Here you are: IMGT Web resources > IMGT Repertoire (IG and TR) > 1. Locus and genes

"+" or "-" indicates if the gene sequences have been found (+) or not been found (-) rearranged (R), transcribed (T) and/or translated into protein (Pr). Arbitrarily that information is shown on the first line of each gene when the data have been confirmed by several studies.

Functionality is shown between parentheses, (F) and (P), when the accession number refers to rearranged genomic DNA or cDNA and the corresponding germline gene has not yet been isolated.
Functionality is shown between brackets, [F] and [P], when the accession number refers to genomic DNA, but not known as being germline or rearranged.

Click on:

IMGT subgroup IMGT gene name IMGT allele name Fct Chromosomal
R T Pr IMGT/LIGM-DB locus reference sequences IMGT/LIGM-DB sequences from the literature
Breed Clone names Accession numbers Positions in the sequence
Secondary accession numbers Breed Clone names Accession numbers Positions in the sequence
TRDV1 TRDV1-1 TRDV1-1*01 P (1) 7 Rambouillet CM008478.1 IMGT000048 MAP 255732..256330
TRDV1-2 TRDV1-2*01 F 7 Rambouillet CM008478.1 IMGT000048 MAP 292343..292942
TRDV1-2*02 F Texel TRDV1S17*01 NW_004082010 [1] (19) complement(2242..2843)
TRDV1-2D TRDV1-2D*01 F 7 Rambouillet CM008478.1 IMGT000048 MAP 1955919..1956519
TRDV1-3 TRDV1-3*01 F 7 Rambouillet CM008478.1 IMGT000048 MAP 388875..389476
TRDV1-4 TRDV1-4*01 P (2) 7 Rambouillet CM008478.1 IMGT000048 MAP 589887..590491
TRDV1-5 TRDV1-5*01 F 7 Rambouillet CM008478.1 IMGT000048 MAP 621023..621629 Gentile di Puglia pzVD57 AJ868225 [2] 279..571 (20)
TRDV1-5*02 F 7 Texel TRDV1S1*01 OviAri_3_chr7 [1] (19) MAP complement(53142..53747)
TRDV1-5*03 F Altamurana LD21, pzD21.3 AJ786840 [2] (19) 567..1174
TRDV1-6 TRDV1-6*01 P (3) 7 Rambouillet CM008478.1 IMGT000048 MAP 637507..638113
TRDV1-7 TRDV1-7*01 P (3) 7 Rambouillet CM008478.1 IMGT000048 MAP 669413..670005
TRDV1-8 TRDV1-8*01 F 7 Rambouillet CM008478.1 IMGT000048 MAP 730543..731148
TRDV1-8*02 F Altamurana LD33, pzD33.15 AJ786834 [2] (19) 559..1164
TRDV1-8*03 ORF (16) + + Gentile di Puglia pzVD65 AJ868223 [2] (19) 278..570 (20)
TRDV1-9 TRDV1-9*01 F 7 Rambouillet CM008478.1 IMGT000048 MAP 753240..753848
TRDV1-9*02 F Texel TRDV1S14*01 NW_004081110 [1] (19) complement(12470..13071)
TRDV1-10 TRDV1-10*01 P (4) 7 Rambouillet CM008478.1 IMGT000048 MAP complement(780119..780725)
TRDV1-11 TRDV1-11*01 P (3) 7 Rambouillet CM008478.1 IMGT000048 MAP complement(790174..790756)
TRDV1-12 TRDV1-12*01 F 7 Rambouillet CM008478.1 IMGT000048 MAP 811026..811631
TRDV1-12*02 P (5) 7 Texel TRDV1S26*01 OviAri_3_chr7 [1] (19) MAP complement(54434..55161)
