-PART2, frameshifts in V-REGION: several insertions and deletions
  17. STOP-CODON in V-REGION: position 24
  18. deletions in V-REGION: AA 106 to 108 are missing, no V-RS
  19. frameshift in V-REGION: insertion of 1 nt in FR3-IMGT
  20. frameshift in L-PART1, frameshifts in V-REGION: several insertions and deletions
  21. STOP-CODON in V-REGION: position 87
  22. probable sequencing error by duplication of 51 nt (acgaataagataagtcatctgtccactgggaagctgcttgtaccaaaaaat) between nt 240289 and 240390
  23. noncanonical DONOR-SPLICE: ngc instead of ngt, deletions in V-REGION: 9 AA are missing
  24. deletions in V-REGION: AA 104 to 108 are missing, no V-RS
  25. no L-PART1, no L-PART2, frameshifts in V-REGION: several insertions and deletions, no V-NONAMER
  26. no CONSERVED-TRP: Ser instead of Trp
  27. frameshifts in V-REGION: several insertions
  28. functionality defined as ORF because partial gene in 5'
  29. noncanonical DONOR-SPLICE: ngc instead of ngt, deletions in V-REGION: 9 AA are missing, no 2nd-CYS: Ser instead of Cys
  30. no CONSERVED-TRP: Cys instead of Trp
  31. noncanonical V-NONAMER: tcaaaagac instead of acaaaaacc
  32. frameshift in V-REGION: insertion of 1 nt in FR1-IMGT
  33. Sequence not in locus reference sequence (assembly Oar_rambouillet_v1.0)
  34. functionality different from the reference sequence: ORF because partial gene in 3'
IMGT references:
  1. Antonacci R. et al., Artiodactyl emergence is accompanied by the birth of an extensive pool of diverse germline TRDV1 genes, Immunogenetics, vol. 57, no. 3-4, 2005, pp. 254-266. DOI: 10.1007/s00251-005-0773-7
  2. Manso,T. et al., IMGT(R) databases, related tools and web resources through three main axes of research and development, Nucleic Acids Res, vol. 50, no. D1, 2022, pp. D1262-D1272. PUBMED: 34875068
  3. Pegorier P et al., IMGT((R)) Biocuration and Comparative Analysis of Bos taurus and Ovis aries TRA/TRD Loci, Genes (Basel), vol. 12, no. 1, 2020, pp. E30-. PUBMED: 33379283
  4. Piccinni, Barbara et al. “Sheep (Ovis aries) T cell receptor alpha (TRA) and delta (TRD) genes and genomic organization of the TRA/TRD locus.” BMC genomics vol. 16 709. 18 Sep. 2015, DOI: 10.1186/s12864-015-1790-z