TRDV1-13 TRDV1-13*01 F 7 Rambouillet CM008478.1 IMGT000048 MAP 905853..906458
TRDV1-14 TRDV1-14*01 ORF (6) 7 Rambouillet CM008478.1 IMGT000048 MAP 941359..941930
TRDV1-15 TRDV1-15*01 P (7) 7 Rambouillet CM008478.1 IMGT000048 MAP <955753..>955969 (20)
TRDV1-16 TRDV1-16*01 P (3) 7 Rambouillet CM008478.1 IMGT000048 MAP 970372..970944
TRDV1-17 TRDV1-17*01 P (3) 7 Rambouillet CM008478.1 IMGT000048 MAP complement(983073..983645)
TRDV1-17*02 ORF (22) Altamurana LD2 AJ786836 [2] (19) 280..539 (20)
TRDV1-18 TRDV1-18*01 F 7 Rambouillet CM008478.1 IMGT000048 MAP complement(1016814..1017421)
TRDV1-18*02 F Texel TRDV1S13*01 NW_004080352 [1] (19) 1959..2566
TRDV1-19 TRDV1-19*01 P (3) 7 Rambouillet CM008478.1 IMGT000048 MAP 1037344..1037952
TRDV1-20 TRDV1-20*01 ORF (6) 7 Rambouillet CM008478.1 IMGT000048 MAP 1053541..1054115
TRDV1-21 TRDV1-21*01 F 7 Rambouillet CM008478.1 IMGT000048 MAP 1065001..1065607
TRDV1-22 TRDV1-22*01 F 7 Rambouillet CM008478.1 IMGT000048 MAP 1091144..1091752 Texel TRDV1S2*01 OviAri_3_chr7 [1] MAP complement(41653..42262)
TRDV1-23 TRDV1-23*01 ORF (6) 7 Rambouillet CM008478.1 IMGT000048 MAP 1125759..1126331
TRDV1-24 TRDV1-24*01 P (3) 7 Rambouillet CM008478.1 IMGT000048 MAP 1138749..1139292
TRDV1-25 TRDV1-25*01 P (1) 7 Rambouillet CM008478.1 IMGT000048 MAP 1151716..1152289
TRDV1-25*02 F Texel TRDV1S24*01 NW_004083226 [1] (19) 4873..5431
TRDV1-26 TRDV1-26*01 P (8) 7 Rambouillet CM008478.1 IMGT000048 MAP 1186083..1186684
TRDV1-26*02 P (8) Texel TRDV1S15*01 NW_004081259 [1] (19) complement(2886..3486)
TRDV1-27 TRDV1-27*01 F 7 Rambouillet CM008478.1 IMGT000048 MAP 1203531..1204122 Gentile di Puglia pzVD47 AJ809503 [2] 271..556 (20)
TRDV1-28 TRDV1-28*01 P (9) 7 Rambouillet CM008478.1 IMGT000048 MAP 1244752..1245344 Gentile di Puglia pzVD110 AJ809507 [2] (21) 272..557 (20)
TRDV1-29 TRDV1-29*01 P (10) 7 Rambouillet CM008478.1 IMGT000048 MAP 1263316..1263927
TRDV1-30 TRDV1-30*01 P (11) 7 Rambouillet CM008478.1 IMGT000048 MAP complement(1444598..1445214)
TRDV1-31 TRDV1-31*01 F 7 Rambouillet CM008478.1 IMGT000048 MAP complement(1500401..1501001)
TRDV1-32 TRDV1-32*01 F 7 Rambouillet CM008478.1 IMGT000048 MAP complement(1539200..1539792)
TRDV1-33 TRDV1-33*01 F 7 Rambouillet CM008478.1 IMGT000048 MAP complement(1562966..1563575)
TRDV1-33*02 P (11) 7 Texel TRDV1S4*01 OviAri_2_chr7 [1] (19) MAP 299287..299894
TRDV1-34 TRDV1-34*01 F 7 Rambouillet CM008478.1 IMGT000048 MAP complement(1589629..1590229)
TRDV1-34*02 P (6) 7 Texel TRDV1S5*01 OviAri_2_chr7 [1] (19) MAP 270875..>271151 (20)
TRDV1-35 TRDV1-35*01 F 7 Rambouillet CM008478.1 IMGT000048 MAP complement(1620303..1620903)
TRDV1-36 TRDV1-36*01 P (3) 7 Rambouillet CM008478.1 IMGT000048 MAP 1699094..1699665
TRDV1-37 TRDV1-37*01 P (4) 7 Rambouillet CM008478.1 IMGT000048 MAP 1747037..1747667
TRDV1-38 TRDV1-38*01 P (12) 7 Rambouillet CM008478.1 IMGT000048 MAP 1763113..1763706
TRDV1-39 TRDV1-39*01 F 7 Rambouillet CM008478.1 IMGT000048 MAP 1779449..1780062
TRDV1-40 TRDV1-40*01 F 7 Rambouillet CM008478.1 IMGT000048 MAP 1792694..1793302
TRDV1-40*02 F Texel TRDV1S20*01 NW_004082507 [1] (19) complement(47564..48172)
TRDV1-41 TRDV1-41*01 P (11) 7 Rambouillet CM008478.1 IMGT000048 MAP 1797373..1797944
TRDV1-42 TRDV1-42*01 F 7 Rambouillet CM008478.1 IMGT000048 MAP 1813277..1813902 Texel TRDV1S6*01 OviAri_2_chr7 [1] MAP complement(254755..255047) (20)
Altamurana LD14A, pzD14.28 AJ786839 [2] 750..1375
TRDV1-43 TRDV1-43*01 F 7 + + Rambouillet CM008478.1 IMGT000048 MAP 1826064..1826672 Gentile di Puglia pzVD46 AJ868221 [2] 282..573 (20)
TRDV1-43*02 P (13) 7 Texel TRDV1S7*01 OviAri_2_chr7 [1] (19) MAP complement(240114..240759)
TRDV1-43*03 F Altamurana LD14B, pzD14.5 AJ786831 [2] (19) 4..612
TRDV1-44 TRDV1-44*01 ORF (14) 7 Rambouillet CM008478.1 IMGT000048 MAP 1837606..1838181 Texel TRDV1S8*01 OviAri_2_chr7 [1] MAP complement(228721..229296)
TRDV1-45 TRDV1-45*01 P (6) 7 Rambouillet CM008478.1 IMGT000048 MAP 1868159..>1868428 (20) Texel TRDV1S9*01 OviAri_2_chr7 [1] MAP complement(<206901..207170) (20)
TRDV1-46 TRDV1-46*01 F 7 Rambouillet CM008478.1 IMGT000048 MAP 1889839..1890432
TRDV1-46*02 ORF (16) Altamurana LD4 AJ786829 [2] (19) 270..555 (20) Gentile di Puglia pzVD14 AJ868219 [2] 273..558 (20)
TRDV1-47 TRDV1-47*01 P (12) 7 Rambouillet CM008478.1 IMGT000048 MAP 1969348..1969924
TRDV1-48 TRDV1-48*01 F 7 Rambouillet CM008478.1 IMGT000048 MAP 2016557..2017068 Texel TRDV1S10*01 OviAri_2_chr7 [1] MAP complement(195461..195971)
TRDV1-49 TRDV1-49*01 F 7 Rambouillet CM008478.1 IMGT000048 MAP 2031592..2032117
TRDV1-50 TRDV1-50*01 P (15) 7 Rambouillet CM008478.1 IMGT000048 MAP 2044723..2045043 (20)
TRDV1-51 TRDV1-51*01 P (12) 7 Rambouillet CM008478.1 IMGT000048 MAP 2058528..2059054
TRDV1-52 TRDV1-52*01 F 7 Rambouillet CM008478.1 IMGT000048 MAP 2072459..2073054
TRDV1-53 TRDV1-53*01 F 7 Rambouillet CM008478.1 IMGT000048 MAP 2090266..2090858
TRDV1-53*02 ORF (8) + + Gentile di Puglia pzVD86 AJ809501 [2] (19) 275..560 (20)
TRDV1-54 TRDV1-54*01 P (8) 7 Rambouillet CM008478.1 IMGT000048 MAP 2118725..2119326
TRDV1-54*02 ORF (8) Altamurana LD15A, pzL15.22 AJ786838 [2] (19) 554..1155
TRDV1-54*03 ORF (8) Gentile di Puglia pzVD63 AJ868224 [2] (19) 280..566 (20)
TRDV1-55 TRDV1-55*01 P (12) 7 Rambouillet CM008478.1 IMGT000048 MAP 2136250..2136850
TRDV1-56 TRDV1-56*01 P (8) 7 Rambouillet CM008478.1 IMGT000048 MAP 2157269..2157869
TRDV1-57 TRDV1-57*01 F 7 Rambouillet CM008478.1 IMGT000048 MAP 2174739..2175333
TRDV1-58 TRDV1-58*01 P (3) 7 Rambouillet CM008478.1 IMGT000048 MAP 2186056..2186651
TRDV1-59 TRDV1-59*01 P (3) 7 Rambouillet CM008478.1 IMGT000048 MAP 2195915..2196507
TRDV1-60 TRDV1-60*01 F 7 Rambouillet CM008478.1 IMGT000048 MAP 2207117..2207709
TRDV1-61 TRDV1-61*01 P (3) 7 Rambouillet CM008478.1 IMGT000048 MAP 2221162..2221661
TRDV1-62 TRDV1-62*01 P (4) 7 Rambouillet CM008478.1 IMGT000048 MAP 2235256..2235855
TRDV1-62*02 F 7 Texel TRDV1S11*01 OviAri_2_chr7 [1] (19) MAP complement(180907..181509)
TRDV1-63 TRDV1-63*01 F 7 Rambouillet CM008478.1 IMGT000048 MAP 2254634..2255226
TRDV1-63*02 F Texel TRDV1S19*01 NW_004082203 [1] (19) complement(1992..2586)
TRDV1-64 TRDV1-64*01 P (12) 7 Rambouillet CM008478.1 IMGT000048 MAP 2265752..2266327
TRDV1-65 TRDV1-65*01 F 7 + + Rambouillet CM008478.1 IMGT000048 MAP 2283169..2283761
TRDV1S1 TRDV1S1*01 F 7 Texel TRDV1S3*01 OviAri_2_chr7 [1] (19) MAP complement(362191..362783)
TRDV1S1*02 F Texel TRDV1S12*01 NW_004080312 [1] (19) 1399..1991
TRDV1S1*03 F Altamurana LD26, pzD26.28 AJ786828 [2] (19) 37..630 Gentile di Puglia pzVD61 AJ868218 [2] 273..558 (20)
TRDV1S2 TRDV1S2*01 ORF (16) Texel TRDV1S16*01 NW_004081954 [1] (19) 3011..>3251 (20)
TRDV1S3 TRDV1S3*01 F Texel TRDV1S18*01 NW_004082156 [1] (19) 1064..1572
TRDV1S4 TRDV1S4*01 F Texel TRDV1S23*01 NW_004082507 [1] (19) complement(2700..3303)
TRDV1S5 TRDV1S5*01 F + + Texel TRDV1S22*01 NW_004082507 [1] (19) complement(15155..15655)
TRDV1S6 TRDV1S6*01 ORF (17) Texel TRDV1S21*01 NW_004082507 [1] (19) complement(43056..43628)
TRDV1S7 TRDV1S7*01 F Texel TRDV1S25*01 NW_004083566 [1] (19) complement(271..865)
TRDV1S8 TRDV1S8*01 F Altamurana LD29, pzG29.35 AJ786827 [2] (19) 346..935 Gentile di Puglia pzVD91 AJ868217 [2] 272..555 (20)
TRDV1S9 TRDV1S9*01 F + + Altamurana LD30, pzD30.36 AJ786830 [2] (19) 160..755
TRDV1S9*02 ORF (16) + + Gentile di Puglia pzVD84 AJ868220 [2] (19) 273..559 (20)
TRDV1S10 TRDV1S10*01 F Altamurana LD37, pzL37.17 AJ786832 [2] (19) 826..1419
TRDV1S10*02 ORF (16) Gentile di Puglia pzVD100 AJ868222 [2] (19) 271..558 (20)
TRDV1S11 TRDV1S11*01 F Altamurana LD15B, pzL15.3 AJ786833 [2] (19) 1..595
TRDV1S12 TRDV1S12*01 F Altamurana LD13, pzD13.08 AJ786835 [2] (19) 55..699
TRDV1S13 TRDV1S13*01 ORF (16) Altamurana LD1 AJ786837 [2] (19) 280..571 (20)
TRDV1S14 TRDV1S14*01 F Altamurana LD34, pzL34.2 AJ786841 [2] (19) 293..894
TRDV1S15 TRDV1S15*01 ORF (16) Gentile di Puglia pzVD5 AJ809502 [2] (19) 292..584 (20)
TRDV1S16 TRDV1S16*01 ORF (8) Gentile di Puglia pzVD60 AJ809504 [2] (19) 272..557 (20)
TRDV1S17 TRDV1S17*01 ORF (16) Gentile di Puglia pzVD92 AJ809505 [2] (19) 301..593 (20)
TRDV1S18 TRDV1S18*01 ORF (16) Gentile di Puglia pzVD105 AJ809506 [2] (19) 272..563 (20)
TRDV2 TRDV2 TRDV2*01 ORF (18) 7 Rambouillet CM008478.1 IMGT000048 MAP 2634184..2634712
TRDV2*02 ORF (18) 7 Texel TRDV2S2*01 OviAri_1_chr7 [1] (19) MAP complement(320807..321335)
TRDV3 TRDV3 TRDV3*01 F 7 Rambouillet CM008478.1 IMGT000048 MAP complement(2765508..2766131) Texel TRDV4-1*01 OviAri_1_chr7 [1] MAP 199768..200391
TRDV3*02 F Altamurana LMCD, pzD30 AJ810117 [2] (19) 599..1222
TRDV4 TRDV4 TRDV4*01 P (4) 7 Rambouillet CM008478.1 IMGT000048 MAP 2610461..2611002 Texel OviAri_1_chr7 [1] MAP complement(344518..345059)
TRDV5 TRDV5 TRDV5*01 F 7 Rambouillet CM008478.1 IMGT000048 MAP 2568593..2569157
TRDV5*02 F 7 + + Texel TRDV3-1*01 OviAri_1_chr7 [1] (19) MAP complement(388874..389438)

MAP: Mapped reference sequences.

IMGT notes:
  1. (1) frameshift in L-PART1, frameshift in V-REGION
  2. (2) no INIT-CODON, frameshift in L-PART1, frameshift in V-REGION
  3. (3) frameshifts in V-REGION
  4. (4) frameshift in V-REGION
  5. (5) frameshift in L-PART1, no L-PART2, deletions in V-REGION
  6. (6) deletions in V-REGION, no V-RS
  7. (7) truncated pseudogene
  8. (8) no CONSERVED-TRP
  9. (9) frameshift in L-PART2
  10. (10) frameshift in L-PART1, the splicing between the DONOR-SPLICE of L-PART1 and the ACCEPTOR-SPLICE of L-PART2 results into a STOP-CODON, frameshift in L-PART2, frameshifts in V-REGION
  11. (11) STOP-CODON in V-REGION
  12. (12) frameshift in L-PART1, frameshifts in V-REGION
  13. (13) probable sequencing error by duplication of 51 nt (acgaataagataagtcatctgtccactgggaagctgcttgtaccaaaaaat) between nt 240289 and 240390
  14. (14) noncanonical DONOR-SPLICE, deletions in V-REGION
  15. (15) no L-PART1, no L-PART2, frameshifts in V-REGION, no V-NONAMER
  16. (16) functionality defined as ORF because partial gene in 5'
  17. (17) noncanonical DONOR-SPLICE, deletions in V-REGION, no 2nd-CYS
  18. (18) noncanonical V-NONAMER
  19. (19) Sequence not in locus reference sequence (assembly Oar_rambouillet_v1.0)
  20. (20) Positions of V-REGION
  21. (21) functionality different from the reference sequence: ORF because partial gene in 3'
  22. (22) deletions in V-REGION
IMGT references:
  1. [1] Piccinni B. et al., BMC Genomics, 16:709 (2015). PMID:26383271
  2. [2] Antonacci R. et al., Immunogenetics, 57(3-4):254-266 (2005). PMID:15900497
Last updated:
Imène Chentli, Perrine Pégorier